Ramon has been appointed the manager of a retail store. He wants to bring the store into the modern era and direct its future by utilizing the latest trends in visual merchandising. What can Ramon do to achieve this?

Answers

Answer 1

Answer:quit school and beco

Explanation:

Answer 2

Answer:

C.  install mannequin robots to display clothes

Explanation:

Among the offered answers, a truly avantgarde, modern approach is to implement robot mannequins in the store. With this tactic, customers would be incentivized to approach this innovative customer journey. Through pioneering this technique, Ramon's company would get a competitive advantage through visual merchandising.


Related Questions

Why are slide presentations universal in business environments?
A. Because the software is free and easy to obtain
B. Because of their compatibility with media and sound
C. Because they are easy to use and can accommodate all varieties
of information
D. Because they are extremely easy to share with your friends and
family members
SUBMIT

Answers

The correct option is, (C)  because they are easy to use and can accommodate all varieties of information.

Which slide is best for presentation?

Here are a few presentation slide options to choose from based on what your topic material is:

Meeting Agenda Template. Company Goals Template.Company Overview Template. Project Status Report Template.Business Annual Report Template.Business Plan Template. Product Introduction Template.Product Presentation Template.

What are two main types of presentation?There are two basic types of presentations (or oral reports) that you will likely be called upon to deliver during your educational career and beyond informative presentations and persuasive presentations.

What are different methods of presentation?There are four basic methods (sometimes called styles) of presenting a speech: manuscript, memorized, extemporaneous, and impromptu. Each has a variety of uses in various forums of communication.

Learn more about  slide presentations universal here:

https://brainly.in/question/11725645

#SPJ2

Tell me ten different things a person would need a credit score for? WILL MARK BRAINLIEST DUE TODAY PLEASE HELP 50 POINTS

Answers

Buying a home, renting a car, credit card, bills, pulling out a loan, Renting a home , buying a car

Match the scenario to the organization/team responsible.

1. As a result of a tornado, many water pipes are broken and it is feared sewage is leaking into the drinking water.
A. CDC
2. As a result of an earthquake, many stores cannot sell food and it is feared some crops have been contaminated.
B. DHS
3. As a result of a disaster, it is determined the local resources cannot adequately address all the needs of a community.
C. FDA

Answers

Answer:

A. people were drinking contaminated water

Explanation:

Question 1 of 20
The final step of the sale of property is
A. acceptance
B. title transfer
C. contract
D. offer

Answers

Answer:

B. title transfer

Explanation:

A certificate of title is the proof of owners of the property. Title transfer is the act of changing ownership of a property from the seller to the buyer.

Title transfer is the last step in a property sale. The process of title transfer starts after the terms and conditions specified in the sale agreement have been fulfilled. The seller is happy to relinquish ownership of the property to its new owner.

What is the difference between domestic and international business? Give an example of a company for each.

Answers

Answer

Cultures
No two cultures are the same and understanding both the social and business culture in another country is the first key to success. Culture defines everything a society does, from its business practices, to its response to advertising and marketing, to negotiating sales. It is important to include research on the culture of the country(s) that you intend to sell to prior to entering their market. Understanding these, often sensitive, areas will mean that you are better prepared when first entering the market. Although the people that you will deal with will not expect you to be completely in tune with the culture, respect and politeness will go a long way.

HELPPP How would entrepreneur apply comfort with risk when developing a product or service ?

Answers

test the product before it launches

Answer:

Testing and responses help

Explanation:

ask for feedback from testers

Comparing traditional view of the cost of variability and Taguchi's view of cost of variability,

a)Both views are about the same.

b)Traditional view holds that as long as the product is within specification, there is no difference.

C)Taguchi's view holds that closer to the midpoint of specifications better it is.

d)B and C are true.

e)None of the above.

Answers

i think it is d
i had to answer this too lol

any good business plan ideas
my business will be something to do with tie Dye

Answers

Answer:

nike socks for sure

Explanation:

Hoodies/Gloves would be amazing options.

guess my birthday and i’ll mark you brainiest . hint october

Answers

Um...october 22nd ?

i hope this is it lol

Answer:

october 1-31st

Explanation:

no need to thank me

ABC Company issues a 3-year bond with a $1,000 Face Value and a 5% Coupon Rate, with coupons paid once a year at the end of every year. It is now the beginning of its second year and the first coupon has already been paid. Banks are now giving 4% interest for deposits. The Bond's Market Value is $913. What is the bond's yield to maturity?

Answers

Answer:

yield to maturity = 9.78%

Explanation:

yield to maturity = {coupon + [(face value - market value) / n]} / [(face value + market value) / n]]

YTM =  {$50 + [($1,000 - $913) / 2]} / [(($1,000 + $913) / 2]] = $93.50 / $956.50 = 0.09775 = 9.78%

The yield to maturity represents the total rate of return that an investor should receive if he/she holds a bond until it matures.

onomics-CPB 2020
Match each occupation with its 2016 employment number, as listed in the previous article.
3,452,200
Office Clerks
4,602,500
Registered Nurses
3,555,500
General Combined Food Preparation and
Serving Workers, Including Fast Food
2,955,200
Cashiers
3,117,700
Retail Salespersons
Correct
Intro
Final

Answers

Answer:

Cashiers - 3,550,500

Retail - 4,602,500

Office Clerks - 3,117,700

General Combine Foods - 3,452,200

Registered Nurses - 2,955,200

Explanation:

I just took it and got them right

Answer:

Cashiers - 3,550,500

Retail - 4,602,500

Office Clerks - 3,117,700

General Combine Foods - 3,452,200

Registered Nurses - 2,955,200

Explanation:

I just took it and got them right

Which describes the difference between simple and compound interest?

A> Simple interest is paid on small, short-term loans, while compound interest is paid on large, long-term loans.
B> Simple interest is paid on the principal, while compound interest is paid on the principal and interest accrued.
C> Simple interest is paid on large, long-term loans, while compound interest is paid on small, short-term loans.
D> Simple interest is paid on the principal and interest accrued, while compound interest is paid only on the principal.

Answers

Answer:

B> Simple interest is paid on the principal, while compound interest is paid on the principal and interest accrued.

Explanation:

Simple interests is the interest earned on the principal amount only. The amount of interest does not change throughout the life of the investment or loan.

In compound interests, the interest earned in a particular season is added to the principal amount. Adding together interest and the principal amount is referred to as compounding. The effect is that the principal amount increases every year. An increase in principal amount results in higher interest every subsequent year.

Simple interest is paid on the principal, while compound interest is paid on the principal, and interest accrued is the difference between simple and compound interest. Thus, option B is correct.

The interest that is solely paid on the principal amount is known as simple interest. Throughout the duration of the loan or investment, the interest rate remains constant.

Compound interest is an interest rate where the interest from one season is added to the principal. Compounding is the process of combining the principal amount, interest, and other amounts. The result is an annual rise in the principal amount. Every successive year, interest rises as the principal amount does as well.

Therefore, option B is the ideal selection.

Learn more about simple interests here:

https://brainly.com/question/30964674

#SPJ6

What will happen if the price of one of the resources used to produce a good increases? a. The demand curve for that good will shift to the left. b. The demand curve for that good will shift to the right. c. The supply curve for that good will shift to the left. d. The supply curve for that good will shift to the right.

Answers

Answer:

. The supply curve for that good will shift to the left.

Explanation:

A shift in the supply curve arises when suppliers increase or decrease production. A shift in the supply curve is a result of a change in supply. An increase in supply results in the supply curve shifting to the right, While a decrease makes it shift to the left.

Factors that cause suppliers to reduce production makes the supply curve to shift to the left or inwards. Examples of such factors include an increase in taxation, civil unrest, or changes in technology.

An increase in the price of raw material will make production more challenging for suppliers. The output from suppliers will decrease, causing the supply curve to shift to the left.

which of the following is NOT included on a check

Answers

Answer: Name date amount of money

Explanation: Your welcome

The process of achieving company goals by effective use of resources is called?

a. Management
b. Planning
c. Controlling
d. Supervision

Answers

Answer:

a

Explanation:

it is called management

Hemanta Wants to meet you soon negative answer​

Answers

Answer:

Hemanta does not want to meet you soon

Answer:

Hemanta doesnt like you

who wanan be mark as brainiest

Answers

Answer:

meeee I think i can do it

Explanation:

plz

When the price is $12 the quantity demanded is 50. When the price increases to $24 the quantity demanded decreases to 30. Calculate the price elasticity of demand.

Answers

Answer:

PED = -0.4 or |0.4| in absolute terms

Explanation:

price elasticity of demand (PED) = % change in quantity demanded / % change in price

% change in quantity demanded = [(30 - 50) / 50] x 100 = -40%% change in price = [($24 - $12) / $12] x 100 = 100%

PED = -40% / 100% = -0.4 or |0.4| in absolute terms

the demand is price inelastic since |0.4| < 1

this means that the change in quantity demanded is proportionally less than the change in price.

Drew a bill upon Raman amounting to Rs 25000 and he accepted the bill.
Journal entry​

Answers

Answer:

left hand side; SALE

RIGHT HAND SIDE: 25000

Explanation:

Select the correct answer.

If a deal sounds too good to be true, it usually is.

-True

-False

Plato Course Assesment

Answers

False

It’s it’s too good to be true then theirs a catch which makes the deal worse

Well the real answer is True

Explanation: It is not a real explanation but the person said it's not false, so I choose to shout out the answer for all of you people. Anyways good luck with the quiz or test!

the answer is already there, this is for the peeps who need it... What are human resources?
Human resources are the people you have working for and supporting your company's success.

Answers

I actually did need this, thank you!

Business 2: After apprenticing for another candy maker, I started my first candy business at age 18.

Unfortunately, my first attempt at starting a business (as well as my second) was a failure. After a rocky start,

my third try was more successful - I have just received a fortune from the sale of my caramel business. During

my world travels, I discovered new equipment that makes chocolate and decided to buy it. Today, only the

wealthy can afford chocolate. With this new technology, I think I can make a chocolate that everyone can

afford. In my mid-thirties, I know very little about making chocolate but I am willing to take the time to learn. I

want my life to center on inventing new candies, building this new business, and laying out a new community

that will be a wonderful place for the people I hire to live. I prefer to leave day-to-day operations of the

company–handling production, sales, marketing and distribution—to someone else

Answers

Answer:

The question is incomplete since the requirements are missing, so I looked for similar questions and found that you should advice this client either to form a sole proprietorship, partnership or corporation.

Since this client wants to focus solely on inventing new candies, he would be better off by forming a corporation. That way, he and other stockholders can elect a board of directors which will appoint an appropriate upper management team to run the business.

The other two types of businesses, sole proprietorships and partnerships require that the owners actively participate in managing the business, and that is something that the client wants to avoid. This happens because sole proprietors and partners are personally liable for all the business obligations. On the other hand, corporations are managed by a professional team.  

Which of the following can help consumers with excessive debt negotiate with lenders to reduce interest rates and fees?

a
Bankruptcy lawyer

b
Credit counseling service

c
Federal Trade Commission

d
Financial Protection Bureau

Answers

Answer:

Credit counseling service

Explanation:

Credit counseling services are offered by not-for-profit organizations to assist individuals and firms plan how to pay off outstanding debts. Credit counselors are specialists in debt management. They offer their clients debt management advice and help them make debt repayment plans.

Credit counseling services make debt repayment easy and manageable. Credit counselors sometimes negotiate for reduced monthly payments and lower interest rates.

Jerry is a student and is currently on a summer job. He hopes to save $2,000 for his short-, medium and long-term goals. Which of the following
is a long-term goal?
O A allocating funds for paying off his student loan
OB.
allocating funds for buying a house
OC. allocating funds for buying books for his next semester
OD
allocating funds for buying a new laptop

Answers

Answer:

OD

allocating funds for buying a new laptop

Explanation:

or A

In three to four sentences, explain how wage discrimination results in unequal pay and how can this be corrected??!

Answers

Answer:

Well some people  bosses of a business can discriminate people in many ways skin tone height anything honestly. It results in unequal pay because sometimes a boss will pay someone who has a specific skin tone more money then someone else who has the opposite skin tone. That's unequal pay and it can be corrected by making people aware of what there doing or protesting and boycotting the places that do this.

Answer:

Women are paid less because they have less potential in the eye of an employer. Although race or gender have nothing to do with work ethic, it takes a toll on minorities regardless. This can be corrected by paying employees based on the work they have done, rather than the work they might do.

Explanation:

Read the sentence.

Because of the presence of many _[blank]_, California is a leader in entrepreneurship and innovation.

Which best completes the sentence?

A)court battles
B)wealthy investors
C)hardships
D)frontier people

Answers

Answer:

D) frontier people

Answer:

the correct answer is  wealthy investors

Explanation:

I got a 100% on the test and answer D was icorrect the first time I took it.

1st to answer gets Brainliest

Which of the following can help consumers with excessive debt negotiate with lenders to reduce interest rates and fees

A.Bankruptcy lawyer

B.Credit counseling service

C.Federal trade commission

D.Financial protection bureau

Answers

Answer:

B.Credit counseling service

Explanation:

Credit counseling services involves engaging a credit counselor to pay off unsecured debts through a debt management plan. Credit counselors offer various services, including providing basic money management advice and setting up debt repayment plans.

Credit counseling simplifies the repayment process. Debt payment becomes easy and manageable.  Credit counselors may negotiate lower interest rates and reduced monthly payments with creditors, which saves money.

what is shareholders and can u give me an example​

Answers

Answer:

The definition of a shareholder is a person who owns shares in a company. Someone who owns stock in Apple is an example of a shareholder

Explanation:

Answer:

Someone who owns stock in Apple is an example of a shareholder.

Explanation:

if the price level is set at 35 margin points, what percentage will be earned on each unit sold?

Answers

Answer: 35%

Explanation:

Margin points are the amount above cost price that a good is being sold for and each point represents a percentage. If it is said that a good is being sold at 35 margin points, it means that it is being sold at 35% above the cost price of the good.

For instance, if a good cost $40 to purchase and you want to sell it at 35 margin points, your selling price is;

= 40 * ( 1 + 35%)

= $54

Let's take a look at precipitation over the course of a year in High Springs ( a small town north of Gainesville, near the Sante Fe River). (Please note that they start the year at O - October.) Which statement best describes the center for the boxplots?

Answers

Answer:

- The medians for the summer months of June, July, August, and September are higher than for the other months.

Explanation:

The statement prescribing 'the medians within the months of summer June, July, August, and September are higher in comparison for the other months' correctly describes the halfway for the boxplots. This displays that the precipitation during these months due were higher due to the high temperature and intense water cycle.

Other Questions
What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait A $10,000 bond with 18%/year, compounded semi-annually (interest is paid every six month) is available in the market. The bond matures in 10 years. The closest PW of this bond if the purchaser can earn 12%/year, compounded quarterly is:_____. My annoying brother likes to drive me crazy. There is no other who is that lazy. He whines to my mom night and day, until eventually gets his way. What is a sister to do, when he screams til he's blue? There is no way to win, for he gets under your skin. He does his best to kill all joy. Oh, how my brother does annoy! What is the tone of the poem PLZ HELP!!!Will mark brainliest44. Show that the quadrilateral with vertices A(0,0), B(a,0), C(a + b, c) and D(b, c) is a parallelogram. hehe i need help with the whole quiz basically:IFind the decimal that is equivalent to: A. 1.714 B. 0.583 C. 0.0583 D. 6. Another engine reaches its top speed from rest in 7.5 s. It is able to perform 250,000 J of wok inthat time How much power does this engine have in that time?