Which of the following is the best example of positive peer pressure?

Answers

Answer 1

Answer:

1.Your friend says "no thanks" to the dinner your dad cooked and prefers to just hang out with friends instead.

2. Your teammates keep making fun of you for spending so much time studying for Friday's math test.

3. Your coworkers spend every weekend watching movies at Tim's house and invite you to join them.

4. Your friends all sign up for a free class at the gym and suggest you sign up for it, too.


Related Questions

Can some smart person help me out here!!!!!!!

Answers

Answer:

B

Explanation:

when you put it on a smooth surface and they're both at the same level it'll determine which one is faster and which one has less Mass. hope this helps much love .

There are no smart people available at the moment, but I'll try and help you.

Do the SECOND choice on the list. Keep the forces of the push on both blocks exactly equal. The block that jumps out ahead has less mass. The block that lags behind has more mass.

Which best compares kinetic energy and temperature?

Answers

Kinetic energy is energy of motion while temperature is a measure of that energy in substances.

Answer:

^ correct

Explanation:

Option A on edge 2020

Please help I need this right now

Answers

Answer:

The basket ball

Explanation:

The heavier an object is the more kinetic energy it will have even if it is thrown at the same speed; therefore, since the basketball is the heaviest, it is the logical answer.

While a marble is heavy for its size, it would not have the same kinetic energy as the basket ball.

Beach balls weigh the least out of the options given so this cannot be the answer.

Golf balls, while they are dense, they do not weigh nearly as much as a basketball would!

Hope this helps <3

Answer:

The answer is B the basketball

Explanation:

PLS HELP DUE AT 10 PM

Answers

I believe it is C hope i helped!

A constant force pushes a 5 kg brick at 10 N. If the mass was tripled, what would happen to the acceleration if the same force is applied?
(PLEASE SHOW WITH STEPS)

Answers

Explanation:

The original acceleration is:

∑F = ma

10 N = (5 kg) a

a = 2 m/s²

If the mass is tripled, the new acceleration is:

∑F = ma

10 N = (15 kg) a

a = 0.67 m/s²

The acceleration is reduced by a factor of 3.

Answer:

1.35 miles per second

Explanation:

1 step it depende the way and hight he is

2 step the mass of the brick it depends

3 if it was triplet the acceleration it would be 1.50

ALWAYS use significant figure rules. Remember that these rules apply to all numbers that are measurements.
In working this problem, assume the value of "g" to be 9.8 m/s2 with two (2) significant digits unless otherwise stated.
A machine exerts a 100 N force to the right over a 5.00 meter length in 4.00 seconds. Calculate the power output of this machine.

_____ W

500.
125
80.0
0.200

Answers

Answer:

The answer is 500

Explanation:

20 points HELP‼️ Which is more important in developing who
you are-environment or genetics? Explain why you believe this.

Answers

Answer:

Environment

Explanation:

Your Environment, More Than Genetics, Determines Your Immune Health. When it comes to immunity, the environment you grow up in, or how you were 'nurtured' , is more important than nature, a new study suggests. Particularly as you get older.

.
المرور
***
6. find the focal length of alens of power
-2.0D. what type of lens is this?

Answers

Answer:

[tex]-\frac{1}{2}[/tex]

Diverging lens

Explanation:

Given parameters:

Power of lens  = -2.0D

Unknown:

Focal length  = ?

Solution:

The power of lens is the reciprocal of the focal length;

   P  = [tex]\frac{1}{f}[/tex]

where  f is the focal length

 f  = [tex]\frac{1}{P}[/tex]   = [tex]-\frac{1}{2}[/tex]

The lens is a diverging lens

Explain why both a power source (like a battery) and a complete circuit are necessary for an electromagnet to function. 

Answers

Answer: So that it can function.

Explanation:

If the velocity of an object is zero, then that object cannot be accelerating. | True or False

Answers

Answer: False

Explanation:

Which statement accurately describes planetesimals?

A. They are the origins of planets.
B. They formed from ice and rocks.
C. They were created during the big bang.
D. They contain 98% of matter in the solar system

Answers

Answer:

B

Explanation:

mark me as brainlist

i would say b as the answer

a man climbs a ladder.which quamtities can be used to calculatethe useful power of the man

Answers

Explanation:

Power is the rate at which work is done. It is expressed as:

     Power  = [tex]\frac{work done}{time taken}[/tex]  

To find the power of the man climbing the ladder, we must know the work he is doing and the duration of the work done.

 Work done  = force x distance

  Since he climbs,

           Force  = weight  = mg (mass x acceleration due to gravity)

    distance  = height = h

Power  = [tex]\frac{mgh}{t}[/tex]

t is the time

    If we know these parameters, we can find the power.

   

A rocket is launched from the origin with an acceleration of 20.0 m/s2 in a straight line at an angle of 30.0 degrees above the horizontal. The launch acceleration lasts for 2.00 seconds at which time the fuel is exhausted. The rocket then falls with an acceleration of 9.80 m/s2 downward. What is the time it takes to reach maximum height?

Answers

Answer:

4.04 seconds

Explanation:

Context before solving:

In order to solve this problem, we must keep in mind that the initial 2.00 seconds at which the fuel is exhausted does not signal when the rocket reaches its maximum height.

From this moment on, the rocket has a downward acceleration of 9.8 m/s² but it still has an upwards velocity, which we will calculate. This upwards velocity keeps the rocket moving up for a certain period of time, which we will also calculate.

For this problem, let's set the upwards direction to be positive and the downwards direction to be negative.

To find the time that the rocket takes to reach its maximum height, we are going to use the initial 2.00 seconds and find the additional seconds it takes to reach a final vertical velocity of 0 m/s. This represents the time at which the rocket stops moving and heads in the downwards direction, which takes place after the rocket has reached its maximum height.

Solving for initial velocity:

The time in the air of an object in projectile motion can be found using this equation, derived from one of the constant acceleration kinematic equations.

Time in the air (projectile motion):

[tex]$t=\frac{2v_isin\theta}{g}[/tex] where g = gravitation acceleration = 9.8 m/s²

Solve for [tex]v_i[/tex] by plugging in 2.00 seconds for t, 30 degrees for theta, and 20.0 m/s² for acceleration, since this is not a constant acceleration problem.

[tex]$2.00=\frac{2v_isin(30)}{20.0}[/tex]

Multiply sin(30) and 2 together.

[tex]$2=\frac{v_i}{20}[/tex]

Multiply 20 to both sides of the equation.

[tex]$40=v_i[/tex] [tex]v_i=40[/tex]Finding the vertical component:

Now we know that the initial velocity of the rocket is 40 m/s. We need to solve for the vertical component of the rocket's velocity in order to solve for the additional time it took after the 2.00 seconds to reach its maximum height.

Vertical component:

[tex](v_i)_y=v_i \times sin\theta[/tex] [tex](v_i)_y=(40) \times sin(30)[/tex][tex](v_i)_y=20[/tex]

The vertical component of the velocity vector is 20 m/s.

Finding additional seconds after 2.00 s:

Now, in order to solve for the additional seconds that the rocket took to reach its maximum height, let's use one of the kinematic constant acceleration equations that uses the variables [tex]v_f[/tex], [tex]v_i[/tex], [tex]a[/tex], and [tex]t[/tex].

[tex]v_f=v_i + at[/tex]

Since we are trying to solve for time, we need to use this equation in terms of the vertical direction, aka the y-direction. Time is the same in either case.

[tex](v_f)_y=(v_i)_y+a_yt[/tex]

The final vertical velocity of this rocket is 0 m/s at the top, or its maximum height. We found that the vertical component, aka the rocket's initial vertical velocity, is 20 m/s. The acceleration is given to us: -9.8 m/s² (since it's falling downwards, the acceleration must be negative because we already established this in the beginning).

We are trying to solve for time t. Substitute the known values into the equation.

[tex]0=(20)+(-9.8)t[/tex]

Subtract 20 from both sides of the equation.

[tex]-20=-9.8t[/tex]

Divide both sides of the equation by -9.8.

[tex]2.040816327=t[/tex] [tex]t=2.04\ \text{seconds}[/tex] Finding total time to reach max height:

Now we can take this time and add it to the initial 2.00 seconds of the rocket. This time we just solved for is the time after these initial seconds that the rocket kept going upwards, since its initial vertical velocity was not 0 m/s yet.

[tex]2.00+2.04=4.04 \ \text{seconds}[/tex]

The time that the rocket takes to reach its maximum height is 4.04 seconds.

Answer:

4.04 second is your answer hope it help you........

Please identify the type of inference happening at letter A and the type of interference happening at letter B. If this was a sound wave, which (A or B) do you think would be louder and why?

Answers

Answer:

B i think

Explanation:

B because it travels in the same wavelentgh.............

[tex]gjkrejktg[/tex]

Type A is constructive interference and Type B wave gives destructive interference. The constructive interference would be louder.

What is interfernece?

Interference can be described as a natural phenomenon that occurs at every place and at every moment. Interference can be defined as the phenomenon in which two waves superpose to produce the resultant wave of the lower, higher, or same amplitude. Light waves are produced randomly by most of the sources.

The interference of light from the soap bubble which reflects colors when illuminated by a light source. The starting point of the wave produced may be a maximum or a minimum,  and there is no way to predict which phase the wave will start.

Interference can either be constructive interference or destructive interference. Constructive interference occurs when the crest of one wave falls on the crest of another wave and the amplitude is maximum.

In destructive interference, when the crest of one wave falls on the trough of another wave and the amplitude is minimum. The phase and displacement of these waves are not the same.

Learn more about interference, here:

https://brainly.com/question/22320785

#SPJ2

Define Gulf in your own words?

Answers

Answer:A deap inlet of the sea Almost surrounded by land, with narrow mouth.

Which of the following statements is correct.
A. A direct relationship exists between frequency and wavelength, as the frequency increase from Radio waves to Gamma rays so does the wavelength.
B. A direct relationship exists between frequency and wavelength, as the frequency decrease
from Radio waves to Gamma rays so does the wavelength.
C. An indirect relationship exists between frequency and wavelength, as the frequency increase
from Radio waves to Gamma rays the wavelength decrease.
D. An indirect relationship exists between frequency and wavelength, as the frequency decrease
from Radio waves to Gamma rays Wie wavelength increase

Answers

The answer is C, as the frequency gets higher the wavelength gets shorter

based on your reading "take a closer look" what can you say about the image that forms on the retina of your eye?

Answers

Answer:

it is an upside-down image but the brain realizes it and corrects it in its orientation so we see it in right direction.

Answer:

The lens of the eye is a convex lens. The image that it forms on the retina is upside down.

Explanation:

The eye makes an image, but it is upside down, the brain corrects the image and turns it right side up

3. The soccer kicker kicks a 2 kg football with a force of 68 N. How fast will the ball accelerate down the field?
m = _______
a = ________
Fnet = _____

Answers

Answer:

[tex]\boxed {\boxed {\sf m= 2 \ kg , \\a= 34 \ m/s^2, \\\F= 68 \ N}}[/tex]

Explanation:

The formula for force is:

[tex]F=m*a[/tex]

If we rearrange the formula to solve for a (acceleration), the formula becomes

[tex]\frac{F}{m} =a[/tex]

The force is 68 Newtons. Let's convert the units to make the problem easier later on. 1 N is equal to 1 kg*m/s², so the force of 68 N is equal to 68 kg*m/s².

The mass is 2 kilograms.

[tex]F=68 \ kg*m/s^2 \\m= 2\ kg[/tex]

Substitute the values into the formula.

[tex]\frac{68 \ kg*m/s^2}{2 \ kg} =a[/tex]

Divide. Note that the kilograms will cancel each other out (hence why we changed the units).

[tex]\frac{68 \ m/s^2}{2}=a[/tex]

[tex]34 \ m/s^2=a[/tex]

The acceleration is 34 meters per second squared.

41. A statue weighs 1,000N and exerts a pressure of 20,000 Pa. How big is
the base of the statue in square meters?
please help

Answers

Answer:

The answer is 0.05 m²

Explanation:

The area of the base of the statue can be found by using the formula

[tex]a = \frac{f}{p} \\ [/tex]

f is the force

p is the pressure

From the question we have

[tex]a = \frac{1000}{20000} = \frac{1}{20} \\ [/tex]

We have the final answer as

0.05 m²

Hope this helps you

What is temperature? Using the example of the pot of boiling water, describe how you think temperature is related to thermal energy.

Answers

Answer:

An example would be "The soup is boiling hot and has a temperature of 100 °C, whereas the water in the tub is just comfortably warm, with a temperature of about 38 °C. Although the water in the tub has a much lower temperature, it has greater thermal energy".

Explanation:

Thermal energy and temperature are closely related. Both reflect the kinetic energy of moving particles of matter. However, temperature is the average kinetic energy of particles of matter, whereas thermal energy is the total kinetic energy of particles of matter.

Which of these is an example of heat transfer by conduction?

cooking carrots in hot water


drying hair with a blow dryer


pressing a shirt with an iron


warming water with sunlight

Answers

Answer:

pressing a shirt with an iron

Explanation:

Heat transfer by conduction is when heat is transferred by two objects in contact with each other.

PLEASE MARK BRAINLIEST. Thanks!!!!

which is one characteristic of an electron?

Answers

Answer:

The electron is a negatively charged particle found in the atoms of all the elements. The electrons are located outside the nucleus in an atom. An electron is usually represented by the symbol (e –). The mass of an electron is about the mass of a hydrogen atom.

Explanation:

A student determines the density ρ of steel by taking measurements from a steel wire
Mass- 6.2 +-0.1g
Length- 25.0 +-0.1m
Diameter- 2.00 +-0.01mm
He uses the equation ρ= 4m/πd^2l
What is the percentage uncertainty in his calculated value of density ?

Answers

Answer:

The percentage uncertainty in his calculated value of density is [tex]\pm 0.713\,\%[/tex].

Explanation:

We can estimate the absolute uncertainty by the definition of total differential. That is:

[tex]\Delta \rho \approx \frac{\partial \rho}{\partial m}\cdot \Delta m + \frac{\partial \rho}{\partial d}\cdot \Delta d + \frac{\partial \rho}{\partial l}\cdot \Delta l[/tex] (1)

Where:

[tex]\frac{\partial \rho}{\partial m}[/tex] - Partial derivative of the density with respect to mass, measured in [tex]\frac{1}{mm^{3}}[/tex].

[tex]\frac{\partial \rho}{\partial d}[/tex] - Partial derivative of the density with respect to diameter, measured in grams per cubic milimeter.

[tex]\frac{\partial \rho}{\partial l}[/tex] - Partial derivative of the density with respect to length, measured in grams per cubic milimeter.

[tex]\Delta m[/tex] - Mass uncertainty, measured in grams.

[tex]\Delta d[/tex] - Diameter uncertainty, measured in milimeters.

[tex]\Delta l[/tex] - Length uncertainty, measured in milimeters.

[tex]\Delta \rho[/tex] - Density uncertainty, measured in grams per cubic milimeters.

Partial derivatives are, respectively:

[tex]\frac{\partial \rho}{\partial m} = \frac{4}{\pi\cdot d^{2}\cdot l}[/tex] (2)

[tex]\frac{\partial \rho}{\partial d} = -\frac{8\cdot m}{\pi\cdot d^{3}\cdot l}[/tex] (3)

[tex]\frac{\partial \rho}{\partial l} = - \frac{4\cdot m}{\pi\cdot d^{2}\cdot l^{2}}[/tex] (4)

And we expand (1) as follows:

[tex]\Delta \rho \approx \frac{4\cdot \Delta m}{\pi\cdot d^{2}\cdot l} - \frac{8\cdot m\cdot \Delta d}{\pi\cdot d^{3}\cdot l}-\frac{4\cdot m\cdot \Delta l}{\pi\cdot d^{2}\cdot l^{2}}[/tex]

[tex]\Delta \rho \approx \left(\frac{4}{\pi\cdot d^{2}\cdot l}\right)\cdot \left(\Delta m -\frac{m\cdot \Delta d}{d}-\frac{m \cdot \Delta l}{l} \right)[/tex] (5)

If we know that [tex]d = 2\,mm[/tex], [tex]l = 25\,mm[/tex], [tex]m = 6.2\,g[/tex], [tex]\Delta m = \pm 0.1\,g[/tex], [tex]\Delta d = \pm 0.01\,mm[/tex] and [tex]\Delta l = \pm 0.1\,mm[/tex], then the absolute uncertainty is:

[tex]\Delta \rho \approx \pm\left[\frac{4}{\pi\cdot (2\,mm)^{2}\cdot (25\,mm)} \right]\cdot \left[(0.1\,g)-\frac{(6.2\,g)\cdot (0.01\,mm)}{2\,mm} -\frac{(6.2\,g)\cdot (0.1\,mm)}{25\,mm} \right][/tex]

[tex]\Delta \rho \approx \pm 5.628\times 10^{-4}\,\frac{g}{mm^{3}}[/tex]

And the expected density is:

[tex]\rho = \frac{4\cdot m}{\pi\cdot d^{2}\cdot l}[/tex] (6)

[tex]\rho = \frac{4\cdot (6.2\,g)}{\pi\cdot (2\,mm)^{2}\cdot (25\,mm)}[/tex]

[tex]\rho \approx 78.941\times 10^{-3}\,\frac{g}{mm^{3}}[/tex]

The percentage uncertainty in his calculated value of density is:

[tex]\%e = \frac{\Delta \rho}{\rho}\times 100\,\%[/tex] (7)

If we know that [tex]\Delta \rho \approx \pm 5.628\times 10^{-4}\,\frac{g}{mm^{3}}[/tex] and [tex]\rho \approx 78.941\times 10^{-3}\,\frac{g}{mm^{3}}[/tex], then the percentage uncertainty is:

[tex]\%e = \frac{\pm 5.628\times 10^{-4}\,\frac{g}{mm^{3}} }{78.941\times 10^{-3}\,\frac{g}{mm^{3}} }\times 100\,\%[/tex]

[tex]\%e = \pm 0.713\,\%[/tex]

The percentage uncertainty in his calculated value of density is [tex]\pm 0.713\,\%[/tex].

You walk forward 105 meters, in 15 seconds. What is your overall velocity? I need help immediately please

Answers

Velocity = displacement/ time
105 meters/ 15 seconds = 7 m/s

2. An object is moving with an initial velocity of 12 m/s. It accelerates at a rate of 1.5 m/s^2 over a distance of 40 m. What is its new velocity?

Answers

Answer:

16.2 m/s

Explanation:

2ad=Vf^2-Vi^2

2 (1.5) (40) = Vf^2 -(12)^2

Vf= 16.2 m/s

gravitational forces is ------ force​

Answers

Answer:

Gravitational force is noncontact force

Explanation:

Contact force occurs due to the contact between two different objects. Non-contact force occurs due to either attraction or repulsion between two objects such that there is no contact between these objects. There is no field linked with the contact force. ... Gravitational force is an example of a non-contact force.

How far will you travel in 3.5 hrs if you have an average velocity of 90 km/hr

Answers

Answer:

The answer is 315 km

A roller coaster is travelling 1 m/s at the top of the track. At the bottom of the track, 5 seconds later, it is travelling 36 m/s. What is the average acceleration?

7.2 m/s2
0.14 m/s2
36 m/s 2
7 m/s2

Answers

Answer:

7m/s²

Explanation:

Given parameters:

Velocity at the top = 1m/s

Velocity at the bottom  = 36m/s

Time  = 5s

Unknown:

Average acceleration = ?

Solution;

Acceleration is the rate of change of velocity with time. It is expressed as;

  A = [tex]\frac{v -u}{t}[/tex]

v is the velocity at the top

u is the velocity at the bottom

t is the time taken

 Now, insert the parameters and solve;

  A = [tex]\frac{36 - 1}{5}[/tex]   = 7m/s²

The average acceleration will be "7 m/s²".

Given values:

Top velocity,

v = 1 m/s

Bottom velocity,

u = 36 m/s

Time,

t = 5 s

The acceleration is:

→ [tex]A = \frac{v -u}{t}[/tex]

By putting the values,

       [tex]= \frac{36-1}{5}[/tex]

       [tex]= \frac{35}{5}[/tex]

       [tex]= 7 \ m/s^2[/tex]

Thus the answer above i.e., "option d" is correct.

Learn more about acceleration here:

https://brainly.com/question/19434332

If you committed a crime, would it be easy for investigators to match this print to your records? Why or why not? Hint: how’s the quality of the lifted print? How rare is your pattern? (At least two sentences)

Answers

Answer:

This question is incomplete

Explanation:

This question is incomplete because of the absence of the picture of the print in question. However, when the quality of the print obtained from a crime scene is high/good, then this is a good/positive step in identification of a suspect. However, if the quality is bad, other options might need to be explored in addendum to the print obtained in identifying a suspect.

If the quality of the print is good enough to make a pattern, then another factor comes into play. If the pattern is a rare pattern or is not common, then it becomes easier to identify the suspect because there would be fewer people having that fingerprint and fewer people to deal with. Of the three major patterns of fingerprints (whorl, loop and arch), arch fingerprints are the least common.

What current flows through a bulb if 360 C of charge moves through
a bulb in 20 minutes?

Answers

Answer: A current of 1 A is flowing in a circuit if a charge of 1 coulomb passes any point in the circuit every second.

1 Amp = 1 Coulomb per second

We can write this formula as:

Current (I) = Charge (Q) / Time (t)

Charge (Q) = Current (I) x Time (t)

Explanation:

Other Questions
Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date.