Where was the margarita pizza 1st made and who was it made for

Answers

Answer 1

It was made in Italy on June 11th, 1889, to honor the queen consort of Italy, Margherita of Savoy. The toppings represent the colors on the flag of Italy.


Related Questions

ONE piece of evidence from the first half of the nineteenth century could be used to support, modify, or refute the argument made in the excerpt about womens rights.

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to attach the excerpt about women's rights. Without the excerpt, we do not what is its content. Just you know it.

However, trying to help you we can answer in general terms based on our knowledge about the topic.

A piece of evidence from the first half of the nineteenth century that could be used to support the arguments for women's rights that favored this movement is the reformation period lived in the United States at the beginning of the 1900s, after many years of the Gilded Age.

During the reformation in America, many reformers joined and supported the women's rights movement initiated by Elizabeth Cady Stanton and Lucretia Mott.

Indeed, Elizabeth Cady Stanton drafted the Declaration of Sentiments presented at the Seneca Falls Convention of 1848, the first Women Rights Convention in the history of the United States that was held on July 19 and 20, 1848, in the city of Seneca Falls, New York.

What are the values and limitations of the World Happiness Report?

Answers

Answer:

The report looks at 6 key to come to a happiness score= income, freedom, trust in government, healthy life expectancy, social support from family and friends and generosity

the value of world report

Explanation:

These residuals have an average value of approximately zero over the whole set of limitations i

Please answer this for me
Please don't say that the answer is in a link

Answers

Answer:

it’s d

Explanation:

because this is where they had their shipyards.

Read the following excerpt from the Truman Doctrine and answer the question below.

"The seeds of totalitarian regimes are nurtured by misery and want. They spread and grow in the evil soil of poverty and strife. They reach their full growth when the hope of a people for a better life has died.
We must keep that hope alive.
The free people of the world look to us for support in maintaining their freedoms."

Describe the tone of President Truman's address to Congress.

Answers

Explanation:  I used this for mine so you need to chnage the words and i didnt really get the question so i dont know if this is right but i tryed my best here :)

Answer:

He is describing totalitarianism as regimes that are based on misery and want and the people that believe/follow those are in poverty and strife so they want the successful people dead.  The tone is kinda saying fight with me I can help but also has a negative connotative towards totalitarianism.

Which of the following best describes the message of the old man who fell into the river?
Don't walk to close to the edge of the river
Go with the flow
Hold your breath and things will work out.
take swimming lessons: you never know when you might need them.

Based on taoism and i really need help

Answers

Answer: Go with the flow. The old man says after coming out alive, "I accommodated myself to the water,

not the water to me.

Without thinking,

I allowed myself to be shaped by it.

Plunging into the swirl, I came out with the swirl.

This is how I survived."

You are trying to convince your parents to send you to Europe. First, you ask them for a small favor (a bus ticket to a local city), hoping that later they will be more willing to send you on the longer trip. This technique is known as: motivated forgetting. the fundamental attribution error. the foot-in-the-door phenomenon. the cognitive dissonance theory.

Answers

Answer:

the foot-in-the-door phenomenon.

Explanation:

From the given question, someone is trying to convince his parents to send him to Europe. First, he asks them for a small favor (a bus ticket to a local city), hoping that later they will be more willing to send you on the longer trip. This technique is known as foot-in-the-door technique.

This technique is used as a compliance tactic to get what a person wants by asking for small favors so that a larger request would be granted.

The House Rules committee is important because it: Group of answer choices reviews all applications regarding the formation of select committees. decides the order in which bills come up for a vote on the House floor and determines the specific rules that govern the length of debate and opportunity for amendments. determines the jurisdiction of every congressional standing committee. is placed in charge of selecting the Speaker of the House.

Answers

Answer:

Decides the order in which bills come up for a vote on the House floor and determines the specific rules that govern the length of debate and opportunity for amendments

Explanation:

House Rules Committee

This is the committee that aid/help structure or direct the flow of major legislation, moves bills ahead quickly, holds them back, or stops them completely, enters bills and also limit debate on bills. The House Rules Committee is not like the one in the senate as their main duty is to runs the House and they are also responsible for placing importance or prioritising bills coming from the committee stage on the house floor for the second reading. It sets out the rules of debates.

The Biggest Evidence for the ancient Lapita Culture is ________.

1) Giant Stone Structure

2) Written Documents

3) Outsider Observations

4) A Distinctive Ceramic Style

Answers

Answer:

Giant Stone Structure or Written Documents

Explanation:

oI would say for sure the Giant Stone Structure but it doesn't say if that structure was during that culture. But, at the same time I wouldnt  think there would be documents back then. So I am going with Giant Stone Structure.

The Biggest Evidence for the ancient Lapita Culture is : A Distinctive Ceramic Style.

What is the Lapita culture?

This was the culture of people that were believed to have existed in Austronesia.

Much evidence of their livelihoods were found on certain Islands. The evidence was found in large Ceramic objects.

Raed more on culture here: https://brainly.com/question/25010777

If a police officer wants to switch careers and become an electrician, she would probably seek out:


Vocational training

ESL classes

GED classes

Continuing education training

Answers

Vocational training

1. Who wrote the Fihrist? What do we know about that person?

Answers

Answer: Ibn al-Nadim,  Ibn al-Nadīm was an Arab Muslim bibliographer and biographer of Baghdad who compiled the encyclopedia Kitāb al-Fihrist.

Ibn al-Nadim, also known as Ibn al-Nadim, was a Baghdad-based Arab Muslim bibliographer and biographer who created the Kitb al-Fihrist encyclopaedia.

What do we know about Ibn Al Nadim ?

He passed away there on Shaban 20, A.H. 385, Wednesday, 320/932. He was perhaps Persian or possibly Arab.

He might have started attending a madrasa when he was six years old, where he could have obtained a thorough education in Islamic studies, history, geography, comparative religion, the sciences, language, rhetoric, and Qur'anic interpretation.

He completed an apprenticeship in the book trade, the line of work of his father.

Al-Nadim was hired by his bookdealer father, who also owned a successful bookstore, to purchase manuscripts from sellers.

Al-Nadim would subsequently replicate them for the clients with the help of the other calligraphy scribes on staff.

The bookshop would have been a favourite gathering place for intellectuals, typically located on an upper floor.

For more details about Muslim leader to refer link

https://brainly.com/question/24286903

#SPJ5

Dr. Johnson conducted a research study in which he investigated the effect of three different methods of teaching mathematics to three different classes of fifth grade students. However, one of the classes had smarter students than the other two and as a result this class demonstrated the most improvement in their mathematics scores. In spite of this problem, he concluded that the method used to teach mathematics to this class of students was the most effective. In this experiment, the intellectual ability of the students in the various classes was:

Answers

Answer:

In this experiment, the intellectual ability of the students in the various classes was: a confounding extraneous variable.

Explanation:

Just a quick reminder: a dependent variable is what is being studied or researched. An independent variable is the factor that is introduced or changed in order to affect the dependent variable.Extraneous variables are factors that may affect the results of a study. These variables may lead a researcher to think that there is indeed an association between the other variables in the study when, in fact, there is not. A type of extraneous variable is the confounding variable, which is connected to both, the dependent and the independent variable. A confounding variable affects the results of the study because it affects how the independent variable affects the dependent one.In the study described in the question, the confounding variable is the intellectual ability of the students. If the students in a class are smarter than the others, their results will be different. As we can see, because they did better, Dr. Johnson concluded that his method was effective. However, that may not be true. They might have done better because of the fact they their intellectual ability was already better.

Define Constitution
Ty!​

Answers

Explanation:

Constitution is the supreme law of the country.

constitution leads the country in the development process . constitution is the law which is accepted by the citizens of whole country.

hope it is helpful to you

A Constitution is a law, but it's not just an ordinary law. A Constitution is a Supreme law that establishes, organizes and empower the government.

4. Which part of the central nervous system is located in the skull and controls most functions of the body.
spinal cord

brain

heart

Answers

The brain is the part of the central nervous system that is contained in the cranial cavity of the skull. It includes the cerebral cortex, limbic system, basal ganglia, thalamus, hypothalamus, and cerebellum.
Its the second one, the brain


lengthy borders to defend
riots, rebellions, and uprisings
barbaric invasions
decline in population

Which of the following would be the best title for the list?
A.
The Reasons for Roman Expansion
B.
The Rise of the Roman Empire
C.
The Limits to Roman Expansion
D.
The Effects of the Punic Wars

Answers

Answer:

A

Explanation:

15.) What is the name of the "Failed Rift" in the U.S.? Where did it begin and end? Your answer O This is a required question​

Answers

Answer:

MCR

Explanation:

Midcontinent Rift (made up of one billion year long old igeneous and sedimentary rocks.)

How does the USA practice Imperialism now?

Answers

Answer:

what is imperialism, fr i wanna know what imperialism is can someone tell me

Explanation:

After the terrorist attacks of September 11, 2001, and the declaration of the War on Terror, America invaded

Answers

Answer:

Iraq and Afghanistan

Explanation:

Answer:

Afghanistan and Iraq.

Explanation:

During the Renaissance, there was a rebirth in____?

Answers

Answer:education, Roman lives and literature, Greek lives and literature, and science

Answer:

Education

Explanation:

tissues that contain non-dividing cells​

Answers

Answer:

The tissues and organs of mammals consist of various cell types, including those that are dividing and those that are non-dividing. In adults, most cells, such as myocytes, adipocytes, skin cells and neurons, are in the non-dividing state, i.e.

Social and economic factors have been found not to influence early sexual activity as it was once thought.
Please select the best answer from the choices provided
T or F

Answers

Answer:

False

Explanation:

Social and economic factors have been found not to influence early sexual activity as it was once thought. is a false statement.

What is economics?

The term Economics is the study of scarcity and its inferences for the use of resources, manufacture of goods and services, growth of production and welfare over time, and a great diverseness of other complex issues of vital concern to society.

Economic skillfulness is important because it grants businesses to reduce their costs and change their output. For consumers, economic efficiency leads to lower prices for goods and services.

The social and economic factors include money, education, work, neighborhood safety, and social support. These elements have an impact on our capacity to make healthy decisions, pay for housing and healthcare, control stress, and other things.

Therefore, The social and economic factors include money, education, work, and neighborhood safety.

Learn more about economics here:

https://brainly.com/question/14787713

#SPJ6

James is an avid hunter. However, he recently has been seen associating with known local gang members. Authorities believe he may have begun the “initiation process” of joining the gang. A team from the ATF (Bureau of Alcohol, Firearms, and Tobacco) stormed his house and confiscated his hunting rifles.

Answers

Answer:

The  ATF  is wrong in how they handled the situation.

Explanation:

Authorities believe he may have begun the “initiation process” of joining the gang. But where is the proof. They should have spied on him first or something. Did the even have a warrent to storm into his house and confiscate his hunting rifles? I know this isn`t a question but I wanted to put in my input. : D

I NEED HELP CAN SOMEONE PLEASE WRITE A 6 SENCTENCE PARAGRAH.....
This is the question
What problems did Britain face after the French and Indian War? How did the British government try to solve these problems? Why did the colonists react negatively to the outcomes of the French and Indian War?
Please answer all these questions TYYYYYYY

Answers

Answer: The British thought the colonists should help pay for the cost of their own protection. Furthermore, the French and Indian War had cost the British treasury £70,000,000 and doubled their national debt to £140,000,000. Compared to this staggering sum, the colonists' debts were extremely light, as was their tax burden.

The British were able to take control of India mainly because India was not united. The British signed treaties and made military and trading alliances with many of the independent states that made up India. The British were very effective at infiltrating these states and gradually taking control.

The American colonists were upset by the taxes. The American colonists had worked together during the French and Indian War making it easier to work together against the British government. ... The French joined the American Revolution to get revenge on the British. They were bitter about losing the French and Indian War.

Explanation:

what are two types of energy used to break down compounds

Answers

heat and electricity:)

write an essay about how advertisements work

Answers

They propose that advertising works by creating patterns of associations that have emotional force, and that influence purchasing behaviour, often unconsciously. ... Therefore, the way an ad makes you feel may also be important, because this contributes to the long-term associations that you have for the brand.

What was the consequence of the Georgia General Assembly's expulsion of its African American members during Reconstruction?

A.
Georgia's economy entered a severe depression.

B.
The Ku Klux Klan disbanded after achieving its goal.

C.
The federal government put the state under martial law.

D.
Georgia's legislature restricted the rights of African Americans.

Answers

The answer is A.
Georgia’s economy entered a severe depression.

Answer:

a

Explanation:

Do you think Gandhi would have considered the protest methods to use body-force or soul-force? Explain.

Answers

Answer:

I think Gandhi used the soul-force because indeed pictures they both show sacrifices of self. The picture of Gandhi and the spinning wheel shows Gandhi reading a book wearing little clothing, and his all skin and bone. He was showing sacrifices of self which indicates soul-force.

Explanation:

What do you think it was like to be a resident of east berlin and of west berlin during the time that the berlin wall divided the city?

Answers

Answer: West Berlin enjoyed freedom in cross sectional sectors of living. The society welcomed various and diverse new ideas, as citizens were allowed to explore as many sectors as they can. They enjoyed more luxury than those in East Berlin.

Explanation:

During the time that Berlin was divided, it was a really divided way of living among between the two towns which were faced off againts each other. Those who resided in East Berlin didn't enjoy much freedom due to they were under a system controlled by communist. The city experienced losses in economy and the Russians. Based on how rigid the system was, citizens could only afford few luxury.

On the other hand West Berlin enjoyed freedom in cross sectional sectors of living. The society welcomed various and diverse new ideas, as citizens were allowed to explore as many sectors as they can. They enjoyed more luxury than those in East Berlin.

What is the purpose of the section “Path to Independence”?

Answers

Answer:

Evaluate calls for resistance against Britain and how they appealed to the rights of British subjects, the rights of the individual, local traditions of self-rule, and the ideas of the Enlightenment.

sorry if wrong

Data on the Persian Gulf and Interior
Country
Population/Growth Rate
Literacy Rate
Per Capita GDP
Bahrain
1.7%
85%
$15,900
Kuwait
3.4%
79%
$15,000
Oman
3.4%
80%
$7,700
Qatar
3.2%
79%
$20,300
Saudi Arabia
3.3%
63%
$10,500
United Arab Emirates
1.6%
79%
$22,800
Yemen
3.4%
38%
$820
Iraq
2.8%
58%
$2,500
Iran
.7%
72%
$6,300
Afghanistan
3.5%
32%
$800

Which country has the highest per capita GDP?

Answers

Answer:

United Arab Emirates

1.6%

79%

$22,800

Which state gained its independence from Mexico and was annexed by the
United States before the Mexican-American War? *

A. New Mexico

B. Texas

C. Arizona

D. Oklahoma

Answers

texas. it gained its independence in 1836.
B) Texas.....!!!!!!!
Other Questions
Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death. Why the allied powers pinpointed Germany at the person guilty for starting world war 1 How did the mandates after World War I create conflict in Southwest Asia? A. Jews and Arabs were given their own separate mandates. B. Mandates were forced to adopt French or English as an official language. C. Mandates were required to adopt democratic forms of government. D. The borders of mandates often ignored ethnic and religious divisions. I have of an hour to finish 6 homework assignments. How much time can I spend on each assignment? Mention the ways of safe abortion(like what should the woman do??)need help fast what is a flowchart and write it's work Maria counted the number of candies in ten different boxes. the number of candies are 57 38,45,49,52,56,41,50,61, and 60. What is the mean absolute deviation of the number of candies. Today is your birthday, and you decide to start saving for your college education. You will begin college on your 18th birthday and will need $4,000 per year at the end of each of the following 4 years. You will make a deposit 1 year from today in an account paying 12 percent annually and continue to make an identical deposit each year up to and including the year you begin college. If a deposit amount of $2,542.05 will allow you to reach your goal, what birthday are you celebrating today Zinc metal reacts with aqueous copper(II) chloride, as shown in this equation. If 3.03 x 1021 atoms of zinc react, how many grams of Cu will form? Show the sequence of conversions necessary, then calculate the numerical answer. Zn (s) + CuCl2 (aq) ---> ZnCl2 (aq) + Cu (s)