What is the difference between -4 and 6? negative 10, negative 2, 2, or 10​

Answers

Answer 1

Answer:

-4-6=-10

Step-by-step explanation:

Hope this helps! If you have any questions comment below (^-^)


Related Questions

Write the equation of the line when m = 4 and the point (3, 15) lies on the line.

Answers

Answer:

y=4x+3

Step-by-step explanation:

y=mx+b

15=4(3)+b

15=12+b

-12 -12

3=b

y=4x+3

1. What is the value of x in this equation? 5x – 2(2x - 1) = 6 *
A.3
B.4
C.7
D.8

Answers

Answer:

Answer B. 4

Step-by-step explanation:

Equations

Solve the equation:

5x - 2( 2x - 1 ) = 6

Operate the parentheses:

5x - 4x + 2 = 6

Collect like terms:

x + 2 = 6

Subtract 2:

x = 6 - 2

x = 4

The value of x is 4

Answer B. 4

Need answer ASAP will give brainliest check out the picture

Answers

Answer:

i think... x=6

Step-by-step explanation:

3x+9=x+21

3x−x=12

2x=12

x=6

Which equation is not true?

Answers

Answer:

the answer is B

What is the volume of the square pyramid? Round to the nearest hundredth, if needed.
5 in.
9 in.
9 in
0405 in 3
135 in. 3
675 in 3
75 in. 3

Answers

Umm I think 0405 in 3?????

Answer:

The answer is 135 in 3.

Step-by-step explanation:

To find the volume of a square pyramid, first you need to find the base and height. In this case,

a = 9

h = 5

Now we use the formula (1/3 a^2 h) To find the volume.

I will use )( To show numbers being multiplied, example: 3)(4 = 12

=1/3)(9 cm^2)(5 cm

=1/3)(81 cm)( 5 cm

= 135 in. 3

Which function has a graph with a y-intercept of -4?
A. 2x – 4y = 8
B. 2x – 8y = -4
C. 4x – 2y = -8
D. 4x - 2y = 8

Answers

the correct answer would be D. if you rearrange the equation, and cross out common factors, it equals -4

Answer:

D

slope is 2 and y-intercept is (0, -4)

Step-by-step explanation:

4x-2y= 8  move variable x to the right (change signs)

- 2y= -8 + 4x   Divide both sides by 2

y= -4 + 2x        reorder terms using communitive property

y = 2x  -4

y= mx + b

8x + 7y = 2
8x + 3y = 10

Answers

Answer:

what do you want from this question?

Step-by-step explanation:

giving extra points pls help

Answers

Answer:

x = 8mi

Step-by-step explanation:

Use Pythagorean theorem! It states that you can find any side of the triangle using the equation  +  =  . The sides a and b are the sides that are shortest, and c is the longest/slanted side (hypotenuse). So plug in what they give you to get  +  =  ( a and b can be used for either number that is not the hypotenuse). A little bit of basic algebra will lead you to get x=8 mi.

Need help ASAP! If IN=2x+10 and AT=26, find x.

A.) 12
B.) 10
C.) 6
D.) 8

Answers

Answer:

X=8

The three lines means that IN and AT are equal so IN must equal 26. 2(8)=16 and 16+10=26

What is the slope and y-intercept of 8x – 2y = -16?

Answers

Answer:

4x+8=y

Step-by-step explanation: This is because you take everything and isolate the y you take the 8x and subtract it from the other side then after that you divide everything by -2 to get your answer

A jar contains 12 caramels, 8 mints and 7 dark chocolates. What is the probability of selecting a mint? simplify if possible.

ME PUEDEN AYUDAR ES PARA HOY

Answers

Answer:

8/27

Step-by-step explanation:

Will give brainliest if correct.

Answers

Answer:

The equation is y = 3x + 15.

The second equation is y = 3 * 50 + 15

If you have a value of 50 berries picked, you would make 165 dollars.

Now first tell me whts 9.6- 26.8
but I already kno!

Answers

Free variably points -17.2

A store sells rope by the meter. The equation p = .8 L represents the price: p (in dollars) of a piece of nylon rope that is L meters long.

How long is a piece of nylon rope that is $2.80?

Answers

Answer:

3.5 meters

Step-by-step explanation:

Equation: p = 0.8L

Given: p = 2.80

To find the length of a piece of nylon rope that costs $2.80, input the given value of p(2.80) into the equation and solve for L:

p = 0.8L

2.8 = 0.8L

Divide both sides by .8 to isolate L:

[tex]\frac{2.8}{0.8} =\frac{0.8L}{0.8}[/tex]

3.5 = L

The length of a piece of nylon rope that costs $2.80 is 3.5 meters long.

what is the cube root of -27​

Answers

Answer:

-3

Step-by-step explanation:

[tex]\sqrt[3]{-27}[/tex] is -3 and can be proven by doing [tex]-3^{3}[/tex] as -3 x -3 x -3 of itself will give you -27, as [tex]\sqrt[3]{-27}[/tex] is just -27/-3/-3

Help me solve this problem please

Answers

Answer:

-2

Step-by-step explanation:

Answer:

-2

Step-by-step explanation:

I dont have an explanation, sorry

Please help !!! I don't understand

Answers

Answer:

P=160+6x

Q=x+40

H=4x-5

P+Q+H=180...P=61.82

A circuit overloads at 1800 watts of electricity you plug in a toaster that uses 800 watts of electricity write and solve an inequality that represents how many watts you can add to the circuit without overloading it.

Answers

Answer:

x ≤ 1000 W

Step-by-step explanation:

Since the circuit becomes overloaded when the load exceeds 1800W and the toaster uses 800 W.

Let the additional watts be x

Therefore;

800 + x ≤ 1800

x ≤ 1800 -800

x ≤ 1000 W

4. A student buys a movie to watch on her phone, but she's worried about the
amount of storage space downloading it will take up. She starts the download and
notices it will download at a constant rate. After 3 minutes, she checks her phone
and sees that she has 2,345 MB of space available. She checks her phone after 7
minutes and notices that she now has 2,105 MB of space available.
(a) How many MB of available storage are being filled by the movie per minute?

Answers

Answer:

240

Step-by-step explanation:

by minusing the both values it'll be 240

The rate at which the storage space of the mobile gets filled by the movie is - 60 MB per minute.

Given that,
A student buys a movie to watch on her phone
it will download at a constant rate.
After 3 minutes, she checks her phone and sees that she has 2,345 MB of space available.
She checks her phone after 7 minutes and notices that she now has 2,105 MB of space available.

What is the rate of change?

The rate of change is defined as the change in value with the rest of the time is called rate of change.

Here,


Rate = (storage available after 3 minutes) - (storage available after 7 min)]
             ---------------------------------------------------------------------------------------------
                                              Time interval

Rate = (2,345 - 2105 ) / (3 - 7)
Rate = - 240 / - 4
Rate = - 60

Where negative sign shows that the amount of storage getting reduced.

Thus, the rate at which the storage space of the mobile gets filled by the movie is - 60 MB per minute.

Learn more about the rate of change here: https://brainly.com/question/13103052

#SPJ2

Sierra plays a hockey video game. She earns 5 stars for
every goal she scores and loses star every time she
misses the goal. She scores 4 goals and misses

Answers

I cant give you the answer because you didn’t finish your question, however I can tell you she has at most 20 starts. 4 goals = 20 stars. Subtract the number of goals she missed and you will have your answer for the total number of goals.

Answer:

the answer is 16

Step-by-step explanation:

Nana plants 3 red roses bushes for every 4 yellow rose bushes in her garden. If she plants 12 red rose bushes, how many yellow will she plant? Number only

Answers

Answer:

16

Step-by-step explanation:

Given that:

For every 3 red roses bushes for every 4 yellow bushes are planted by Nana in her garden.

Let us first have a look at the ratio of red roses bushes and yellow bushes.

Number of red roses bushes : Number of yellow bushes = 3 : 4

Now, we are given that there are 12 red rose bushes planted.

To find: How many yellow rose bushes Nana will plant?

Solution:

Let us use unitary method for finding the required answer.

Number of yellow rose bushes for every 3 red roses = 4

Number of yellow rose bushes for every 1 red rose = [tex]\frac{4}{3}[/tex]

Number of yellow rose bushes for every 12 red rose = [tex]\frac{4}{3}\times 12 = 4\times 4 = \bold{16}[/tex]

Therefore, the answer is 16.

Triangle has side lengths 2, 3, and 4.
Triangle has side lengths 4, 5, and 6.
Is Triangle similar to Triangle?

Answers

Answer:

I think no

Step-by-step explanation:

I would say no because they would all have to be the same. 2/4= 1/2 so all the side lengths would have to divide into one half, and they don't

Roxanne has already jarred 10 liters of jam and will jar an additional 3 liters of jam every
day. How many days does Roxanne need to spend making jam if she wants to jar 16 liters
of jam in all?
Explain please and how to do the equation

Answers

Answer:

3

My logic:

so she jars 10 on the first day (that is 1 day) and she wants to jar 16. so if you subtract 10 from 16 you get 6. Now we know she wants to jar 6 more, and if she does 3 every day then you would divide 6 by 3 and get 2. 2+1 is 3, so 3 days. (if you cant chose 3 chose 2 because your teacher might not want yo to count the first day)

Hope this helped!

At a football game, 69 out of 92 students were wearing the color red to support the home team. What percent of the students were wearing red?

A.
69%
B.
88%
C.
65%
D.
75%

Answers

Answer c

Step-by-step explanation:

Answer:

D. 75%

Step-by-step explanation:

Divide 69 by 92 and you will get 0.75, move the decimal to the right two times. and there is your answer.

A public parking garage charges $5, plus an additional $2 per hour.
Choose the graph of the line.

Answers

Answer:

2nd one

Step-by-step explanation:

Graph-2 is correct line that represents the parking charge of the public garage.

What is a linear equation?

A linear equation is an equation where the variable has the highest degree of 1.

Given, a public parking garage charges $5, plus an additional $2 per hour.

For 1 hour, the total cost will be = $(5 + 2 × 1) = $7.

For 2 hours, the total cost will be = $(5 + 2 × 2) = $9.

For 3 hours, the total cost will be = $(5 + 2 × 3) = $11.

For 4 hours, the total cost will be = $(5 + 2 × 4) = $13.

For 5 hours, the total cost will be = $(5 + 2 × 5) = $15.

Here, the increase in parking cost is in the form of linear equation and it increases $2 with the increase in every hour.

Therefore, graph-2 represents the actual line of cost of the parking charge and time.

Learn more about linear equation here: https://brainly.com/question/2263981

#SPJ2

1. Billy's mother started a college fund on Billy's 8th birthday. She
deposited $8,200 into a savings account that yields an interest rate of
0.21% compounded annually. How much money will the savings account
be worth when Billy turns 18 years old?

Answers

when billy turns 18 he will have $3,099.6 in his account because .021 percent x $8,200= $172.20 per year x 18 years = $3,099.60

A firefighter is standing 33 feet away from a 45 foot tall building. The firefighter looks up and sees that a cat that is stuck on the top of the building and also notices a dog in a second flooor window that is 15 feet above ground. What is the angle of elevation of the cat?

Answers

Given :

Distance of firefighter from the building, D = 33 feet.

Height of building, h = 45 feet.

To Find :

The angle of elevation of the cat.

Solution :

Let, angle of elevation is Ф.

We know, tan Ф = h/D

tan Ф = 45/33

Ф = tan⁻¹( 45/33 )

Ф = 53.75°

Therefore, angle of elevation is 53.75° .

Hence, this is the required solution.

Harriet needs to ship a small vase. The box she will use has a volume of 216 cubic inches. If the side lengths are all the same, what is the length of each side of the box?​

Answers

Answer:

1080

Step-by-step explanation:

if you answer this right I will give you Brainliest
What is 2+2

Answers

Answer:

fish

Step-by-step explanation:

Answer:

2

Step-by-step explanation:

The first four terms of a sequence are shown below:

9,5, 1, -3

Which of the following functions best defines this sequence?


Answers

Answer:

-4

Step-by-step explanation:

Other Questions
3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time? The Yellow River is often called the cradle of Chinese civilization. It was along the banks of the Yellow River where the Chinese civilization first formed. The Yellow River is 3,395 miles long, making it the sixth longest river in the world. It is also called the Huang He River.Early Chinese farmers built small villages along the Yellow River. The rich yellow-colored soil was good for growing a grain called millet. The farmers of this area also raised sheep and cattle. Ancient China: Geography,Ken NelsonUsing context clues, which statement best defines the phrase "cradle of Chinese civilization?the place where the longest river in China startsthe place where most people in ancient China livedthe place where people in China began a farming culturethe only place in ancient China where people could farm What is an accurate statement about many of the first Africans to come to Louisiana?They came voluntarily.They were skilled laborers. They came in search of domestic work. They knew how to grow crops. Carter was given a box of assorted chocolates for his birthday. Each night, Carter treated himself to some chocolates. Carter ate 5 chocolates each night and there were originally 30 chocolates in the box. Write an equation for C,C, in terms of t,t, representing the number of chocolates remaining in the box tt days after Carter's birthday. When a space shuttle was launched, the astronauts on board experienced an acceleration of 29.0 m/s2. If one of the astronauts had a mass of 60.0 kg, what net force in Newtons did the astronaut experience? Which equation below has no solution?A) 3(6x + 8) = 24 + 18xB) 8(x + 4) = 12x - 6C) 5x - 4 = 2(4x + 8) - 3x can somebody do 4 and 5 for me iliketurtles2000 hi iananswer this question anyone pleaseFind: 113 23The quotient is 5 and .