what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer 1

Answer:

AUGGCCUACGGUCUAGUUUAG


Related Questions

All life-forms survive on resources from the environment. So, each ecosystem can support only a certain number of organisms of each species. What would most likely happen if a species of herbivores exceeded what the particular ecosystem could support?

A. There will be less food for the secondary consumers.
B. There will be too few producers to provide energy for the system.
C. There will be no decomposition by bacteria and fungi.
D. There will be more food for the other primary consumers.

Answers

Answer:

maybe D

Explanation:

Answer: it's the second one

Explanation:

if there are lots of animals who eat grass then there will be very few producers (which are those plants + grass). Hope this helps!

hope this helps

what is the definition of the earth's crust

Answers

Isent it like the mantle

Answer:

“Crust” describes the outermost shell of a terrestrial planet.

Earth's crust is generally divided into older, thicker continental crust and younger, denser oceanic crust. Earth has three layers: the crust, the mantle, and the core. The crust is made of solid rocks and minerals.

What are the functions of the digestive system?

Answers

Answer:

The function of the digestive system is digestion and absorption.

Explanation:

Digestion is the breakdown of food into small molecules, which are then absorbed into the body.

Which section of the article BEST explains why the development of CRISPR-Cas9 is significant for the scientific community?

Answers

Answer:

It allows the scientists to activate gene expression instead of cutting the DNA.

Explanation:

The development of CRISPR-Cas9 is significant for the scientific community because this development allows the scientists to activate gene expression instead of cutting the DNA. This technique allows the scientists and researchers to study the function of the gene. Before development, Cas9 enzymes produced by the CRISPR system binds to the DNA and cuts it by shutting the targeted gene off so this development of CRISPR-Cas9 enables the scientists to activate gene expression instead of cutting the DNA.

Why do multicellular organisms perform mitosis and meiosis ?

Answers

Answer:

Multicellular organisms depend on mitosis for growth and repair. When an animal, plant or other multicellular organism grows, it makes more cells through mitosis. Organisms can repair some of their tissues, using mitosis to regenerate new cells.

Explanation:

If you have a hamster with long fur, what possible genotypes could the hamster have?

Answers

Answer:

Ll, Ll, LL

Explanation:

So, there is one thing we must remember to answer this:

1# dominant genes(long fur) are expressed over reccesive genes(short fur)

Knownign that dominant is over reccesive, it is simple. If the genotype was Ll or lL then the dominant long fur would be expressed over reccesive short fur. Long fur - Ll, lL

Next, we know that LL will be long fur since its both long and long, and there is no possibility for short fur. Long fur - LL

Finally. we have ll, and since there isnt a dominant long fur, and only reccesvie short, then this cannot be long fur. Short fur. - ll

Which of the following is responsible for carrying genetic instructions for making protein out of the nucleus?
DNA
mRNA
rRNA
tRNA

Answers

Answer:

tRNA

Explanation:

I have to have 20 characters but it's tRNA

PLEASE HELP ME

Why are planets round?
*
A.Gravity pulls mass in one direction

B.Gravity pushes mass out from the center

C.Gravity pulls mass into its core from all directions equally

D.Elliptical orbits smooth out planetary imperfections

Answers

Answer:

c

Explanation:

planets are round because of their gravitational field acts as though it pulls everything from the center of its body and pulls everything toward it

two or more tissues working together make up the blank level of organization.

Answers

Answer:

organ :)

Explanation:

the level of organization is cells-tissues-organ-organ system-organism

Viruses can be prevented by receiving a weakened form of the virus called a?

A)plastid
B)vaccine
C)antibiotic
D)fertilizer

Answers

vaccine, the answer is B

Where are spores produced in a fungus? Please give a explanation on the process of how these spores are produced and then sent out of the fungus for distrubution?

Answers

Answer: Here

Explanation: The fungus is located in an asci, and when the asci breaks open, the spores release in a cloud. This applies to cup fungi. Gilled mushrooms drop spores from the gills when the mushrooms mature

How is facilitated diffusion similar to
active transport?
A. Neither require energy.
B. They both use protein channels.
C. Both move against the concentration gradient.

Answers

B - They both use protein channels (I think so at least) they differ because active transports use a pump to leave the cell and it uses atp (cell energy).
B- they both use protein channels

Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) oxygen squared B) monoxide. C) oxide. D) diatomic oxygen.

Answers

A. Oxygen Is the most abundant

In what order are human beings classified?

Answers

Answer:

The order they are classified in is Primates

Explanation:

Please help i am giving away brainiliest

Describe the Lytic cycle.

No dam links

Answers

Answer: here ya go

Explanation: The lytic cycle is one of the two cycles of viral reproduction

Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.

Explanation:

What things were like before Malcolm X accomplishment?

Answers

Answer:

"His charisma and oratory skills helped him achieve national prominence in the Nation of Islam, a belief system that merged Islam with Black nationalism. After Malcolm X's assassination in 1965, his bestselling book, The Autobiography of Malcolm X, popularized his ideas and inspired the Black Power movement"

Malcom X other accomplishments were to create his own spiritual organization, and to stop racism.

In the illustration below, Picture 4 represents...
Opoints
Picture 1
Plcture 2
Picture 3
Picture 4

Answers

Answer:

i think it's A i'm not 100% sure let me know if it's right

Explanation:

Why do scientists that work on producing biofuel from algae need to understand algal reproduction?

Answers

Answer:

Due to more production of biofuel.

Explanation:

Scientists that work on producing biofuel from algae need to understand algal reproduction because reproduction of algae is responsible for the higher productivity of biofuel. Algae produce by both sexually and asexually means from the fusion of male and female gametes and from only one parent. Algae needs carbondioxide gas and light for the growth and reproduction so if these factors are present in sufficient amount then the algae increases in growth and reproduce rapidly which leads to higher production of biofuel.

Fuels acquired from biomass is called biofuel. Biomass can be a plant, animal waste or algae. It is a reservoir of renewable energy and can be supplied readily.

Scientists operating on biofuel need to learn about algal reproduction as algae is the major source of biofuel production.

The potency of biofuel depends on the generative cycle of the algae.

Algae can propagate asexually by means of spores and vegetatively or through sexually by producing the gametes.

If the determinants like carbon dioxide and sunlight required for reproduction are present in the right quantity then the algae will thrive and proliferate rapidly, thus increasing biofuel production.

Therefore for increasing biofuel production, we need to know the reproductive methods of algae.

To learn more about biofuels follow the link:

https://brainly.com/question/502679

Which conclusion is supported by the fact that the black-breed boar, with its quality meat, and the white-breed sow, with its quality fertility, are swine that are often matched for mating? Animals are often paired based on physical traits and personal compatibility. Strong reproductive capability is the most important trait in animal breeding. Selective breeding combines ideal traits of animals to replicate in offspring. Swine are the only agricultural animal species that are currently crossbred.

Answers

Answer:

Selective breeding combines ideal traits of animals to replicate in offspring

Explanation:

Selective breeding is the process which involves choosing parents with particular characteristics to breed together and produce offspring with more desirable characteristics. It is also known as artificial breeding and provides both plants and animals with greater variation and higher chances of survival. Selective breeding can be used to produce plants with bigger and tastier fruits and vegetables, crops with greater resistance to pests and diseases, and bigger animals that can be used for meat or milk production. The process of selective breeding is of great importance to the farmer today as it has brought about greater economic advantages.

In the instance of the black-breed boar and the white-breed sow being matched for mating, the reason is to combine these desirable traits in their offspring. The black-breed boar produces quality meat while the white-breed sow has quality fertility. Mating between these two breeds will produce offspring which has both traits of quality meat production as well as quality fertility.

Arturo ran a 3,000-meter race. His running time from start to finish was 10 minutes. What was Arturo's average speed?

Answers

Answer:

300 meters/min

Explanation:

average speed = distance / time

(3000 m) / (10 min) = 300 meter per minute

if you need it in meters/sec then just multiply 10 by 60 first and then continue

(3000 m) / (600 sec) = 5 m/s

Provide thorough details of how human population, interplanar, and extraplanar conditions contribute to global climate change.

Answers

Answer:

all i know is the one for the human population part shown in explanation by

ryuvrajsingh1298 ....

Explanation:

Population growth is also important because it affects the Earth's ability to withstand climate change and absorb emissions, such as through deforestation as land is converted for agricultural use to feed a growing human population. We are currently adding more than 80 million people a year to our global population.

I am sorry if this doesn't help.....

_

    M

        I

          N

               S

Two different populations of birds live in the same area and eat the same types of food. Which most likely describes the relationship between these two populations of birds?

A. Competition

B. Mutualism

C. parasitism

D. predator-prey

Answers

Answer:

A. Competition

Explanation:

Both species of bird need to compete for limited resources, in this case they need to compete for both territory and food

Answer:

Competition

Explanation:

What type of cells are produced in Meiosis?
What type of cells are produced in Mitosis?

Answers

Sexual cells such as gametes are produced in meiosis, while regular cells such as plant or animal ones are produced in mitosis.

What is the term for a male sheep that can be a
father?

Answers

Answer:

ram

Explanation:

What is the difference between physical properties and chemical properties of matter?
A. physical properties are recognized when substances react with one another, while chemical properties do not change the composition of matter,
B. physical properties cannot be studied, while chemical properties of matter can be studied
C.physical and chemical properties are the same thing
D. physical properties do not change the composition of matter, while chemical properties can be recognized only when substances react or don't react with one another

Answers

the answer is d. :) you got this!

Four groups of organic compounds found in living organisms are proteins carbohydrates lipids and nuclei acids. Which element is a main component in nucleic acids but not in the other three organic compounds?

Answers

Answer:

Phosphorus

Explanation:

Nucleic Acids are made up of Carbon, Hydrogen, Oxygen, Nitrogen, and Phosphorus. Remember that they have a sugar phosphate backbone and their nucleotide bases.

An easy way to remember what all four macromolecules are made up of is

CHO-CHO-CHON-CHONP

Carbohydrates-Lipids-Proteins-Nucleic Acids

Carbon(C)

Hydrogen(H)

Oxygen(O)

Nitrogen(N)

Phosphorus(P)

What does Greenberg identify as being a terrible problem, and how do we fix it?

Answers

To answer the question need to watch this video:

https://youtu.be/_jaWs87t5UM

Answer:

The correct answer is - A large amount of sea life is being taken from the ocean to feed other creatures.

Explanation:

In this video, Greenberg found out that there is a terrible problem as using fishing on a large scale causing harm to marine life and resulting in the extinction or endangering of species on large scale or taken from the ocean to feed other creatures.

To correct this he talks about the overfishing problems He talks about preventing people from overfishing so many fish do not have to face problems of extinction.

List one organism and describe all of its adaptations.​

Answers

Adaptation is a mechanism of species to survive and reproduce in their environments, adjusting to selective pressures. Cactus: leaves, stems, spines.

What is adaptation?

In biology, adaptation might be defined as the mechanism of organisms to improve their fitness in the environment in which they live, adjusting to different changes and selective pressures acting on them.

Adaptation involves molecular, physiological, morphological, and behavioral changes.

For these changes to persist and be transmitted from generation to generation, they must increase the individual's fitness. They must increase the individual survival and reproductive probabilities, making it more competitive.

A good and easy to unsderstand example of adaptation is the cactus.

Cactusses are plants adapted to dry and hot environments like deserts, where water availability is scarse and temperatures are high.

To avoid dehydration, cactusses have developed wide palmated or cilindirical stems and reduced or vestigial leaves.

They use stem tissues to store water. Vestigial or reduced leaves to avoid transpiration and water loss.

As their leaves are not developed, their stems photosynthetize to produce organic compounds.

Some species are very rich in water and nutrients, so they turn to be covetted by other species. Animals living in the same environment look for them as a source of food.

To avoid predation, cactusses have developed large and numeros spines that are leaves modifications. This is another adaptation to avoid being eaten by animals and avoid loosing water through leaves.

You can learn more about adaptations at

https://brainly.com/question/14420984


Can angiosperms be considered male or female?


Answers

The male structure makes the sperm (pollen) and the female have ovaries (which is eggs). So apart of the male.

Here's your answer: Their male

Which two molecules are produced over the course of the light and dark reactions of photosynthesis?

glucose

water

carbon dioxide

pyruvic acid

oxygen

Answers

the light independent reactions send NADP+ and ADP back to the light dependent reaction to convert them into ATP and NADPH. The light-independent reactions send the ATP and NADPH made during the light dependent reactions to the dark reaction to make glucose.
Other Questions
Ana took out a 4-year loan for 7,500 and paid 3.6% simple interest.How much was the total interest on the loan in dollars? WILLL GIVE BRAINLIST!!! Suppose mechanical weathering breaks a rock into pieces. How would this affect the rate at which the rock weathers chemically? How do chemical and physical weathering differ? Explain your answer in at least 3 sentences. Is global warming in a tundra biome secondary or primary succession? Why? PLEASE ANSWER PLEASE HELP ME FAST!!!The volume of a triangular prism is 32 cubic inches. The prism is 2 inches tall. What is the area of the base of the triangular prism?A. 4 square inchesB. 12 square inchesC. 8 square inchesD. 16 square inches What are examples of Health Informatics workplaces? Check all that apply.a home officea hospital cafeteriaa laboratory in a universitya medical clinics front office Determine whether the following can be modeled by a quadratic,exponential or linear function? Cancer triples every six months. quadraticexponentiallinear Hacemos arepas! Last night the Snchez family made arepas. Their mother, doa Olga, explains what each person did. Choose the right preterito . mi esposo Oswaldo _________________ la recetaleyleleolea Although Mark begins administering first aid when he notices his 8-month-oldson coughing, his son becomes unconscious. What should Mark do next?D. Mark should call 911 check for airway blockages and begin mouth to mouth breathing On average, women and girls in developing countries walk 6 kilometers(approximately 3.5 miles) a day, carrying 20 liters (approximately 42 pounds/20 kgs) ofwater. In some areas, it is common for this journey to take more than 15 hours a week. 1L = 0.26 gal. If you had to carry 20 liters of water, how many gallons would that beequivalent to? Help!Determine the perimeter of the triangle below. Find the range of the following data set: 5, 9, 2, 10, 3, 5 In Chapter Four of Lord of The Flies, what best symbolizes the savagery that is continuing to emerge from Jack?A. his insincere apology to PiggyB. his face paintingC. his attack on RalphD. his torturing of squirrels Jim bought some nice running shoes for $216. The salestax is 6.5% and he is paying cash with bills only becausehe doesn't have any change. What is the least amounthe should give the cashier? In 1775 George Washington was appointed as General and Commander inChief of the _______ army.A. British B. French C. Continental 9. The drone descends 2 feet per minute. Represent the drone's positionwith an integer after 7 minutes. *8 points Compare 1.41___1.397= What is the growth (or slope) of the simplified equation?? HURRRY! ILL GIVE BRAINLEST Mrs. Jordan surveyed all of her students to find out which testing format they prefer. Of the 120 students, 30 prefer ALEKS.com, 60 prefer paper, 10 prefer Deltamath.com and 20 prefer Microsoft Forms.What is the relative frequency of students who prefer taking their test online?answers: 17%25%8%50% Select whether the statement is for Speed, Velocity, or Acceleration.The earth travels at 30 kilometers per second.VelocitySpeedAcceleration A graphic designer creates a logo in the shape of an ellipse. The equation+64= 1, with units in centimeters,14.44represents the outer edge of the logo. How tall is the logo?