Taylor had a bag of 28 marbles. 5 red, 9 blue, 8 yellow, and 6 black. If Taylor pulled out a yellow one and DID NOT put it back in. What is the probability of pulling out a blue marble (SIMPLIFY YOUR FRACTION). /

Answers

Answer 1

Answer:

The probability of pulling out a blue marble is 33.3%.

Step-by-step explanation:

Given that Taylor had a bag of 28 marbles, which were 5 red, 9 blue, 8 yellow, and 6 black, if Taylor pulled out a yellow one and did not put it back in, to determine what is the probability of pulling out to blue marble the following calculation must be carried out:

28 - 1 = 27

9/27 = X

0.333 = X

0.333 = 33.3%

Therefore, the probability of pulling out a blue marble is 33.3%.


Related Questions

How do you write 20% as a decimal?

Answers

Answer:

the answer is 0.20 for 20%

Answer:

[tex] \bf \huge0.2[/tex]

Step-by-step explanation:

Given that :

How do you write 20% as a decimal?

to find :

write in decimal form

explanation :

finding the decimal form of 20%

⟼ decimal form = 20%

⟼ decimal form = 20/100

⟼ decimal form = 2/10

⟼ decimal form = 0•2

the decimal form of 20% is 0•2 .

How is the graph of the parent function y= hurrrr!!!x2 transformed to produce the graph of y= 3(x+1)2? It is translated 1 unit right and compressed vertically by a factor of 3. © It is translated 1 unit left and compressed vertically by a factor of 3. Olt is translated 1 unit right and stretched vertically by a factor of 3. It is translated 1 unit left and stretched vertically by a factor of 3.​

Answers

Answer:

3.

Step-by-step explanation:

The graph is being moved to the left and then stretched by a factor of three. If it were to be compressed than the 3 would be 1/3.

The graph of the parent function is translated to 1 unit left and compressed vertically by a factor of 3.

Option B is the correct answer.

What is translation?

It is the movement of the shape in left, right, up, and down direction.

The translated shape will have the same shape and shape.

There is a positive value when translated to the right and up.

There is a negative value when translated to the left and down.

We have,

The graph of the parent function y = x² can be transformed to produce the graph of y = 3(x + 1)² by translating it 1 unit to the left and stretching it vertically by a factor of 3.

Here's why:

The (x + 1) part inside the square means that the graph is shifted 1 unit to the left.

The exponent of 2 means that the graph is squared, just like the parent function.

The coefficient of 3 in front of the square means that the graph is stretched vertically by a factor of 3.

Therefore,

It is translated 1 unit left and compressed vertically by a factor of 3.

Learn more about translation here:

https://brainly.com/question/12463306

#SPJ7

Help me on this question please!

Answers

31.2 or G

Step By Step Explanation:

What is the mean for the data shown in the dot plot? 4 5 6 10

Answers

Answer:

Mean = 6.25

Step-by-step explanation:

Data values: 4, 5, 6, 10

Mean = (Sum of all values)/(Number of values)

Mean = (4 + 5 + 6 + 10)/4

Mean = 25/4

Mean = 6.25

The mean for the data shown in the dot plot is 6.25.

The given data is 4, 5, 6 and 10.

We need to find the mean for the data shown in the dot plot.

What is the dot plot?

A dot plot is used to encode data in a dot or small circle. The dot plot is shown on a number line that displays the distribution of numerical variables where a value is defined by each dot.

Now, mean = Sum of all the observations / Total number of observations

=(4+5+6+10)/4

=25/4

=6.25

Therefore, the mean for the data shown in the dot plot is 6.25.

To learn more about the dot plot visit:

https://brainly.com/question/22746300.

#SPJ2

I got stumped on another one!

Answers

The answe is the first one

H⁣⁣⁣⁣ere's l⁣⁣⁣ink t⁣⁣⁣o t⁣⁣⁣he a⁣⁣⁣nswer:

bit.[tex]^{}[/tex]ly/3a8Nt8n

What is the solution to the equation StartFraction 1 Over h minus 5 EndFraction + StartFraction 2 Over h + 5 EndFraction = StartFraction 16 Over h squared minus 25 EndFraction?

Answers

Answer:Hi i think its 50 x 16= ur answer think about that hopes this helpp!!! :D

Step-by-step explanation:

Answer:

the answer is h=7

Step-by-step explanation:

Which conic section is shown in the image?

A.
circle
B.
ellipse
C.
parabola
D.
hyperbola

Answers

Answer:

D. Hyperbola

Step-by-step explanation:

symmetrical open curve formed by the intersection of a circular cone with a plane at a smaller angle with its axis than the side of the cone.

The conic section in the given figure is Hyperbola. Therefore, option D is the correct answer.

In the given figure conic section is given.

What is conic section?

A figure formed by the intersection of a plane and a circular cone. Depending on the angle of the plane with respect to the cone, a conic section may be a circle, an ellipse, a parabola, or a hyperbola.

The given figure  an open curve with two branches, the intersection of a plane with both halves of a double cone. The plane does not have to be parallel to the axis of the cone; the hyperbola will be symmetrical in any case.

The conic section in the given figure is Hyperbola. Therefore, option D is the correct answer.

To learn more about conic section visit:

brainly.com/question/8179077

#SPJ2

Write an equivalent expression for 6( 4 + 2m) ?

Answers

Answer:

QUESTION:

Write an equivalent expression for 6( 4 + 2m) ?

ANSWER:

6(4+2m) = ?

6 X 4 = 24

6 X 2m = 12m

Final answer:

12m + 24

Step-by-step explanation:

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.

Which equation matches the table?

Answers

Answer:

Wait that makes no since but i would say 4 input and 28 input

Step-by-step explanation:

A man purchased a used car for $5000 He decided to sell the car for 20% above his purchase price. He could not sell the car so he reduced his asking price by 20% of
he sells the car at the reduced price will he have a profit or a loss or will he break even?
Select the correct choice below and fill in any answer box to complete your answer
A. The man will have a profit of __
B. The man will break even
C. The man will have a loss of 5__

Answers

C po
#CarryOnLearning

what is the diameter of a circle with a circumference of 27 centimeters?

Answers

Answer:

diameter = 8.6 cm

Step-by-step explanation:

diameter = 27/π = 8.6 cm

(It's Free!!!!)
Enjoy!

The dot plots show 20 scores on two different tests.
What is the difference of the ranges?

A) 20
B) 35
C) 5
D) 10

Answers

Answer:

A) 20

Step-by-step explanation:

Test 1:

90-50 = 40

Test 2:

100-40 = 60

Difference:

60-40 = 20

A sports store received a shipment of 150 footballs and basketballs. 20% were basketballs. How many footballs were in the shipment?

Answers

0.20(150) = 30 basketballs were in the shipment. Since the shipment presumably comprised only footballs and basketballs, the remainder of the shipment must consist of footballs.

150 - 30 = 120 footballs were in the shipment.

Consider a population of people who suffer occasionally from migraine headache. Suppose 62% of those people get some relief from taking ibuprofen (true proportion). To investigate the effectiveness of ibuprofen, a random sample of 100 people is obtained at random from this population. A. (4 pts.) Determine the sampling distribution of sample proportion. Also, find the mean and standard deviation of the sampling distribution.

Answers

Answer:

The sampling distribution of sample proportion is approximately normal, with mean 0.62 and standard deviation 0.0485.

Step-by-step explanation:

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

For a proportion p in a sample of size n, the sampling distribution of the sample proportion will be approximately normal with mean [tex]\mu = p[/tex] and standard deviation [tex]s = \sqrt{\frac{p(1-p)}{n}}[/tex]

62% of those people get some relief from taking ibuprofen (true proportion).

This means that [tex]p = 0.62[/tex]

Sample of 100

This means that [tex]n = 100[/tex]

A. (4 pts.) Determine the sampling distribution of sample proportion. Also, find the mean and standard deviation of the sampling distribution.

By the Central Limit Theorem, it is approximately normal with

Mean [tex]\mu = p = 0.62[/tex]

Standard deviation [tex]s = \sqrt{\frac{p(1-p)}{n}} = \sqrt{\frac{0.62*0.38}{100}} = 0.0485[/tex]

I need help plz it is just the help with the one that say write each one as a decimal

Answers

Answer:

1) 0.4552) 0.1253) 2.333

Step-by-step explanation:

The explain in the photos above

I hope that is useful for you :)

what is the mode for the following numbers 67 76 67 76 67 23 32 23 32​

Answers

67 is the mode because it appears the most.

Answer:

67.

Step-by-step explanation:

67 appeared three times while everything else appeared only twice.

A cook makes vegetable barley soup by mixing 2 pounds of barley into 7 quarts of vegetable broth. Assume that the cook continues to use the same rate to make more batches of soup. How many pounds of barley should the cook mix with 35 quarts of broth?

Answers

Answer: The answer to this question is 10 :D

Step-by-step explanation:

The answer is 10 pounds.

2 pounds            7 quarts

4                                14

6                                 21

8                                 28

10                                35

In the diagram below what is the measure of X round to the nearest whole number if necessary round your answer to the nearest 10th of a unit

Answers

Answer:

C. 12

Step-by-step explanation:

Find x by applying the leg rule.

The leg rule is given as:

Hypotenuse/leg = leg/part

Hypotenuse = 24

Leg = 17

Part = x

Plug in the value into the equation:

24/17 = 17/x

Cross multiply

24*x = 17*17

24x = 289

x = 289/24

x = 12.0416667 ≈ 12 (nearest tenth)

help! the measure of XY = 140 find the measure of angle 0

Answers

Answer:

it's 140 ÷ 2 = 70

bcz the XY is a Inscribed angle

In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.

Which recursive rule can be used to find the nth term of the sequence, an?

a1=3; an=an−1+2
a1=−3; an=2an−1
a1=3; an=2an−1
a1=−3; an=an−1+2

Answers

Answer:

a1=−3; an=an−1+2

Step-by-step explanation:

I just took the quiz and this was what was correct

Plss help me ASAP pls ASAP thank you

Answers

I think 7 is B and 8 is A, but im not really sure about this so im sorry if this is wrong

You notice that the client's bedroom is also proportional to a larger office that you have already completed. The diagram below shows the bedroom (left) and completed office (right). Use this diagram for Questions 3-6.

It cost $120 to buy the materials for crown molding in the completed office. (Crown molding is the decorative border where the walls meet the ceiling. It will go all the way around all four walls.) Using the same materials, how much will it cost to buy all of the crown molding for the bedroom? Round up to the nearest whole dollar.

Answers

Answer:

D. 75

Step-by-step explanation:

The cost to buy all of the crown molding for the bedroom would be $75.

What is a proportion?

A proportion is a fraction of a total amount, and the measures are related using a rule of three.

The relations between variables, either direct or inverse proportional, can be built to find the desired measures in the problem.

We are given that bedroom and office in the diagrams below are similar rectangles and the walls on the left sides in the diagram are proportional, and the walls on the top sides in the diagram are proportional.

Since it will cost $120 to buy the materials for crown molding in the completed office. Thus Crown molding is the decorative border where , the walls meet the ceiling. It will go all the way around all four walls.

Hence, cost to buy all of the crown molding for the bedroom = $75.

More can be learned about proportions at;

brainly.com/question/24372153

#SPJ3

What is the least common denominator of 1/6 and 5/12

Answers

Answer:

The least common denominator is 12.

Step-by-step explanation:

1/6 and 5/12.

Skip count by 6and 12.

6: 6,12,18,24,30.....

12: 12,24, 36,48...

12, appeared first, so 12 is the least common denominator.

hope it helps.

Please help, test due in 2 hours! Will give good review and brainliest. :)

Answers

Please mark me brainliest!!!!

It would be 86.283616915 but rounded, would be 86.

Hope this helps!

****For density you would divide mass by volume

I need help with this

Answers

Answer:

sience -2 is to the left of 2

_

. 3

PLEASE HELP WILL GIVE BRAINLIEST

Answers

Answer:

12.5%

Step-by-step explanation:

r = (1/4)((1500/1000) - 1) = 0.125

r = 0.125 = 12.5%

D or 12.5%
Explanation: r= (1/4) ((1500/1000)-1) =0.125
r= 0.125 = 12.5%

Sara has 3 choices to get to school: walk, ride a bike, or ride the bus.
She has the same choices to get home after school. If Sara randomly
chooses how she is getting to school and home, what is the probability
that she will walk to school and then ride the bus home?

Answers

Answer:

I think the answer is 1/9

Step-by-step explanation:

I did the equations by using a tree diagram to explain it but

I have ¾ of an hour to finish 6 homework assignments. How much time can I spend on each assignment?

Answers

Answer:

 7.5 min for each assignment

Step-by-step explanation:

1 hour is 60 minutes, and there are four 15 minute intervals. So, if there are four intervals of 15 minutes that add up to 60, just take three of them and put them over four:

15 ⋅ 15⋅ 15/ 15⋅ 15 ⋅ 15 ⋅ 15= 45 /60

Or we could multiply one hour, or 60 minutes, by  3 /4 .

    60 ⋅ 3/ 4 = 60 /1 ⋅ 3 /4 = 60 ⋅ 3/ 4 ⋅ 1 = 180 /4 =45

Three fourths of an hour is 45 minutes.

to find  time for each assignment =45/6

          7.5 min

=
O LINEAR The length of a rectangle is 6 cm longer than its width.
If the perimeter of the rectangle is 56 cm, find its length and width.
cm
Х
length: 0
width: Ich
?
cm

Answers

Answer:

I. L = 17 cm.

II. W = 11 cm.

Step-by-step explanation:

Let the length of the rectangle be L.

Let the width of the rectangle be W.

Given the following data;

Perimeter of rectangle = 56cm

Translating the word problem into an algebraic expression, we have;

L = W + 6 .....equation 1

The perimeter of a rectangle is given by the formula;

P = 2(L + W)

56 = 2(L + W) ......equation 2

Substituting eqn 1 into eqn 2, we have;

56 = 2(W + 6 + W)

56 = 2(6 + 2W)

Opening the bracket, we have;

56 = 12 + 4W

4W = 56 - 12

4W = 44

W = 44/4

W = 11 cm

Next, we would find the length of the rectangle;

From eqn 1;

L = W + 6

L = 11 + 6

L = 17 cm

1. Josh is reading a book that contains 100 pages. If he reads 1/3 of the book in 1/6 of an hour, how many pages per hour does Josh read?​

Answers

100/3=33.33.... 1/6= 10 mins 33.33....*6= 199.98

hope this helped you out!!

Other Questions
Maria says that the solutions of the inequality are y. Find, describe, and correct the error in Maria's work, shown here. if the pressure of a container is enlarged three times what will the pressure be? Write a paragraphexplaining how life in the West was different fromlife in the East. please help with this question?!? what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death. Why the allied powers pinpointed Germany at the person guilty for starting world war 1 How did the mandates after World War I create conflict in Southwest Asia? A. Jews and Arabs were given their own separate mandates. B. Mandates were forced to adopt French or English as an official language. C. Mandates were required to adopt democratic forms of government. D. The borders of mandates often ignored ethnic and religious divisions. I have of an hour to finish 6 homework assignments. How much time can I spend on each assignment? Mention the ways of safe abortion(like what should the woman do??)need help fast what is a flowchart and write it's work Maria counted the number of candies in ten different boxes. the number of candies are 57 38,45,49,52,56,41,50,61, and 60. What is the mean absolute deviation of the number of candies. Today is your birthday, and you decide to start saving for your college education. You will begin college on your 18th birthday and will need $4,000 per year at the end of each of the following 4 years. You will make a deposit 1 year from today in an account paying 12 percent annually and continue to make an identical deposit each year up to and including the year you begin college. If a deposit amount of $2,542.05 will allow you to reach your goal, what birthday are you celebrating today Zinc metal reacts with aqueous copper(II) chloride, as shown in this equation. If 3.03 x 1021 atoms of zinc react, how many grams of Cu will form? Show the sequence of conversions necessary, then calculate the numerical answer. Zn (s) + CuCl2 (aq) ---> ZnCl2 (aq) + Cu (s)