what organization founded in 1909 tested segregation and discrimination laws in the courts and provided legal counsel for jailed demonstrators? question 13 options: southern christian leadership conference congress of racial equality national association for the advancement of colored people

Answers

Answer 1

Answer:NAACP

Explanation: Dedicated to helping coloureds and fighting discrimination

Answer 2

The National Association for the Advancement of Colored People (NAACP) founded in 1909 tested segregation and discrimination laws in the courts and provided legal counsel for jailed demonstrators.

The National Association for the Advancement of Colored People (NAACP) was established on February 12, 1909, in response to the ongoing viciousness against Black people at the time. The founding members of the NAACP were black and white progressives who were committed to civil rights and equal justice. The organization is still active today and continues to be one of the United States' most influential civil rights organizations. The NAACP has played an important role in the advancement of civil rights in the United States over the last century.

One of the organization's most important efforts has been to challenge segregation and discrimination in the courts. By filing lawsuits and engaging in other forms of legal action, the NAACP has helped to strike down numerous laws and policies that were discriminatory towards Black people and other minorities. The NAACP also provides legal counsel for jailed demonstrators.

The organization has established a legal defense fund to provide financial and legal assistance to individuals who have been arrested for participating in civil rights protests or other forms of political activism. This fund has been critical in ensuring that individuals who are fighting for justice are not punished unfairly by the legal system.In conclusion, The National Association for the Advancement of Colored People (NAACP) founded in 1909 tested segregation and discrimination laws in the courts and provided legal counsel for jailed demonstrators.

For such more questions on Anti-discrimination laws

https://brainly.com/question/30052471

#SPJ11


Related Questions

How could the senate grow under rules set by the constitution?

Answers

Answer:

Explanation:

Firstly, the Constitution allows for the possibility of new states being admitted to the Union, which would in turn increase the number of Senators. Article IV, Section 3 of the Constitution gives Congress the power to admit new states to the Union, and each state is entitled to two Senators.

Secondly, the Constitution does not set a specific limit on the number of Senators that can serve in the chamber. Article I, Section 3 of the Constitution establishes the Senate as a body composed of two Senators from each state, but it does not set a maximum number of Senators that can serve in the chamber. This means that Congress could choose to increase the size of the Senate by passing legislation to create new Senate seats.

However, it's worth noting that changing the size of the Senate would likely be a politically contentious issue, and any proposal to increase the number of Senators would need to be approved by both the House of Representatives and the Senate before it could become law. Additionally, changing the size of the Senate would also require amending the Constitution, which is a difficult process that requires the approval of two-thirds of both the House of Representatives and the Senate, as well as the ratification of three-fourths of the states.

How can our system of federalism lead to conflict
between the states and the federal government?
Give your response in the form of at least three complete
sentences

Answers

While the Constitution expressly grants the federal government the power to act on behalf of the nation in many areas, it does leave some rights to the states.

What is a federalist system?

Federalism is a type of governance where numerous branches of government have jurisdiction over the same territory. Although the Constitution and federal law take precedence, implied powers exist but are not expressly mentioned. Below, this is further discussed.

In conclusion, analyzing the origins and solutions of political conflict—which results from people's differing viewpoints, interests, and values—requires an awareness of the strengths, weaknesses, and changes in public opinion.

Read more about the system of federalism, refer:

brainly.com/question/13038482

#SPJ1

Which line from extremely loud and incredibly close reveals a melancholy tone? as for the bracelet mom wore to the funeral, what i did was i converted dad’s last voice message into morse code, and i used sky-blue beads for silence, maroon beads for breaks between letters . . . she said it was the best gift she’d ever received. i asked her if it was better than the edible tsunami, from when i was interested in edible meteorological events. she said, “different.†i wanted to tell her she shouldn’t be playing scrabble yet. or looking in the mirror. or turning the stereo any louder than what you needed just to hear it. it wasn’t fair to dad, and it wasn’t fair to me. i made her other morse code jewelry with dad’s messagesâ€"a necklace, an anklet, some dangly earrings, a tiaraâ€"but the bracelet was definitely the most beautiful, probably because it was the last, which made it the most precious.

Answers

The line "it wasn't fair to dad, and it wasn't fair to me" reveals a melancholy tone.

The speaker is reflecting on the loss of his father and the effect it has had on his mother. The use of the word "fair" suggests a feeling of injustice or sadness about the situation. The speaker is also creating Morse code jewelry with his father's messages, which shows a desire to hold onto the memories of his father.

Overall, the tone of this passage is melancholic as the speaker grapples with the loss of his father and the impact it has had on his family.

Learn more about melancholy tone

https://brainly.com/question/9248513

#SPJ4

Complete Question:

Which line from the passage is extremely loud and incredibly close reveals a melancholy tone?

"as for the bracelet mom wore to the funeral, what i did was i converted dad's last voice message into morse code, and i used sky-blue beads for silence, maroon beads for breaks between letters . . . she said it was the best gift she'd ever received. i asked her if it was better than the edible tsunami, from when i was interested in edible meteorological events. she said, different. i wanted to tell her she shouldn't be playing scrabble yet. or looking in the mirror. or turning the stereo any louder than what you needed just to hear it. it wasn't fair to dad, and it wasn't fair to me. i made her other morse code jewelry with dad's messages' necklace, an anklet, some dangly earrings, a tiara's but the bracelet was definitely the most beautiful, probably because it was the last, which made it the most precious."

Answer:

(C) on edg   I wanted to tell her she shouldn’t be playing Scrabble yet. Or looking in the mirror. Or turning the stereo any louder than what you needed just to hear it. It wasn’t fair to Dad, and it wasn’t fair to me

Explanation:

trust me bro

which group welcomed black members and advocated the passage of antilynching legislation and the return of voting rights to southern blacks? group of answer choices the daughters of the american revolution. the republican party. the congress of industrial organizations. the house un-american activities committee. the american liberty league.

Answers

Answer:

The CIO welcomed black members and advocated the passage of antilynching laws and the return of voting rights to southern blacks. The one place it seemed where blacks were not discriminated against was within federal employment practices.

Explanation:

The CIO is a highly recommended group.

What is the constitutional basis of the national government

Answers

The constitutional basis of the national government in the United States is based on the principles of federalism, separation of powers, and individual rights and protections outlined in the U.S. Constitution.

The U.S. Constitution establishes a federal system of government, in which power is divided between the national government and the individual states. The powers of the national government are outlined in the Constitution's Article I, Section 8, and include the power to collect taxes, regulate commerce, declare war, and make laws necessary for carrying out the other powers listed in the Constitution.

The Constitution also establishes three branches of government: the legislative, executive, and judicial branches. The legislative branch is made up of the House of Representatives and the Senate, which together make up the U.S. Congress.

learn more about U.S. Constitution here:

https://brainly.com/question/14453917

#SPJ4

How alexander the great’s conquest of the persian empire?

Answers

Alexander the Great's conquest of the Persian Empire began in 334 BC, and it ended in 323 BC.

Alexander the Great was born in 356 BC in Macedonia and was the son of King Philip II. He began his conquest of Persia at the age of 20 after the death of his father in 336 BC.

Alexander defeated the Persian king Darius III at the Battle of Issus in 333 BC, capturing Darius' wife and mother, which aided in his conquest of Persia. After the Battle of Issus, he continued to conquer the eastern part of the Persian Empire, including Babylon, Susa, and Persepolis, the capital of the Achaemenid Empire. Darius III fled from the Battle of Issus and then in 331 BC was defeated in the Battle of Gaugamela, and his empire fell to Alexander the Great.

The Battle of Gaugamela was the last major battle in the conquest of the Persian Empire. Alexander the Great captured Babylon, the empire's cultural capital, in 331 BC, thus securing his position in Mesopotamia. The Persian Empire had existed for over 200 years, and it was the largest empire of the time, covering over 3 million square miles.

For more question on Persian Empire click on

https://brainly.com/question/19202302

#SPJ11

What new political party rose in
opposition to President Andrew Jackson?
What was the party's attitude toward the
power of the president?

Answers

The National Republican Party was founded by his political adversaries John Quincy Adams and Henry Clay, and it later merged with other anti-Jackson political organizations to become the Whig Party.

What are each of the American political parties?Those who band together to run for office, run the government, and shape public policy make up a political party. The two main parties in Congress at the moment are the Democratic and Republican. The Senate's political parties. Find out more about the U.S. Senate's differences across political parties.A political party is a group that arranges candidates to run in elections in a certain nation. It is typical for party members to share similar political viewpoints, and parties may support particular ideologies or policy objectives. The definition of "political party" in the federal campaign finance legislation is a group or organisation whose nominated or chosen candidates for federal office appear on the ballot as the party's candidates.

To learn more about political party, refer to:

https://brainly.com/question/633543

how does industrial war impact humans

Answers

Answer:

it impact humans by changing

how people worked, the technologies available to them, and often where they lived. It made life comfortable for many though living conditions for workers remained abhorrent, which eventually fueled the rise of labor unions that led to improved working conditions and fair wages.

how does this author justify european imperialism in africa?

Answers

European Imperialism in Africa was justified through various means, and resulted in the control of much of the continent by the European powers.

European Imperialism in Africa was justified through a variety of means. The most prominent was the concept of 'civilizing mission,' which asserted that it was the moral and ethical responsibility of the European powers to bring the benefits of European civilization to African peoples. This was supported by the notion of 'social Darwinism,' which saw the strongest powers and cultures as those who should dominate and civilize those less advanced.

This was further justified through claims of economic benefits, such as the opening of markets to European trade, and strategic advantages such as the acquisition of raw materials and new territories. In terms of the actual events of European Imperialism in Africa, the Berlin Conference of 1884 marked a formal start to the partitioning of Africa.

Various European powers sought to control the continent, with a particular focus on the 'Scramble for Africa.' Over the next two decades, the majority of African states and territories were colonized by the European powers. In many cases, this was done through military force and direct control over the colonized nations. Additionally, in some areas, the Europeans used diplomacy and other strategies to ensure control of strategic areas.  

Know more about European Imperialism  here:

https://brainly.com/question/31163874

#SPJ11

What Union rules did the Union Army put Henry Wirz on trial under and why is it ironic? Answer in one to two sentences.

Answers

The Union Army put Henry Wirz on trial under the rules of war for mistreating and conspiring to kill Union prisoners of war at Andersonville prison during the American Civil War. The irony is that Wirz was a Swiss immigrant who had been a doctor in the Confederate Army, and yet he was tried and executed by the Union Army for his role in the mistreatment of Union prisoners.

Only about one-third of Alaska’s human population live in Southcentral Alaska.
True
False

Answers

Explanation:

Only about one-third of Alaska’s human population live in Southcentral Alaska is true.

Answer:

I think it is false. I believe about half of Alaska's population lives in Southcentral Alaska, which includes the Anchorage metropolitan area.

which country did germany attack by using its blitzkrieg tactics for 57 nights in a row?

Answers

Germany attacked the United Kingdom by using its blitzkrieg tactics for 57 nights in a row.

The Blitz, which began on September 7, 1940, was a sustained bombing campaign by the German Luftwaffe against the cities of the United Kingdom, primarily London. Germany's use of blitzkrieg tactics allowed for rapid and devastating attacks, with a focus on destroying the enemy's infrastructure and morale.

The Blitz resulted in significant damage and loss of life, with over 40,000 civilian deaths in the United Kingdom. Despite the devastating impact of the Blitz, the United Kingdom did not surrender, and the German strategy of using air power alone to defeat the United Kingdom ultimately failed. The Blitz was a significant moment in World War II, shaping the course of the conflict and highlighting the importance of air power in modern warfare.

Learn more about blitzkrieg tactics :

https://brainly.com/question/11919823

#SPJ4

What was the relationship between Vietnam and the United States prior to the Vietnam War?
A. extremely positive
B. warm & fuzzy
C. very complex
D. extremely negative

Answers

Answer:

A

Explanation:

Answer:

B

Explanation:

what might have been the difficulties and the rewards of being an explorer in the 15th or 16th centuries?

Answers

The difficulties of being an explorer in the 15th and 16th centuries were immense – the technology to support them was limited and journeys were incredibly dangerous.

Explorers faced storms, rough seas, unfamiliar terrain, hostile natives and diseases. Furthermore, the financial risk of exploration was high, as explorers had to pay for ships and equipment themselves.

However, there were also great rewards. Explorers could gain fame and fortune from bringing home new discoveries and knowledge. They could also make a name for themselves as the first to discover lands, trade routes and resources. Exploration also allowed them to open up new worlds and cultures, promoting understanding, trade and diplomacy.

To know more about explorer, click here:

https://brainly.com/question/17800920

#SPJ4

Please help

The Cold War at Home to write two letters (4-5 Sentences each) from two different viewpoints. One is from the perspective of an American describing what has been going on in their life and one is from the perspective of someone from the Communist East (like East Berlin or the Soviet Union).

Answers

The US of America and the Soviet Association's change into imposing worldwide powers during The Second Great War strengthened their contention.

What was the Cold War ?

The communist nations of Eastern Europe and Western democracies experienced prolonged tension during the Cold War. The United States of America led the west, while the Soviet Union led Eastern Europe. These two nations came to be referred to as superpowers.

In a 1945 article, George Orwell gave this rivalry between the two superpowers its first name. Although historians disagree on the precise date when the Cold War ended, most agree that it was marked by the implementation of nuclear and conventional arms control agreements, the withdrawal of Soviet military forces from Afghanistan and Eastern Europe, and the fall of the Soviet Union.

To learn more about war visit :

https://brainly.com/question/3445478

#SPJ1

15. What type of success did the United States have with their rocket program when it first started?

Answers

Answer: The launch of Explorer 1, the country's first satellite

Explanation: One of the most significant successes of the US rocket program was the launch of Explorer 1, the country's first satellite, in 1958. This was followed by a series of other successful satellite launches, as well as manned space missions and unmanned missions to explore the moon and other planets.

Ultimately, the US rocket program was a remarkable success, culminating in the historic landing of astronauts Neil Armstrong and Edwin "Buzz" Aldrin on the moon in 1969. The US continues to be a leader in the field of rocketry and space exploration to this day, with ongoing missions to explore the solar system and beyond.

Why did Washington blame “democratic societies” for the crisis? Did he go too far?

Answers

Answer:

I am sorry, but I cannot provide an accurate answer to your questions. Can you please provide me with additional context or information, such as who or what crisis Washington was referring to and in what historical context? Thank you.

Simón bolívar was known as the “liberator†because he liberated:___.a. southern south america from spanish rule. b. southern south america from french rule.c. northern south america from spanish rule. d. northern south america from french rule.

Answers

Simón Bolívar was known as the "liberator" because he played a significant role in the independence movements of several South American countries, particularly in northern South America, including Venezuela, Colombia, Ecuador, Peru, and Bolivia.

Therefore, the correct answer is C, northern South America from Spanish rule.

Bolívar was a military leader and politician who fought for the independence of these countries from Spanish colonial rule during the early 19th century. He led numerous battles and campaigns against the Spanish forces, culminating in the victory at the Battle of Boyacá in 1819, which secured the independence of Colombia and Venezuela.

Bolívar's legacy as a liberator and a visionary leader is celebrated throughout Latin America, and his contributions to the cause of independence remain an important part of the region's history and identity.

The correct answer is C

Learn more about the Simón Bolívar:

brainly.com/question/1402690

#SPJ4

during the nineteenth century, several european powers pursued a policy of imperialism in africa and asia. what was one important effect of european imperialism in africa?

Answers

One important effect of European imperialism in Africa was that several European powers pursued a policy of imperialism in Africa and Asia during the 19th century.

What was the impact of European imperialism in Africa?

The impact of European imperialism in Africa was that it made the African people dependent on the Europeans for the goods that they once produced themselves.

Europeans also exploited Africans' labor and resources to generate wealth, causing social, political, and economic upheaval in Africa.

Therefore, European imperialism has created long-lasting effects, such as economic inequality, poverty, and a host of other social issues, on the African continent.

Furthermore, it created artificial national borders that often divided ethnic and linguistic groups, leading to conflicts and wars that continue to this day.

To learn more about imperialism, refer below:

https://brainly.com/question/1225474#

#SPJ11

Hitler's allies are on the move. Japan invades Manchuria as far back as 1931, world does nothing. Hitler, having seen the world do nothing, now wants a bigger piece of Europe. annexes Austria. Now demands the German speaking parts of the Czech Republic, called Sudatenland. Neville Chamberlain goes to meet with Hitler, agrees to give him what he wants, with promises that Hitler will not demand anything more. Signs the Munich Agreement, which when he comes home, says "we have peace in our time." Of course this is wrong. What is this policy called of giving in to aggression, in the hopes that it will prevent war?

Answers

Appeasement Policy is this policy called of giving in to aggression, in the hopes that it will prevent war.

In this question , once Hitler requested the German-speaking regions of the Czech Republic to be renamed Sudatenland and Austria was annexed, Neville Chamberlain acceded to his demands.

He used the policy of Appeasement in hopes that it will prevent war.

So, the answer is the Policy of Appeasement.

How did the appeasement strategy promote hostility?

Hitler took too many chances because he believed he could do whatever he wanted as a result of appeasement, not knowing when the allied forces would strike again.

Hitler was encouraged to be more aggressive by appeasement, and each success gave him greater self-assurance and authority.

To know more about Appeasement visit:

https://brainly.com/question/11969058

#SPJ1

Which statement best describes Harriet Tubman's contribution to the Union war effort?

A. Harriet Tubman helped to enlist Black soldiers.

B. Harriet Tubman spied for the Union by posing as an enslaved
person in the Confederate White House.

C. Harriet Tubman led a Union raid that resulted in over 700 enslaved people being freed.

D. Harriet Tubman became an army nurse and reached the rank of major.

Answers

The statement that best describes Harriet Tubman's contribution to the Union war effort is A: Harriet Tubman helped to enlist Black soldiers.

What is Harriet Tubman's Contribution to the Union War Effort?

Tubman was an abolitionist who worked as a nurse, cook, and spy during the Civil War, and she also played a significant role in recruiting Black troops for the Union army. She traveled to the South to organize and train Black soldiers, working closely with Union leaders to ensure that they were given equal pay and treatment.

Tubman's efforts helped to significantly increase the number of Black soldiers in the Union army, which was crucial to the Union's ultimate victory in the Civil War.

Learn more about Union War on:

https://brainly.com/question/29614372

#SPJ1

Answer:

its c

Explanation:

Explain ONE major difference between Willams’ and Zinn’s interpretations of
America’s Cold War actions abroad

Answers

According to Zinn's account, immigrants contribute to the economy through their diverse range of employment and political activities. Furthermore, many political machines saw immigrants as potential supporters.The Constitution was an agreement between those in the North and those in the South. The Northern representatives desired laws governing interstate trade that could be passed by a simple majority of Congress.The rationale was that if people of great riches and power had everything on their side - land, money, industry, church, education - voting would have no effect on their power. Howard Zinn and Larry Schweikart hold diametrically opposed perspectives on American history. Their political views influenced and guided their interpretations. Howard Zinn was a journalist. a lifelong leftist and critic of American society, while Schweikart is an arch-conservative.

The United States home front during the First World War was marked by an increase in all of the following EXCEPT
answer choices
government regulation of fuel, food, and transportation
employment opportunities for African Americans and Mexican Americans
participation of women in factory work, government service, and volunteer work

Answers

Option (d), With the exception of the Supreme Court's support for individual liberty, all of the following increased on the home front in the United States during the First World War.

Why are civil liberties restricted for Americans during times of war?

Consider this: Throughout all three of America's great wars—the American Civil War, World War I, and World War II—the government restricted citizens' civil liberties in an effort to quell dissent, muzzle criticism of political decisions, and safeguard national security. 24-Sept-2001

What is an example of a Supreme Court ruling that protects personal freedoms?

The Supreme Court's ruling in Tinker v. Des Moines Independent Community School District (1969), which allowed public school students to protest the Vietnam War by wearing black armbands to school, provides proof that symbolic expression is covered by the First Amendment.

Learn more about citizens' civil liberties: https://brainly.com/question/2836536

#SPJ1

The correct question is:

The United States home front during the First World War was marked by an increase in all of the following EXCEPT

government regulation of fuel, food, and transportationemployment opportunities for African Americans and Mexican Americansparticipation of women in factory work, government service, and volunteer worksupport of individual liberties by the Supreme Court

Which industry was most affected by the contributions of Howard Hughes, Sr.? answer choices. Agriculture. Communication. Petroleum.

Answers

Howard Hughes Sr. was primarily involved in the petroleum industry. He was a successful businessman who founded the Hughes Tool Company, which manufactured drill bits used in oil drilling.

He also developed several other oil-related technologies that were instrumental in the growth of the petroleum industry in the United States. The industry most affected by the contributions of Howard Hughes Sr. was the petroleum industry. Hughes Sr. was a pioneer in the development of new technologies for oil drilling and exploration.

He founded the Hughes Tool Company, which manufactured drill bits used in oil drilling, and developed other oil-related technologies, such as the rotary drill bit and the Hughes two-cone bit. These technologies made oil drilling faster, more efficient, and more profitable, and were instrumental in the growth of the petroleum industry in the United States. Hughes Sr.'s contributions to the petroleum industry helped transform it into the major global industry it is today.

Learn more about Howard Hughes Sr.

https://brainly.com/question/31116057

#SPJ4

5
World War I- France, Britain, and Russia (and later Japan, Italy and the USA)1

Answers

World War I was global conflict that took place between 1914 and 1918.

What was the World War I?

World War I was global war that lasted from the 1914 to 1918. It involved the majority of the world's nations, including all of the great powers, and was primarily centered in Europe. The immediate trigger for the war was the assassination of Archduke Franz Ferdinand of Austria-Hungary in June 1914, which led to a series of alliances and declarations of war. The war was characterized by trench warfare, new military technologies, and devastating casualties. It resulted in the deaths of millions of people and led to significant political and social changes, including the dissolution of empires, the redrawing of national borders, and the rise of nationalism and totalitarianism.

To learn more about World War I, visit:

https://brainly.com/question/28927253

#SPJ1

why do you think military spending decreased steadily in the early 1970s

Answers

Answer:

The decrease in military spending in the early 1970s can be attributed to several factors, including:

The end of the Vietnam War: The Vietnam War was one of the costliest military conflicts in American history, and it was a major driver of military spending in the 1960s. By the early 1970s, the United States was winding down its involvement in the war, and this led to a reduction in military spending.

Budget constraints: The United States was facing economic challenges in the early 1970s, including high inflation and rising energy costs. As a result, there was pressure to reduce government spending across the board, including military spending.

Changing political priorities: The political climate in the early 1970s was shifting, with a growing emphasis on domestic issues such as civil rights, environmental protection, and social welfare programs. This meant that there was less support for military spending among some politicians and the general public.

Overall, a combination of these factors led to a steady decrease in military spending in the early 1970s. However, it's worth noting that military spending has fluctuated over time and is influenced by a variety of political, economic, and strategic factors.

Explanation:

5. What is Islam's MAIN teaching?
There is only one God.
O Muslims must memorize the Qur'an.
O Muslims must follow Muhammad's example.
O People should pray on Fridays.

Answers

The main teaching of Islam is that there is only one God, known as Allah, and that Muhammad is the final prophet and messenger of Allah.

What is the main teaching of Islam?

This belief is known as the declaration of faith or shahada, which states "There is no god but Allah, and Muhammad is the messenger of Allah."

While Muslims are encouraged to memorize the Qur'an and follow Muhammad's example, these are not the main teachings of Islam.Prayer on Fridays is also important in Islam, but it is not the main teaching either.

The central focus of Islam is on monotheism and submission to the will of Allah, which is the meaning of the word "Islam" itself. Muslims are expected to live their lives in accordance with the teachings of the Qur'an and the example of the Prophet Muhammad, with an emphasis on compassion, justice, and obedience to Allah.

Learn more about Islam at:

https://brainly.com/question/1214743

#SPJ1

how did the treaty of versailles aim to maintain peace

Answers

The Treaty of Versailles was one of the peace treaties that ended World War I. Its main aim was to maintain peace by creating a new international order that would prevent future wars. The treaty included several key provisions that were designed to achieve this goal:

Disarmament: The treaty required Germany to disarm, limiting its army to just 100,000 men and prohibiting it from possessing heavy artillery, tanks, and aircraft. This was intended to prevent Germany from becoming a military threat to other European countries.

War Guilt and Reparations: The treaty placed sole responsibility for the war on Germany and its allies, and required Germany to pay reparations to the victorious powers. This was intended to punish Germany and deter it from starting another war.

League of Nations: The treaty established the League of Nations, an international organization whose purpose was to promote peace and resolve disputes between nations through negotiation and diplomacy. The League of Nations was intended to provide a forum for nations to resolve their differences peacefully rather than resorting to war.

Despite these intentions, the Treaty of Versailles was criticized by many for its harsh treatment of Germany and its failure to address underlying issues that led to the war, such as nationalism and the desire for territorial expansion. The treaty's disarmament provisions also led to a sense of insecurity among many European nations, which may have contributed to the rise of aggressive nationalist regimes in the 1930s and the outbreak of World War II.

Learn more about Versailles ,

https://brainly.com/question/1800157

#SPJ4

at the munich conference in 1938, britain and france

Answers

At the Munich Conference in 1938, Britain and France agreed to the appeasement policy, allowing Germany to annex Czechoslovakia's Sudetenland region.

In the lead-up to World War II, the Munich Conference was a pivotal moment in international diplomacy. British Prime Minister Neville Chamberlain and French Premier Édouard Daladier agreed to allow Germany's annexation of Czechoslovakia's Sudetenland region, despite protests from Czechoslovakia and the Soviet Union.

The agreement was based on the appeasement policy, which sought to avoid war by giving in to the demands of aggressive nations like Nazi Germany. However, the Munich Agreement ultimately failed to prevent the outbreak of war, as Germany continued its expansionist ambitions, leading to the invasion of Poland and the beginning of World War II.

Learn more about  Munich Conference https://brainly.com/question/1476947

#SPJ11

CRITICAL THINKING QUESTIONS

Of the three types of stories, which do you think would be the most challenging to write and why?

Answers

Of the three types of stories, I believe that writing a character-driven story would be the most challenge . This is because a character-driven story requires the writer to create well-developed and complex characters that readers can empathize with and become invested in.

It also requires the writer to craft a plot that is driven by the characters' actions and decisions rather than external events.To write a successful character-driven story, the writer must have a deep understanding of human nature and psychology, as well as the ability to create multidimensional characters with flaws and contradictions. The writer must also be skilled in creating tension and conflict through the interactions between characters and their internal struggles.In contrast, a plot-driven story relies more heavily on external events and action to drive the narrative forward, and a theme-driven story focuses more on exploring a particular idea or message. While these types of stories still require skillful writing and storytelling, they may be more straightforward in terms of creating compelling characters and developing their internal journeys.

To learn more about challenge click the link below:

brainly.com/question/9176487

#SPJ1

Other Questions
James is a new project manager and is struggling to meet deadlines. He approaches his director and begins to complain to him about all the problems with the project. James is obviously stressed and not thinking clearly. His director calmly slows James down and has him start from the beginning and asks him to focus on one question or problem at a time. Soon, James is speaking clearly and each question and problem is addressed.What problem solving method did James director use to improve the situation? For the function p = 2 - 3q. what is the instantaneous rate of change function? A piece of property contains 1,758.1066 sq. yards. How many yards are on each side of the square? How did the passage of Jim Crow laws in the South affect Black Americans?A. Jim Crow laws forced Black Americans to move North.B. Jim Crow laws forced Black Americans to move to Africa.C. Jim Crow laws took away rights from Black Americans.D. Jim Crow laws encouraged the development of the sharecroppingsystem. PLEASE HELP ME MATH. I WILL GIVE BRAINLISEST mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply. true or false? two proofs are required to establish the provable equivalence of two sentences of tfl. Why was the National Association of REALTORS Code of Ethics created? One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference? Which graph represents the solution to inequality which atomic particles are in a unique cloud outside of the nucleus of the atom? HELPPPPPPPPPPPP Plsss Solve 4^-2x 4^x = 641) Rewrite the equation using the same base. 2) Solve for x. Remember to show all work.PLEASE SHOW ALL WORK FOR BRAINLIEST PLEASEEE A buffer solution is prepared by adding NaH2PO4 to a solution of H3PO4. What happens if KOH is added? (1 point) one of the one-way functions used in public key cryptography is integer multiplication/factorization. multiplying two integers is easy, but factoring is hard. the number 3174277 is the product of two primes.what is the smaller of the two primes?what is the largest of the two primes?