Shondra takes notes in class.

I. Electromagnetic Waves
II. The ability to work
- Has many forms
- Mechanical
III. Potential energy
- Chemical
- Elastic
- Gravitational
Kinetic energy
- Energy of movement
- Electrical
IV. Nuclear
- Radiant
- Thermal

One line of Shondra’s notes is irrelevant to the rest of her notes. Which line is about a different topic than the rest of Shondra’s notes?

I
II
III
IV

Answers

Answer 1

Answer

A. I

Explanation:

got it right on the quiz. edge2021

Answer 2

Answer:

a

Explanation:

edg2o2o


Related Questions

what does Mrs. Baker help Holling with that requires him to go outside?

Answers

Is there a reading that goes with this?

What was the relationship beetween Jim Crow Laws/ Jim Crow Era and the Great Migration

Answers

Answer:

Jim Crow era is the main causes for the Great Migration.

Explanation:

During the Jim Crow era, the Southern states introduced a Racial segregation. This segregation separated the infrastructure that exist in the states. The better infrastructures tend to be allowed for white citizens only while the worse infrastructures were given for the Black citizens.

This resulted in a lot of suffering and missed opportunities for the Black citizens.

As a result, a large portion of black citizens decided to migrate to northern states. They heard that the north had a lot more job opportunities for them and the treatment that they'll have there wouldn't be as bad as they receive in the South. This period of mass migration is what we usually refer to as the Great migration.

Which of the following is an example of human systems in the Amazon?

A Boating on the Amazon River
B Speaking Portuguese
C The Amazon's exact location
D A waterfall on the Amazon River

Answers

Aaaaaaa
Aaaaaaa
Aaaaaaa
Aaaaaa
Aaaaaaa
Aaaaaa

questions below a
1. What messages do these ads give to the middle adolescents like you?​

Answers

There is no other information to conclude this question. Is there any other questions or writing that goes with this?

a) Explain the difference between Monkish concept and moderate path with examples. (word limit: 300 words, 3 marks)

Answers

Answer:

The difference between Monkish concept and moderate path with examples is discussed below in details.

Explanation:

Comparing to, or resembling a monk or monks.

Example -

There are hidden doors, magic charms, and the common sight of rich old fools in monks robes carrying quasi-religious ceremonies in the pursuit of unimagined strength and some decadent sense of purity.

MODERATE PATH

Development in Islam is one of the central terms and intentionally used material in Islam. In the knowledge of Islamic law, it is a fundamental component of Islamic doctrine and It has been used from the very origin of Islam. it refers to a nice stable form of life, avoiding utmost and experiencing things in moderation

The Hebrew people moved to Egypt after a drought and famine in Canaan.
True
False

Answers

This is True because they moved due to a huge lack of food and they also where looking for new place to grow there food.

Answer:

False.

Explanation:

This is my answer because why would they move back to Egypt when they were slaves before.

Why did women support the temperance movement? Check all that apply. It would give women the right to vote in elections. It would enable women to get jobs with equal pay. It would decrease the alcohol consumed by women. It would decrease domestic violence against women. It would encourage men to spend more time with their children.
PLS ANWSER ASAP PLEASE!!!THANK YOU​

Answers

Answer: Why did women support the temperance movement? Check all that apply.  

It would decrease domestic violence against women.

It would encourage men to spend more time with their children.

Explanation: took test

The women supported the temperance movement because It would decrease domestic violence against women, and would encourage men to spend more time with their children. Thus, option 4th and 5th are correct.

What was the temperance movement?

The temperance movement is a social movement that advocates for temperance or total abstention from alcoholic beverages. Participants in the movement often criticize or advocate teetotalism, and its proponents highlight the detrimental consequences of alcohol on people's health, personality, and family lives.

Women were more interested in temperance than in any other movement in US history at the time. Women's participation appeared natural, given that the movement focused on men's alcohol drinking and how it hurt women and children. Hence,  option 4th and 5th are correct.

Learn more about the temperance movement here:

https://brainly.com/question/3322614

#SPJ2

What movement do the statements describe?





The Protestant Reformation


The Renaissance


The Middle Ages


Scientific Revolution

Answers

Answer:

Explanation:

The Murder of Emmit till

15. Regarding the chief executive, the writers of the Constitution
a. were all in agreement about the necessity of a powerful executive for the new republic.
b. modeled the presidency of the United States after the Prime Minister of France.
c. had no models to follow when they created the presidency of the United States.
d. originally wanted a king
e created a leader with unchecked powers.

Answers

Answer:

74e3nrtfike4 mfvrodpnhtfb fdygtrjy

jyhkromhybm huopt7i

Explanation:

54jimy65ipetkp5ekjhut6

critically evaluate two ways on how social media reports on gender-based violence based on my collage​

Answers

Answer:

hiavhsuc n nkc dsh cmksdn. ljbn

Explanation:

cvh j;cn cb vch

Jo is in her early forties and is juggling the demands of taking care of her two young children and having to
assist her elderly parents with some daily tasks. She is
O a. facing the demands of the "second shift"
O b. experiencing the "sandwich generation" effect
O c. an example of a "supermom"
O d. experiencing the challenges of cohabitation

Answers

Answer:

It's b

Explanation: She is in her early 40s and taking care of the upbringing of her young children and assisting her aging parents

In the given case, Jo is experiencing the sandwich generation effect.  

• According to the 2007's American Psychological Association, the mothers in the age group of 35-54 experience more stress in comparison to any other age group, this age group is termed as the sandwich generation.  

• They feel stress as they have to equilibrate the delicate and demanding acts of caring for the developing children and their aging parents.  

• It has been found that in this age group, women feel more stress in comparison to men, and they seem to manage their stress very poorly.  

• About 40 percent of the mothers in the age between 35-54 encounter with extreme levels of stress.  

Thus, correct answer is option b, that is, experiencing the sandwich generation effect.

To know more about:

https://brainly.com/question/19122536

According to Ribeau et al. (1999), if a European American man talks with his African American coworker only about sports and music, he is engaging in:____________.

Answers

Answer:

negative stereotyping

Explanation:

Stereotype: In social psychology, the term "stereotype" is described as an over-generalized and fixed belief about a specific class or group of individuals. Therefore, when an individual is stereotyping someone then it represents that he or she has a whole range of abilities and characteristics that can be assumed about the members of that particular group have.

Negative stereotyping is referred to as an individual's characteristics or traits, that is being negatively attributed and valenced to a specific person or social group.

In the question above, the given statement represents negative stereotyping.

what is the reason why Spain sponsored the first voyage of Columbus to the west

Answers

Answer: to find a more direct trade route to Asia

Explanation:

When 2-1/2-year old Cassi plays with her dolls and stuffed animals,she makes them carry on a conversation.Cassi is engaged in
A) egocentric behavior.
B) pretend play.
C) conservatism.
D) object permanence.

Answers

Answer:

B) pretend play.

Explanation:

Pretend play may be defined as a form of a symbolic play where the young children or babies uses objects such as dolls or stuffed animals to represent some other objects or characters using their imaginations and assign them roles to inanimate people and carry conversation with them.

This is a kind of play that babies usually play with their toys and dolls.

In the context, a two and half year old child Cassi is playing with her dolls and she tries to carry a conversation with them is a form of pretend play.

Why is the Statue of Liberty a symbol for freedom in the United States?

Answers

Answer:

The Statue of Liberty is a symbol of freedom in the United States because it was a gift from France to celebrate the independence of the U.S. In other words, it means that it commemorates the freedom that the United States had to fight to obtain.

It is also a symbol for freedom because it welcomed immigrants, that escaped from wars, persecutions or misery, into a safe land where they could thrive.

Even though it does not welcome ships with hopeful immigrants anymore, it still symbolizes it.

Explanation:

The Statue of Liberty was a gift from France to the U.S to celebrate 100 years of independence from England. It was the first thing that characterized the statue as a symbol of freedom.  Later, as it is on Liberty Island, just in front of Ellis Island, where immigrants scaping persecutions and wars, were welcomed, she became a symbol of liberty for the U.S since it was the first thing that people saw when arriving.

Also, the Statue of Liberty has elements that represent freedom, thriving, and equality for all the people in the world.

What type of research method do you think you would prefer to use say, in a senior thesis as a social

science major? Why? Describe a possible research project you could do using this method, or a project

you might be interested in doing but which would actually be ill-suited to your preferred method.

Answers

A qualitative research is the most preferable to use in a senior thesis as a social major since it is detailed as well as exhaustive to satisfy the need of the research. Behavior can be best analyzed in a qualitative research since resolutions can be well understand with the type of research.

Qualitative research is a process through which non-numerical information such as language has been obtained, analyzed, and evaluated.

It could be used to understand how such a person understands his social structure subjectively as well as gives meaning.It is best used as a social major inside an advanced thesis because it is both detailed and exhaustive in order to meet the requirement for study.The behavior of qualitative study can be best analyzed, as the research type can easily comprehend resolutions.

Learn more:

brainly.com/question/24498447

On which continent is the Fertile CrescentMesopotamia?

Answers

Answer:

The Fertile Crescent, often called the "Cradle of Civilization", is the region in the Middle East which curves, like a quarter-moon shape, from the Persian Gulf, through modern-day southern Iraq, Syria, Lebanon, Jordan, Israel and northern Egypt.

Explanation

Answer:

It’s in Asia

Explanation:

Qualities that make us human beings, according to Aristotle
Select one:
a. our ability to grow
b. our ability to think and to be social
c. our ability to take in nutrition

Answers

Answer:

B.our ability to think and to be social

Answer:

i would say a, i havent found a definite answer but lots of them are leaning towards the ability to grow.

Explanation:

is loer egypt flat or upper egypt flat

Answers

Answer:

lower egypt

Explanation:

Lower Egypt is flat/ Hope this helps

Jordan develops an understanding that he has a mind that represents the world in potentially different ways than other people's minds. He uses this ability to explain his sister's preference for a movie he does not like, and to predict how his mother will react when she finds he ate all the cookies. Which term best describes Jordan's ability

Answers

This question is missing the options. I've found them online. They are the following:

Which term best describes Jordan's ability?

A. conservation

B. theory of mind

C. operational manipulation

D. none of the above

Answer:

The term that best describes Jordan's ability is:

B. theory of mind

Explanation:

Theory of mind is a term in psychology that refers to our ability of attributing mental states such as desires, emotions, beliefs, intent, and knowledge to others as well as ourselves. Having such an ability is crucial for interpersonal interactions since it supports our understanding of others' behaviors and perspectives. Theory of mind allows us to grasp, for instance, that different people have different tastes. It also allows us to predict the behavior or reactions of others.

The mind is known to be very vast. The term that best describes Jordan's ability is the theory of the mind.

Piaget was known to view the human thought as  it originates in the development of the motor capacities. The theory of mind is known to be the ability of a person to imagine what other people are thinking, to be able to predict the outcome of their behavior and intentions etc.

The act of knowing that people do not share the same thoughts and feelings as one do develops during childhood is known to be the theory of mind.

Learn more from

https://brainly.com/question/16890176

True or false after gaining their freedom economists said at their new government to give most power to the States versus the national government as they are scared of a monarch

Answers

The right answer is true

The answer is true hope this helped

Han society was bound together by the imperial bureaucracy and
O
A
harsh laws.
O B. Confucian values.
0 C. strict punishments.
O
D. a vast spy network.

Answers

I got this and it’s D

give an example of legitimate authority in our society.

Answers

Authority is defined as a person who is considered an expert in his field. A philosophy scholar who publishes books is an example of an authority.

what is diffusion and osmosis in science

Answers

Answer:

Diffusion and osmosis are both active transport processes, meaning they require energy provided by the cell to move substances across a cell's membrane. Diffusion refers to the process by which particles flow from an area where they are more concentrated to an area where they are less concentrated. Whereas, osmosis is the diffusion of water through a selectively permeable membrane. The overall effect is equalized concentration throughout the medium.

After the Great Schism occurred, what major difference separated the Eastern Orthodoxy and the Catholic faith?

Answers

Question:

After the Great Schism occurred, what major difference separated the Eastern Orthodoxy and the Catholic faith?

Explanation:

Charlemagne's crowning made the Byzantine Emperor redundant, and relations between the East and the West deteriorated until a formal split occurred in 1054. The Eastern Church became the Greek Orthodox Church by severing all ties with Rome and the Roman Catholic Church — from the pope to the Holy Roman Emperor on down.

What can we conclude about similarities and differences in short-term and long-term memory based on the way coding occurs in both?

Answers

Answer:

Explanation:

One similarity between both is that the type of encoding that occurs in a particular situation in both the Short Term Memory and the Long Term Memory depends on the task being carried out.

Another difference between both is the fact that the auditory coding is the predominant type of coding in Short Term Memory, while in that of the Long Term Memory, the semantic coding is the predominant type of coding.

Information can also be remembered in both the Short Term Memory and Long Term Memory with the aid of auditory and semantic coding. Auditory memory is mostly that of Short Term Memory, while Semantic is that of Long Term Memory.

Boundaries established by European governments that placed competing ethnic groups within the same country in Africa led to what?

Answers

Answer:

led to the outbreak of cilvil  wars

Explanation:

Hope this helps  :)

Boundaries established by European governments that placed competing ethnic groups within the same country in Africa led to the outbreak of civil war.    

European powers started colonizing for social, economic, and political factors. The resources and wealth in Africa led many civilians to fight in many countries.The outbreak of civil war caused as resources divided and created chaos in countries.

Learn more about Africa civil wars here:

brainly.com/question/3784455

What
are the
sources of national identity in the
context of Nepal​

Answers

Explanation:

In this context the muluki ain of 1854 stratified the Nepalese society according to a Hindu caste system, which was a little bit different from that ...

which of the following was NOT part of schooling in the colonies?

Answers

Answer:

Sorry im not sure of ur question

Explanation:

Nonverbal communication often happens without our control and knowledge; when this betrays our internal feelings, it is called ______.
a. adage
b. leakage
c. prestige
d. vantage

Answers

Answer:

leakage

Explanation:

A non verbal communication such as leakage is a scenario where a person verbalizes one thing but their body language bis indicative of something else entirely. An example is using hand gestures, facial movements and also using hand to face gesture.

This concept is very important in the study of body language. It can show what a person's internal feeling is even though they try to cover it up.

For this question, leakage is the correct answer.

Other Questions
A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem