What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer 1

Answer:

what I don't understand what is the Ctcagt


Related Questions

If cells from one part of an embryo are transplanted to another part, and they develop into the tissue they would have made originally, the cells are said to be ____________ .

Answers

Answer:

determined

Explanation:

Determined cells are embryonic cells that will generate all the cell types of the adult organism, with this process being independent of environmental inputs. Cell determination is defined by specific gene expression patterns in embryonic cells. In consequence, cell determination is defined as a genetic process where a particular cell fate can be broken down into two different states: specified (committed) or determined. If a cell is in a committed/specified state, the cell's fate can still be reversed or transformed, while if a cell in a determined state, the cell's fate cannot be reversed or transformed.

Today we use the word bureaucracy to refer to any organization that has many departments. T F

Answers

the answer would be true

Today, the word "bureaucracy" is used to refer to any organization that has many departments, which is a false statement as bureaucracy is related to government administration.

What is the significance of the bureaucracy?

The importance of bureaucracy includes making sure that governmental tasks are carried out effectively and efficiently by skilled professionals who are authorities in their fields and are capable of handling their tasks with a high degree of competence. They make sure that government policies are applied consistently and fairly. They are tasked with providing information and support to regular individuals who require it since they are a crucial part of public administration and governance.

Hence, today the word "bureaucracy" is used to refer to any organization that has many departments, which is a false statement as bureaucracy is related to government administration.

Learn more about the bureaucracy here.

https://brainly.com/question/2582252

#SPJ2

Explain the characteristics you observed when studying the epithelial types of the Epithelial Tissue from Kidney and Epithelial Tissue from Dermis and Epidermis images.

Answers

Answer: The epithelial tissue is a membranous tissue which has a function of covering.

Explanation:

The cuboidal epithelial tissues are present in the proximal convoluted tubules or PCT these tissues help in absorption of materials present in the filtrate generated in the glomerulus. These includes necessary salts, glucose, amino acids, water, gets selectively reabsorbed.

The stratified squamous epithelium are present in dermal layer of the skin. The dermal layer is the layer which receives the nerve supply of blood and nourishment. The epithelium helps in secretion of sweat and protection against microorganisms.  

The fruits have several purposes. Which purposes might be similar to those of a cone?

Answers

Answer:

Flowers and cones have different structures. Cones when mature have a woody texture and is made up of scales while flowers have colorful petals, sepals and both male and female reproductive portions are called stamens and pistils.

Explanation:

Answer:

the other side of a cone

Explanation:

These are some of the factors that drive ocean currents.


ATides, Water, Gyres, Boats
BFish, Water, Temperature, Waves
CGyres, Temperature, Wind, The Moon
DPeople, Fish, Water, Wind


Answers

D: People, fish, water, and wind

which process in photosynthesis uses energy from the sun

Answers

Answer:

splitting water into hydrogen and oxygen

Explanation:

because

The light-dependent reaction

          The light-dependent reaction, as its name implies, occurs inside the thylakoid membrane and necessitates a constant supply of sunshine. The light waves' energy is captured by the chlorophyll and transformed into chemical energy in the form of the molecules ATP and NADPH.

What is Photosynthesis ?

           Plants and other living things employ a process called photosynthesis to transform light energy into chemical energy that can then be released through cellular respiration to power the organism's activities. Despite the fact that various species undertake photosynthesis in different ways, the process always starts when proteins called reaction centres that contain green chlorophyll absorb energy from light. Unlike bacteria, which have these proteins incorporated in the plasma membrane, plants store these proteins in organelles called chloroplasts, which are most prevalent in leaf cells.

         When the cell needs energy, ATP can be taken out and used to fuel processes or stored for use in later ones. Animals use ATP to retain the energy released during meal digestion. Similar to this, plants use ATP molecules to store the energy they obtain from light during photosynthesis.

          In addition to converting ADP to ATP, photosynthetic processes are used by plants to absorb, process, and store solar energy. Animals convert ADP to ATP, which can subsequently be utilised to drive essential development and cell maintenance, using the energy supplied from the breakdown of glucose and other molecules.

           Plants absorb water (H2O) and carbon dioxide (CO2) from the soil and atmosphere during photosynthesis. Water is oxidised, which means it loses electrons, while carbon dioxide is reduced, which means it receives electrons, inside the plant cell. Water is converted into oxygen and carbon dioxide into glucose as a result.

To learn more about Photosynthesis refer :

brainly.com/question/19160081

#SPJ2

1
ushat is Environment. Pollution?
Se distinguish between-biodegeable and none biodegrabable
Pollutants
e) choose the biodegradable pollutants from the list given
below Sewage :DDT hadioactive waste agricultsal Waste​

Answers

Answer:

Explanation:

the contamination of the physical and biological components of the earth/atmosphere system to such an extent that normal environmental processes are adversely affected. is called environmental pollution.

biodegradable substance are those which decompose naturally left beneficial

to the environment and are used by

but non biodegradable resources are the waste which do not decompose naturally. these waste cause pollution to the environment resulting harmful effect on living beings.

Sewage and agricultural waste are biodegradable waste.

What is crossing-over, during what phase does it occur, and what is its significance?

Answers

Answer:

Crossing over is a biological occurrence that happens during meiosis when the paired homologs, or chromosomes of the same type, are lined up. Hope this helps :)

Explanation:

Red blood cells are able to maintain homeostasis because they are bathed in blood, which is to the fluid in the cells themselves.

Answers

Answer:

this is not a question it is a statement

Explanation:

Soil horizons develop as a result of?

Answers

Answer:

translocation, additions, transformation, and removal.

Explanation:

Soil horizons are the result of these four things.

i will mark u brainliest!!! What is on the biology module 3 dba? pleasee only leave real answers im struggling lol.

Answers

Answer:

WHat school?

Explanation:

FLVS: What are mutations and how do they occur? Explain their effects on organisms.

Explain how DNA is involved in creating genetic variation within a species. Is this considered a mutation, if so why?

Describe how you can use a Punnett square to predict the probability that offspring will inherit a trait. Provide explanations of genotypes and phenotypes.

Compare mitosis and meiosis. What type of cells are created through mitosis and meiosis and what is the function of each? What makes these processes vital to our survival?

Summarize how protein molecules are made through transcription and translation. Where do these processes take place?

What is genetic engineering? Provide an example of a positive example of genetic engineering technology and its impact on health and genetics.

These should be the questions.

They might be different for you

in your own, explain why you think that geologists find relative dating useful
i need the answer ASAP

Answers

Answer:

Because they can compare their findings with other geologest and their results.

Explanation:

Which of the following statements correctly describes a difference between plant cells and animal cells?

2 points

A. Plant cells have an envelope surrounding the nucleus. Animal cells do not.

B. Animal cells contain mitochondria. Plant cells do not.

C. Animal cells contain chloroplasts. Plant cells do not.

D. Plant cells are surrounded by a cell wall. Animal cells are not.

Answers

Answer:

D

Explanation:

plant cells are the only kind of cell to have cell walls

The statement 'plant cells are surrounded by a cell wall, while animal cells are not' correctly describes the difference between plant cells and animal cells (Option D).

Both plants and animals are eukaryotic organisms, which means that their cells have nuclei and contain membrane-bound organelles.

Plant cells contain an organelle known as chloroplast, which is used by these organisms during photosynthesis.

Moreover, the plasma membrane of plant cells is surrounded by a cell wall that provides structural support to their cells.

In conclusion, the statement 'plant cells are surrounded by a cell wall, while animal cells are not' correctly describes the difference between plant cells and animal cells (Option D).

Learn more in:

https://brainly.com/question/965751

A plant cell at 24 degrees Celsius containing 0.3 M sucrose is in equilibrium with its
surrounding solution containing 0.15 M sucrose in an open beaker.
A. What is S for the plant cell?
B. What is S for the solution?
C. What is P for the solution?
D. What is P for the plant cell?
E. What is for the plant cell?

Answers

Answer:

A.A plant cell, similar to an animal cell, is eukaryotic. Eukaryotic cells are characterized by the presence of organelles, particularly nucleus, as opposed to prokaryotic cells that lack them. ... Plant cells have many chloroplasts whereas animal cells lack them. Chloroplasts are key organelles in photosynthesis.

B.n chemistry, a solution is a special type of homogeneous mixture composed of two or more substances. In such a mixture, a solute is a substance dissolved in another substance, known as a solvent.

C.We noticed earlier that the problem of recognizing palindromes is solvable in linear time, which is certainly polynomial time. It is easy to see that PALINDROME is in P. To decide if x is a palindrome, just reverse x and check whether the reveal of x is equal to x.

D.P is an important plant macronutrient, making up about 0.2% of a plant's dry weight. It is a component of key molecules such as nucleic acids, phospholipids, and ATP, and, consequently, plants cannot grow without a reliable supply of this nutrient.

E.Plant cells are differentiated from the cells of other organisms by their cell walls, chloroplasts, and central vacuole. Chloroplasts are organelles that are crucial for plant cell function. These are the structures that carry out photosynthesis, using the energy from the sun to produce glucose.

Please answer
Answer answer answer answer answer answer answer

Answers

Answer:

The nucleus is like the principal of a school, the cell membrane is like a school building, and the mitochondria is like the staff in a school.

Explanation:

Definitions:

The nucleus of a cell contains the majority of the cell's genetic material, and coordinates cell activities like protein synthesis and cell division.The cell membrane is the semipermeable membrane of a cell that surrounds the cytoplasm (the material inside the cell other than the nucleus).The mitochondria is "the powerhouse of the cell", because it produces most of the chemical energy needed to power the cell's chemical reactions.

The nucleus is like the principal of a school: the nucleus controls the cell, much like how the principal controls the school.

The cell membrane is like a school building: the cell membrane forms a boundary between the cell and outside environment, much like how the school building separates you from outside.

The mitochondria is like the staff in a school: the mitochondria powers the cell, much like how the staff in a school keep the school running.

Answer:

Answer

Explanation:

Answer

determine what foods you would take with you on your journey develop a supply list must by 2 paragraphs.

PLEASE HELP ​

Answers

On a Journey to and island i would take a Blade. The blade will he useful to cut tress to make various sorts of Things such as bark to start fires and Bamboo to make beds/tools. Also the blade will help me hunt Food and cut the meat to make it edible.
On the journey i would also take Fire starters because you need a fire for various of things. With the fire you made from the fire starters you can cook food and clean water for survival. Also you can Keep warm during the cold with said fire.

Which part of the brain is used to integrate incoming information and send it to the appropriate portion of the cerebrum?

Answers

Answer:

the Brarin that what it is

what system gives itself information about itself after change or event this is called

Answers

Answer:

The term feedback involves a process wherein the system regulates itself by creating a response or returning an information regarding its productivity.

Explanation:

Hope this was helpful

Answer:

It is feedback

Explanation:

Which property of water allows it to moderate the temperature of nearby areas of land by resisting temperature changes? How is this important for living organisms?

Answers

Answer:

land because ask water

Explanation:

In a paternity testing case, a child's DNA was collected to see if it matched both parents' DNA. Which type of genetic material can be used for the DNA fingerprinting?

A. Coding DNA
B. Noncoding DNA
C. RNA

Answers

I think A is the correct answer

Which are properties of metals? Check all that apply
Dullness
Malleability
Ductility
Poor conductors of heat
Good conductors of heat

Answers

Metals are malleable
Metals are ductile
Metals are good heat and electricity conductors
Metals lose electrons in reactions.

Answer:

2,3, and 5

Explanation:

got it right on edge

Relative dating techniques have been around for hundreds of years. How did newer
absolute dating techniques change the way we look at seologic cross section
It allowed us to put reologie cross sections lo better order
It allowed us to put a formation date on some geologic crosections
It allowed us to disprove the existence of land bridges
It allowed us to start using the idea of superposition

Answers

Answer:

It allowed us to put a formation date on some geologic crossections

Explanation:

Absolute dating is a newer way of evaluating the chronology of historical events by assigning numerical ages to them. The age thus assigned might not be the exact age but it is still closer to the real age.

It is unlike relative dating techniques which simply give the chronology or order of past events instead of the exact dates. Relative dating techniques have been in use before the emergence of absolute dating techniques in the twentieth century.

offering 15 pts
*I'm looking for a high-quality complete answer. One or two sentences will not suffice. looking for about two paragraphs. :)

A biologist from another galaxy might think that automobiles are a dominant form of life on planet Earth. Automobiles move, consume gasoline and oil, and produce wastes. They are sheltered in garages and respond to stimuli. Automobiles age and break down, but new automobiles appear every year. They evolve, changing in appearance from year to year.

What arguments would you use to persuade the alien visitor that cars are not alive?

Answers

Answer:

Organisms need 6 things to be considered living which are, responsiveness to the environment, the ability to reproduce, having a metabolism, being able to breathe, maintaining homeostasis, being able to pass down traits, and made of cells. Cars, do not have the ability to reproduce, do not maintain homeostasis, cannot pass down traits, do not have a metabolism, etc... a living being needs to fit all of the criteria to be considered living. In this case, cars do not fit the criteria.

Knowing this, you would tell the alien about the 6 things needed to be considered a living being. After that, you would tell the criteria that the car does not fit which would then explain how a car is in fact, not a living being.  

Explanation:

How does ground water relate to lakes or rivers?

All lakes and rivers are replenished by groundwater.
When ground water reaches the surface it can form lakes or rivers.
Groundwater can affect the size of lakes and rivers.
Lakes and rivers produce groundwater.

Answers

B is the answer you are looking for

Answer:

When ground water reaches the surface it can form lakes or rivers.

Explanation:

Groundwater in valleys is often pushed under pressure by rainwater that falls on the nearby highlands. If the water table reaches the surface, a lake, a river, or a spring is formed. A spring in desert country is surrounded by plants that take advantage of the water supply, forming an oasis. Water now coming to the surface at oases in the Sahara Desert came from rain that fell on hills near the desert during the Middle Ages--eight hundred to one thousand years ago.

Hope this helps   :)))))

Please help it’s urgent!!! For these 2 questions

Answers

First one is endothermic since you are adding heat
Second one is 75% of our body is water
Hope this helps!!
Plz make me brainliest!

Answer:

The first question is endothermic change of state. The second answer is 75% of our bodies are made up of water

Explanation:

I think this is the answer Hope this helps and I'm sooo sorry if this is wrong.

Animal and plant organs are organized into organ systems, thus resembling the way you organize

Answers

nimal and plants organs are organized into organ systems,much like you organize your homework in. ... The animals in which cells are organized into structural and functional units ... You organize files by storing

please help me with this question:)

Answers

400x

Is the answer to this question.


Organisms that must get there energy from food or other living things are
called:
zenotrophs
heterotrophs
autotrophs
plants

Answers

Answer:

b

Explanation:

heterotrophs animal

Try reducing the level of fossil fuel percentage increase and decrease deforestation by 1 GT per year. Predict what will happen to the atmospheric carbon levels and record it in your Data Table. Run the simulation to test your hypothesis. Were you correct? Were you surprised by the result? What about your result surprised you?

Answers

Answer: The atmosphere can handle almost 700 billion tons of carbon in it. The carbon levels are increasing due to industrial revolution.

Explanation:

The overload of the emission of carbon in the atmosphere surprised me. The data was recorded and investigated for 2000 to 2100. Different parameters like ocean water and fossil fuel. The fossil fuel when burn contribute to the release of carbon monoxide and carbon dioxide gas. The oceanic water release the decomposed carbon dioxide by calcium carbonate of coral reefs and respiration of aquatic animals.

Which of these mechanisms exerts gene control by suppressing transcription in eukaryotes?

A. Acetylation of histone proteins
B. Methylation of DNA
C. Action of activator proteins

Answers

Sets of transcription factor proteins buying a specific DNA sequences in or near a gene and promote or repress its transcription into RNA. Which i believe its C

Answer:

Its B. Methylation of DNA I just took the test.

Explanation:

Other Questions
Which set of line segments could create a right triangle?24, 30, 3512, 18, 3018, 24, 3018, 24, 35 PLEASE HELP WITH GEOMETRY Identify next three numbers in this sequence: 2, 6, 3, 9, 6, 18, 1545, 22.5, 67.519, 16, 2045, 42, 12640, 37, 111 How many moles of Nitrogen gas are in 135L of Nitrogen gas at STP? A student throws a 110 g snowball at 6.5 m/s at the side of the schoolhouse, where it hits and sticks.What is the magnitude of the average force on the wall if the duration of the collision is 0.19 s ? DUE IN A HOUR!!!!!!!!!!What is the slope?Simplify your answer and write it as a proper fraction, improper fraction, or integer. Which of the following is false? a. The 1844 Treaty to Annex Texas was soundly rejected by the U.S. Senate. b. James K. Polk was elected president in 1844 and he supported annexation. c. The 1845 joint resolution for annexation was rejected by the U.S. Congress. d. The majority of Texans favored annexation. WILL GIVE BRAINLIEST!!Which form of prose does the following passage suggest?Its hard to get traction on gravel. The rocks are tiny and roll under your sneakers. When your legs go out from under you, you realize that youre not in control of gravity anymore.a.) fictional storyb.) functional articlec.) creative nonfiction essayd.) information report HELP MEE Simplify the expression : (5x + 3y) + (2x + 12y) The amount of water vapor in a given volume of air is ______________ .The amount of water vapor in the air at any one time depends on ______________ . Warmer air holds ______________ water thancooler air. Clouds form when humidity is ______________ and thetemperature is ______________ . ______________ humidity is definedas the amount of water vapor in the air ______________ by the amountthat would have to be present in the same air to form a ______________ or condense on a surface. ______________ is related to the humidityof the previous day. The air temperature at which water vapor in the air ______________ onto cool surfaces is the dew point. The words:humiditytemperaturemorehighlowrelativedivided clouddewcondenses if u answer this I sware u'll be brainliest bc this is so important, thank u u r soo kind and much appreciated if u pleaseGod Bless PLEASE HELP!!!!!!!!!!!!!!!!!!!!!! Preston bought 16 donuts. There were d donuts in each box. Choose the expression that shows how many boxes of donuts Preston bought Someone please help me! -25.63+ -30.59 ??? Can someone let me know what this equals? D. impromptuThe four (4) types of speech according to delivery are also observed in:Other Speaking SituationA. manuscriptB memorizedC. extemporaneousD. Impromptu To solve the following system by elimination of the x terms, if the first equation were multiplied by -4, by what number would you multiply the second equation? .***6. find the focal length of alens of power-2.0D. what type of lens is this? CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION THANK YOU!! A serving of seafood appetizers is arranged on a bed of ice. Dipping sauces are in the center with a tiny spoon for dishing them out. What technique did the chef apply to make the arrangements? 2(5x + 3) - 2(2x - 3)