mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.

Answers

Answer 1

Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance

What is inheritance?

Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.

Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.


The law of segregation,
which states that the two alleles of a gene separate into different gametes when a plant produces gametes (sex cells).
The law of independent assortment, which states that each pair of alleles segregates independently during gamete production.
The law of dominance, which states that a dominant allele will always be expressed in the phenotype of the organism.

To know more about inheritance of traits refer here:

https://brainly.com/question/22686199#

#SPJ11


Related Questions

6. which location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is not sufficient. explain.

Answers

The location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is an oil spill.

Oil spills can lead to fish kills because they block sunlight and oxygen exchange at the surface of the water and they also cause a reduction in oxygen levels because bacteria consume the oil and use up the oxygen in the process. These conditions can make it impossible for fish and other marine life to survive. Other possible factors that can lead to large fish kills include algae blooms occur when there is an excessive growth of algae in the water. The algae consume the oxygen in the water, leading to a decrease in oxygen levels that can be deadly for fish.

Wastewater that is high in organic matter can also lead to fish kills. Bacteria in the water consume the organic matter and use up the oxygen in the process, leading to a decrease in oxygen levels that can be deadly for fish. Extreme weather conditions such as drought, heatwaves, and cold snaps can also lead to fish kills. For example, when the water temperature is too high, fish may become stressed and die. Conversely, when the water temperature is too low, fish may become sluggish and vulnerable to predators.

Learn more about oil spill at:

https://brainly.com/question/1307422

#SPJ11

a bacterial species differs from a species of eukaryotic organisms in that a bacterial species group of answer choices does not breed with other species. breeds with its own species. can be distinguished from other bacterial species. is a population of cells with similar characteristics. has a limited geographical distribution.

Answers

"A bacterial species differs from a species of eukaryotic organisms in that a bacterial species does not breed with other species."

A bacterial species does not interbreed with other species, but will only breed with its own species. This is different from a species of eukaryotic organisms, which may be able to breed with other species. Additionally, bacterial species can be distinguished from other bacterial species based on characteristics such as morphology, genetic makeup, and metabolic characteristics. Bacterial species also typically have a limited geographical distribution.

Learn more about bacterial species: https://brainly.com/question/8695285

#SPJ11

a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left.true or false

Answers

The statement "a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left" is False.

A decision tree is read from left to right, but the conditions are usually represented as nodes or circles, and the actions or outcomes are represented as branches or lines. The conditions are evaluated at each node, and based on the outcome of that evaluation, the tree branches off to the next node, and so on until an action or outcome is reached.

The branches are typically labeled with probabilities or expected values, and the goal of the decision tree is to identify the optimal decision or course of action based on the available information and the desired outcome.

To learn more about decision tree refer to:

brainly.com/question/30673588

#SPJ4

observe your frog heart after it has been removed. did it continue to beat? how? what else did you learn from your frog? anatomy? physiology? did you do any further tests? please elaborate. g

Answers

Yes, the frog heart continued to beat after it had been removed. This is due to the intrinsic excitability of the myocardium, or muscle tissue in the heart. This intrinsic excitability means that the heart can continue to beat without any external input from the nervous system.

From observing the frog heart, we can learn about anatomy and physiology. Anatomy refers to the structure and physical form of the heart. We can see the size and shape of the heart and the blood vessels entering and leaving it. Physiology is the function and processes of the heart. We can observe how the heart beats and pumps blood.

Further tests could include a detailed analysis of the heart rate. This could involve measuring the heart rate over time, looking for any changes in rate, or measuring the heart rate under various conditions. Additionally, one could measure the electrical activity of the heart by using an electrocardiogram. This would involve placing electrodes on the heart and measuring the electrical impulses.

In conclusion, by observing the frog heart we can learn about both anatomy and physiology and also explore other tests to gain a deeper understanding of the heart’s function.

For more such questions on Frog heart.

https://brainly.com/question/11126450#

#SPJ11

What is transport in humans and plants and what is the difference?

Answers

Answer:

In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.

Explanation:

Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices

Answers

Answer: c. isotopes

Explanation:

maybe sorry if wrong

Can someone help me with this question please

Explain why there is no set number of mutations that always result in cancer.

Answers

Answer:

There is no set number of mutations that always result in cancer because the development of cancer is a complex process influenced by many factors. Cancer can arise from mutations in many different genes that affect the regulation of cell growth and division, DNA repair mechanisms, and other important cellular processes. Additionally, the accumulation of mutations can be influenced by external factors such as exposure to carcinogens like tobacco smoke, radiation, or certain chemicals, as well as by lifestyle factors like diet and physical activity.

Some mutations may have little effect on the development of cancer, while others may be critical drivers of the disease. The number and type of mutations required for cancer to develop can vary depending on the type of cancer, the individual's genetic makeup, and other factors such as exposure to environmental factors or lifestyle choices. Therefore, there is no set number of mutations that always result in cancer, and the development of cancer is a complex and multifactorial process.

Which type of valve opens in response to increasing pressure in the ventricles?

Answers

The type of valve opens in response to increasing pressure is semilunar valves.

Semilunar valve, one of two pocket-like, half-moon-shaped organs that connect the heart's left and right ventricles to the aorta (aortic valve) and pulmonary artery, respectively. The semilunar valves allows blood to flow into the arteries from the ventricles and prohibit the backward flow of blood from the arteries into the ventricles.

The endocardium, a thin, smooth membrane, and connective tissue make up the semilunar valves. The atrioventricular valves, which are situated halfway between the atrium and the ventricle, cooperate with them in order to function. The audible pulse is connected to the closure of the heart valves. The atrioventricular valves close first, followed by the pulmonary and aortic semilunar valves, which produce the second sound.

Learn more about Semilunar valves:

https://brainly.com/question/14481540

#SPJ4

two proteins interact to form a multimeric complex. when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. this type of mutation is classified as .

Answers

When one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

What is a loss-of-function mutation?

A loss-of-function mutation is a type of genetic mutation in which a gene's normal function is impaired or eliminated. This type of mutation can lead to a decrease or complete loss of protein function in the body. It might result in the inability to produce a protein or the production of a defective protein, both of which can have consequences for normal biological function. The severity of loss-of-function mutations can differ, depending on the importance of the protein and the extent of the mutation.

To sum up, when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

Learn more about mutation: https://brainly.com/question/14438201

#SPJ11

mcat the association observed experimentally between the expression of mirnas and mrnas in ar kidney transplants indicates that mirnas regulate the expression of genes implicated in which type(s) of immune response(s)?

Answers

In the cell cytoplasm, messenger RNA (mRNA) and microRNA bind to control the majority of gene expression. The designated mRNA will either be destroyed or its components recycled, rather than being promptly translated into a protein.

How does the cytoplasm work?

The gel-like liquid that makes up a cell's cytoplasm. Chemical reactions take place in it as the medium. It gives other organelles in the cell a base from which to function. The cytoplasm of something like a cell performs every task necessary for cell division, growth, and replication.

The cytoplasm is what, exactly?

History. First used as a synonym to protoplasm when Rudolf von Kölliker first coined the phrase in 1863, the phrase has since come to refer to the cell's interior and extracellular organelles.

To know more about cytoplasm visit:

https://brainly.com/question/15417320

#SPJ1

How does the location structure of the endocrine organs in the fetal pig differ from that in humans?

Answers

The adrenal glands are found near the aorta towards the cephalic end of the kidneys unlike the humans where it is present at the top of the kidneys.

Adrenal glands are the small triangular shaped kidneys. They are responsible for producing the hormones that regulate the functions of metabolism, immune system, blood pressure, or response to stress. These hormones are aldosterone, cortisol, androgens and estrogen.

Kidneys are the organs present in a pair and are of the shape of beans. The function of kidneys is to filter the blood and remove all the impurities in the form of dissolved ions, proteins, and waste water. The kidney have a basic functional unit called the nephron.

To know more about adrenal glands, here

brainly.com/question/1406904

#SPJ4

explain each step of the skeletal muscle contraction process in your own words using the sliding filament theory

Answers

The sliding filament theory has various steps including Nerve impulse, Acetylcholine release, Muscle fiber depolarization, Calcium release and Cross-bridge formation.

Skeletal muscle contraction is a complex process that involves the interaction of different proteins in the muscle fibers. Here are the steps of the skeletal muscle contraction process using the sliding filament theory:

Nerve impulse: Skeletal muscle contraction begins with a nerve impulse that travels down a motor neuron and reaches the neuromuscular junction, which is the point where the motor neuron meets the muscle fiber.Acetylcholine release: When the nerve impulse reaches the neuromuscular junction, it triggers the release of a neurotransmitter called acetylcholine into the synaptic cleft, which is the tiny gap between the motor neuron and the muscle fiber.Muscle fiber depolarization: The acetylcholine molecules bind to receptors on the muscle fiber membrane, which causes a depolarization of the muscle fiber. This depolarization spreads along the membrane and into the interior of the muscle fiber through a network of tubules called the T-tubules.Calcium release: The depolarization of the muscle fiber triggers the release of calcium ions from the sarcoplasmic reticulum, which is a specialized organelle that stores calcium ions in muscle fibers.Cross-bridge formation: The calcium ions bind to a protein called troponin, which causes a change in the shape of another protein called tropomyosin. This change in shape exposes binding sites on the protein actin, which forms the thin filaments of muscle fibers.

To know more about sliding filament theory

brainly.com/question/30404392

#SPJ4

what are the two ways the video mentions that invasive species can be introduced into aquatic ecosystems? a) on ship hulls and in large aquariums b) on ship hulls and through hitchhikers c) in ballast water found in ships and through fish farm nets d) in ballast water found in ships and as bait in commercial fishing expeditions please select the best answer from the choices provided a b c d

Answers

Invasive species can be introduced into aquatic ecosystems through a variety of pathways, but the video mentions two specific ways.

The first way is through ballast water found in ships, which is water taken on board to stabilize the vessel during travel. When the ship reaches its destination, this ballast water is discharged along with any organisms it may contain, including potential invasive species. This is a common pathway for the introduction of aquatic invasive species.

The second way is through the use of live bait in commercial fishing expeditions. Live bait can contain non-native species that can be introduced into new environments if they are not properly disposed of. This pathway is often overlooked but can be an important source of invasive species in aquatic ecosystems.

Therefore, the correct answer is d) in ballast water found in ships and as bait in commercial fishing expeditions.

To learn more about aquatic ecosystems visit;

https://brainly.com/question/4967501

#SPJ4

ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides. True or False?

Answers

The given statement "ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides" true. because ddNTPs (dideoxynucleotides) are used in Sanger sequencing to terminate DNA synthesis, allowing for the determination of the nucleotide sequence of a DNA fragment.

To differentiate between the different nucleotides, ddNTPs are labeled with different fluorescent dyes, each of which emits a unique wavelength of light. The fluorescent signal emitted by the ddNTPs is detected by a laser during sequencing, allowing for the identification of the nucleotide sequence of the DNA fragment.

Therefore, labeling ddNTPs with fluorescent dyes is an important part of Sanger sequencing. SO, The given statement is true.

To learn more about nucleotides

https://brainly.com/question/13185536

#SPJ4

where are old world monkeys found? group of answer choices africa and northern europe mexico and south america sub saharan africa, southern asia, and northern japan india and southern asia only north america and mexico

Answers

Old-world monkeys are found in sub-Saharan Africa, southern Asia, and northern Japan.

Old-world monkeys have divided nostrils and, unlike the new-world monkeys, do not have a prehensile tail. These monkeys include baboons, mandrills, macaques, colobus, langurs, guenons, and many others. Old world monkeys (Cercopithecoidea) are a family of primates that belong to the order of primates.

They are classified into two different categories: the New World monkeys and the Old World monkeys. Old World monkeys are from Africa and southern Asia, including Japan. They have a wider range than New World monkeys, which are limited to Central and South America.

Old World monkeys differ from New World monkeys in a number of ways. They have longer, more developed noses, and they lack a prehensile tail, which means that they cannot hold onto things with their tail.

Old World monkeys are arboreal and can be found in almost all types of forests, including rainforests and deciduous forests. They can also be found in savannas and grasslands.

Learn more about old-world monkeys here:

brainly.com/question/28892484

#SPJ11

Which of the parent cells can transmit the changed DNA to the offspring?

Answers

Through the process of cell division and reproduction, any parent cell that experiences a change in its DNA (genetic material) has the potential to pass the altered DNA to its offspring.

The egg cell (female gamete) and the sperm cell (male gamete) are the two parent cells in sexual reproduction, and they each provide the baby with half of its genetic makeup. An alteration in the DNA of either the egg or the sperm cell, such as a mutation, can be passed on to the progeny.

Asexual reproduction creates identical children by dividing the parent cell. Before dividing, if the parent cell goes through a DNA alteration, this DNA change will be present in both the parent cell and the child.

The type and magnitude of the DNA mutation, as well as other parameters including the progeny's viability and survival, all play a role in determining whether altered DNA is transmitted to offspring during sexual and asexual reproduction.

To know more about cell division,

https://brainly.com/question/29773280

#SPJ4

Table 2. Philippine Volcanoes Worth Seeing

Province

Active Volcano

Interesting Facts

1

2

3

4.

5. ​

Answers

Here are some active volcanoes in the Philippines that are worth seeing and some interesting facts about them:

Province: Albay

Active Volcano: Mayon Volcano

Interesting Facts:

Mayon Volcano is an iconic landmark of the Bicol region and is renowned for its perfect cone shape.

It is the most active volcano in the Philippines, having erupted over 50 times in the last 500 years.

Mayon is known for its "Lava Fountaining," where it produces ash columns and lava flows that can be seen from miles away.

Province: Batangas

Active Volcano: Taal Volcano

Interesting Facts:

Taal Volcano is a complex volcano located on the island of Luzon in the province of Batangas.

It is one of the smallest active volcanoes in the world but has been very active throughout history.

Taal has erupted over 30 times since the 16th century, with the most recent eruption occurring in January 2020.

Taal Volcano has a crater lake which can be reached by boat, and tourists can enjoy scenic views of the volcano from Tagaytay City.

Province: Camiguin

Active Volcano: Mount Hibok-Hibok

Interesting Facts:

Mount Hibok-Hibok is the only active volcano on the island of Camiguin.

It has erupted at least 5 times in the past century, with the most recent one happening in 1951.

Mount Hibok-Hibok is a popular hiking destination among locals and tourists, offering stunning views of the island and the sea.

Province: Sorsogon

Active Volcano: Bulusan Volcano

Interesting Facts:

Bulusan Volcano is located in the province of Sorsogon in Bicol and is one of the most active volcanoes in the Philippines.

It has erupted over 15 times since the 19th century, with the most recent eruption occurring in 2020.

Bulusan is a popular hiking destination, with several trails leading to its crater and offering breathtaking views of the surrounding landscape.

Learn more about volcanoes here brainly.com/question/12945128

#SPJ4

a black haired true breeding guinea pig is crossed with a white haired true breeding guinea pig. all of the offspring have black hair.

a. which color is dominant?
b. what are the genotypes and phenotypes of the parents?
c. what are the genotypes and phenotypes of the offspring?

Answers

a. Their phenotypes are black-haired and white-haired, respectively.

b. The genotype and phenotype of all offspring are BB and black-haired, respectively.

c. All of the offspring have black hair, so they must all have the genotype BB.

What are the genotypes and phenotypes of the parents?

In this case, we can infer that black hair color is dominant over white hair color since all offspring have black hair.

Since they are both true breeding, their genotypes are homozygous dominant and homozygous recessive, respectively. Therefore, the genotypes of the parents are BB and bb. Their phenotypes are black-haired and white-haired, respectively.

Let's denote the black-haired true breeding guinea pig as BB and the white-haired true breeding guinea pig as bb.

Therefore, the genotype and phenotype of all offspring are BB and black-haired, respectively.

Learn more about genotype here: https://brainly.com/question/902712

#SPJ1

What happens after glycolysis but before citric acid cycle?

Answers

I think it’s oxidative phosphorylation when in presence of oxygen.

body cells contain a full set of chromosomes from each parent. these _____ chromosomes contain matching gene sequences.

Answers

Answer:

Explanation:

Human body cells (somatic cells) have 46 chromosomes. A somatic cell contains two matched sets of chromosomes, a configuration known as diploid. The letter n is used to represent a single set of chromosomes; therefore, a diploid organism is designated 2 n.

What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?

Answers

The significance of crossing over is the creation of new combinations of genetic material in offspring.

Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.

It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.

To learn more about Crossing over, here

https://brainly.com/question/19671756

#SPJ4

TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA

Answers

AUG UCC UAG UAA AGC GCU UGC CUC GGC CUU GA(?) last letter there is gone

what component/protein/subunit is present in the holoenzyme but is not present in the core enzyme in prokaryotes?Select one:O rhoO beta primeO optimus primesO deltaO sigma

Answers

The sigma subunit is present in the holoenzyme but is not present in the core enzyme in prokaryotes.

An enzyme is a type of protein that functions as a biological catalyst by speeding up chemical reactions. A holoenzyme is a protein that is enzymatically active and made up of an apoenzyme and a cofactor. The apoenzyme is a protein that isn't yet fully functional without the cofactor. The holoenzyme is the cofactor and apoenzyme combined, which is enzymatically active. The core enzyme is the apoenzyme in its free state, which is inactive and lacks cofactors. It's also referred to as the apoenzyme by some scientists.

The sigma subunit, a part of RNA polymerase, is required for transcription initiation in bacteria. In bacterial cells, RNA polymerase is a complex enzyme that aids in the synthesis of RNA. In prokaryotes, the sigma subunit is present in the holoenzyme but not in the core enzyme. The sigma subunit recognizes promoter sequences on the DNA and directs the RNA polymerase complex to the beginning of the gene, allowing it to begin transcription. Therefore, the correct answer is option D. Sigma subunit is present in the holoenzyme but is not present in the core enzyme in prokaryotes.

More on enzymes: https://brainly.com/question/15150442

#SPJ11

How does microwave radiation affect the germination of radish seeds?

Answers

Microwave radiation can have both positive and negative effects on the germination of radish seeds, depending on the intensity and duration of exposure.

Positive effects:

Microwave radiation has been shown to increase the germination rate and speed of radish seeds in some studies.Short-term exposure to low-intensity microwave radiation may stimulate the enzymes and metabolic activity in the seeds, leading to faster and more uniform germination.Microwave radiation may also help to break down the seed coat and promote the uptake of water and nutrients, which can facilitate germination.

Negative effects:

Long-term or high-intensity exposure to microwave radiation can have negative effects on the germination of radish seeds.Prolonged exposure to high-intensity microwave radiation can damage the cellular structure of the seeds and inhibit germination.Excessive exposure to microwave radiation can also lead to the production of reactive oxygen species (ROS) and oxidative stress, which can cause cellular damage and impair germination.

Overall, the effect of microwave radiation on the germination of radish seeds is complex and depends on the intensity and duration of exposure. While low-intensity and short-term exposure may have positive effects, prolonged or high-intensity exposure can have negative effects and inhibit germination. Further research is needed to determine the optimal conditions for using microwave radiation to enhance the germination of radish seeds.

Learn more about radish seeds:

https://brainly.com/question/7131226

#SPJ11

which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover

Answers

Crossover is the process based on DNA recombination.

The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.

Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.

Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.

Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.

Learn more about DNA: https://brainly.com/question/16099437

#SPJ11

telophase and cytokinesis is a step of mitosis. what key event happens during telophase and cytokinesis?

Answers

Telophase and cytokinesis are both steps in mitosis. The key events that happen during telophase and cytokinesis are formation of the nuclear envelope, formation of the contractile ring, division of the cytoplasm

The nuclear envelope starts to reform around each set of chromosomes, it does this by gathering membrane vesicles from the Golgi apparatus and other membranes within the cell. Formation of the contractile ring, this occurs only in animal cells, and is the beginning of the cytokinesis process. The contractile ring is made of actin and myosin, two proteins that contract like muscle tissue to "pinch" the cell membrane and divide the cell in two.

Division of the cytoplasm, once the nuclear envelope is fully formed and the contractile ring is in place, the cell begins to divide into two daughter cells. This is accomplished by the contraction of the contractile ring, which pulls the cell membrane inward to create a small "cleavage furrow."  The cleavage furrow deepens and ultimately divides the cell in two. The end result of telophase and cytokinesis is the creation of two identical daughter cells, each with a full complement of genetic material from the parent cell.

Learn more about  cytokinesis at:

https://brainly.com/question/29765124

#SPJ11

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True or False?

Answers

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True

A component with a lower flavor threshold means that it can be detected at lower concentrations, and therefore, can make a bigger contribution to the overall flavor profile of the beer.

For example, compounds like isoamyl acetate, which gives banana-like flavor, and diacetyl, which gives a buttery flavor, have low flavor thresholds and can be perceived even at low concentrations. Therefore, a small amount of these compounds can have a noticeable impact on the taste and aroma of the beer.

Learn more about lower flavor

https://brainly.com/question/17515899

#SPJ4

16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?

Answers

Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.

What causes Blue Andalusian birds to exist?

The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.

What kind of hens are Blue Andalusian?

According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.

To know more about heterozygous visit:

https://brainly.com/question/30622664

#SPJ1

the term for a specific molecule on which an enzyme acts is the

Answers

The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.

Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction.  The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.

Learn more about substrate: https://brainly.com/question/4047091

#SPJ11

which atomic particles are in a unique cloud outside of the nucleus of the atom?

Answers

The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.

The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.

Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.

To know more about electrons click here:

https://brainly.com/question/1255220

#SPJ4

Other Questions
What are contaminants Compare and contrast the difficulties sole custody and joint custody can pose for teens whose parents are divorced. contemporary sociologists would term whites in the united states with northern european ancestry (often referred to as european americans, white anglo-saxon protestants, or wasps) as the A ballet class has 40 dancers. If I collect all of the dancer's heights, is it a census or sample? In Art Spelgelman's series of graphic novels about the Holocaust, men are either mice or cats. Is this approachrepresenting characters effective? Is it more effective, for instance, than using humans as the characters in Maus? during which phase of the moon do we see the entire lighted side of the moon? responses new moon new moon waning gibbous waning gibbous full moon full moon first quarter Compare/contrast theoretical perspectives on sex/sexuality and race/ethnicity. The vertices of ABC are A(2,5), B(2,4), and C(5,2). If ABC is reflected across the line y=2 to produce the image A'B'C', find the coordinates of the vertex A'. what literary element is: Matt was swept by both fear and joy A historian is interested in studying the role of women during the IndustrialRevolution. He finds a recently published secondary source that includes thisinformation:The Wealthlest Women During the 19th-Century IndustrialRevolution: Were able to hire servants to do the majority ofhousework. Often worked for charities or became activists Pushed for social reforms such as women's rights andthe right to voteWhich piece of information would most help him understand the historicalcontext of these facts? HELP PLEASE! the question in the photo below The kinetic energy distributions of particles of a gas at 20 C and at 60 C is shown below.Which one of the statements relating to these distributions is correct?(a) At 20 C the average kinetic energy of the particles is higher than at 60 C.(b) At 20 C there are no particles with a high kinetic energy. (c) At 60 C there are no particles with a low kinetic energy. (d) At 60 C there are more particles with higher kinetic energy than at 20 C. a nurse is providing education to a client experiencing postpartum blues. the nurse determines client understanding when the client makes which of statements regarding factors that contribute to postpartum blues, signs and symptoms associated with postpartum blues, and collaborative care to treat symptoms? X =someone HELP!!!! 4) in terms of a bad smell, why is it better to stay in its presence than to leave and return several times? group of answer choices olfactory receptors are rapidly adapting. olfactory receptors are tonic. slowly adapting receptors take longer to come online. with time, labeled lines change their modality. the decrease in graded potentials increases the frequency of their action potentials. Please answer now:Analyse the functions of the price mechanism true or false? square root functions are either always increasing or always decreasing for the whole domain of at the concentration of 20 wt% ag - 80 wt% cu, lf i cool the material down from 1100 c, what is the composition of the first solid phase that forms?\ your college is considering investing $6 million to add 10,000 seats to its football stadium. the athletic department forecasts it can sell all these extra seats at each game for a ticket price of $20 per seat, and the team plays six home games per year. if the school can borrow at an interest rate of 14 percent, should the school undertake this project? what would happen if the school expected a losing season and could sell tickets for only half of the 10,000 seats? How are stripes in tigers a beneficial adaptation? Explain how tiger stripes could have evolved through gradualism.