pleaseeee helppppppp

Pleaseeee Helppppppp

Answers

Answer 1
i believe that the answer is B. my apologies if it is incorrect

Related Questions

Steps to Don Poe proper order

Answers

Answer:

Donning PPE (Putting on)

Perform hand hygiene

Put on shoe covers (if applicable)

Put on gown

Put on mask/respirator (if applicable)

Put on eye protection (if applicable)

Put on gloves

Doffing PPE (Taking off)

Remove shoe covers (if applicable)

Remove gown and gloves together*

Perform hand hygiene

Remove eye protection (if applicable)

Remove mask/respirator (if applicable)

Perform hand hygiene

Explanation:

what type of infusion is the followinng order give sofium chloride 0.9% 1000 ml qt12 for 3 days

SVP
MVP
LVP
or
Intermittent infusion

Answers

Intermittent infusion is the followinng order give sodium chloride 0.9% 1000 ml qt12 for 3 days

What is the sodium chloride 0.9% 1000ml q12 for 3 days infusion?

Sodium Chloride 0.9% intravenous infusion is an isotonic solution, having an estimated osmolarity of 308 mOsm/l. The solution's pharmacodynamic characteristics are those of the sodium and chloride ions in maintaining fluid and electrolyte balance.

Sodium Chloride 0.9% is a colourless, sterile solution for infusion. It is used to treat sodium shortage, dehydration (water loss), hypovolaemia (sudden reduction in circulating blood volume), and as a solvent and carrier for other suitable pharmaceuticals for parenteral administration of medicines.

learn more about Intermittent infusion

https://brainly.com/question/28322084

#SPJ1

4. As an effective communicator, you will
patients.
O speak simple language to
O ignore
compromise with
advocate for
(be a supporter of) your

Answers

Answer:

Speak simple language to patients.

Explanation:

True or false? Contraceptive failure rate is based on studies that directly measure the percentage of women who experience unintended pregnancy in the first year of contraceptive use.

Answers

True, the contraceptive failure rate is indeed based on studies that directly measure the percentage of women who experience unintended pregnancy in the first year of contraceptive use. This rate is an important statistic for evaluating the effectiveness of various contraceptive methods.

To calculate the contraceptive failure rate, researchers conduct studies that monitor women using a particular contraceptive method over a defined period, usually one year. The primary focus is on observing how many unintended pregnancies occur during that time. These studies usually involve a large number of participants to ensure a reliable and representative sample of the population using that method.

After the data is collected, researchers analyze the results and determine the contraceptive failure rate by calculating the percentage of women who experienced an unintended pregnancy within the first year of using the method. This rate allows individuals and healthcare professionals to compare the effectiveness of different contraceptive methods and make informed decisions on which method might be best suited for their needs.

In summary, it is true that the contraceptive failure rate is based on studies that directly measure the percentage of women who experience unintended pregnancy in the first year of contraceptive use. This important statistic helps evaluate the effectiveness of various contraceptive methods, enabling individuals and healthcare professionals to make informed choices about their family planning options.

for more such questions on  contraceptive .

https://brainly.com/question/10480479

#SPJ11

Brainstorm ways that you might incorporate more physical activity into classroom routines to help children achieve the recommended 60 minutes of vigorous daily activity.

Answers

The ways that you can be able to incorporate more physical activity into classroom routines to help children are outlined below.

How do you incorporate physical activity?

There are many ways to incorporate more physical activity into classroom routines to help children achieve the recommended 60 minutes of vigorous daily activity. Here are some ideas:

Brain breaks: Incorporate short physical activities or "brain breaks" into the classroom routine, such as dancing, stretching, or doing jumping jacks. These can be scheduled at regular intervals throughout the day to give students a chance to move around and get their blood flowing.

Active learning: Incorporate physical activity into learning activities, such as having students act out stories or concepts, or using movement to reinforce math or science concepts.

Standing desks: Consider providing standing desks or adjustable-height desks to allow students to stand or move around while working.

Recess: Encourage students to be active during recess by providing a variety of equipment and activities, such as jump ropes, balls, or organized games.

Active transportation: Encourage students to walk or bike to school or other activities, and provide safe routes and infrastructure to support active transportation.

Classroom design: Design the classroom to promote physical activity, such as providing space for movement and active play, or incorporating equipment such as stability balls or pedal desks.

Physical education: Ensure that students have access to high-quality physical education classes, which provide opportunities for structured physical activity and help students develop fundamental movement skills.

By incorporating these strategies, teachers can help students achieve the recommended 60 minutes of vigorous daily activity, which can have positive effects on physical health, academic performance, and overall well-being.

Learn more about physical activity:https://brainly.com/question/14338730

#SPJ1

Andrea intensively uses synthetic fertilizers to increase the productivity of soil. Intensive use of fertilizers to compensate for productivity loss is unsustainable and has additional ecological effects such as water pollution and ______
.

Answers

Intensive use of fertilizers to compensate for productivity loss is unsustainable and has additional ecological effects such as water pollution and land/soil pollution.

What are fertilizers?

Fertilizers are chemical substances that is used to make the ground more suitable for growing plants.

This means that chemical or inorganic fertilizers are used to increase the productivity of the soil by artificially supplementing the nutrients in the soil.

According to this question, Andrea intensively uses synthetic fertilizers to increase the productivity of soil. The intensive use of fertilizers to compensate for nutrient depletion can cause the soil to be polluted.

Soil pollution is the contamination of soil with anomalous concentrations of toxic substances.

Learn more about soil pollution at: https://brainly.com/question/27352495

#SPJ1

Section: 6 (Questions 167-200)
167. What type of reactive exercises involve the repeated maximum stretching and contracting of muscles in the shortest amount of time?
A. O Speed training
B. O Balance training
C. Plyometric training
Agility training
D.Agility training

Answers

Answer:

C. Plyometric training

Explanation:

Plyometric training involves the repeated maximum stretching and contracting of muscles in the shortest amount of time.

Plyometric exercises, also known as jump training, involve explosive movements that are designed to increase power and explosiveness in muscles. These exercises involve rapid stretching (eccentric phase) of the muscle followed by a rapid shortening (concentric phase) of the same muscle. Some common examples of plyometric exercises include jump squats, box jumps, and burpees.

when food is directly given in the vein it is called ​

Answers

Answer: Parenteral nutrition

Explanation:

Parenteral nutrition, often called total parenteral nutrition, is the medical term for infusing a specialized form of food through a vein (intravenously).

Why is it important to understand individual routines?

Answers

Explanation:

Understanding individual routines is important for a variety of reasons, including:

Time management: Knowing an individual's routine can help in managing time effectively. It allows you to prioritize tasks and schedule activities at the most suitable times, avoiding conflicts and optimizing productivity.

Health and wellness: Understanding an individual's routine can help identify any unhealthy habits or practices that may negatively impact their health and well-being. By understanding their routine, you can suggest ways to incorporate healthy habits such as exercise, meditation or healthy eating.

Communication: Understanding individual routines helps facilitate better communication between individuals. It can help in planning meetings, scheduling appointments, and coordinating activities more effectively, ensuring that everyone's needs are met.

Empathy: Understanding an individual's routine can help you be more empathetic towards them. It helps you understand their challenges, strengths, and limitations, making it easier to offer support and assistance when needed.

Relationship building: Understanding individual routines is also essential for building positive relationships. It allows you to develop a deeper understanding and appreciation for an individual's unique qualities, which can help in building trust, respect, and stronger relationships.

In summary, understanding individual routines is important because it can help in time management, promote health and wellness, improve communication, foster empathy, and build positive relationships.

1. Cindy is a phlebotomist working the morning shift at the local hospital. Though she is
normally well rested and ready for work, this morning she is feeling tired and irritable.
Her 2-year-old son had a stomachache and kept her up most of the night. Her first patient
is a 22-year-old male with a bad attitude. When she attempts to explain that she is going
to obtain blood for testing, he sneers at her and asks, "You and what army?" Cindy snaps
back at him, "I didn't order these tests, your doctor did. Now, hold still!"
Suggestions

Answers

Answer: I think that she should take a break from work

Explanation:Since Cindy is a phlebotomist it must be a very hard job for her

Interventions to deal with the factors that affect team cohesion

Answers

Team cohesion refers to the degree of mutual attraction, unity, and commitment among team members.

What is a cohesive team?

A cohesive team tends to work well together, trust each other, communicate effectively, and share common goals. However, several factors can affect team cohesion, including individual differences, lack of trust, poor communication, conflicting goals, and task interdependence.

Here are some interventions that can help deal with these factors and improve team cohesion:

Build trust: Establishing trust among team members is crucial to building cohesion. Encourage team members to share personal stories, opinions, and concerns with each other. Foster an environment where it is safe to make mistakes and learn from them. Establish clear boundaries and guidelines for respectful communication and behavior.

Improve communication: Communication breakdowns can lead to misunderstandings and distrust. Encourage team members to listen actively and speak candidly. Use a variety of communication channels such as emails, instant messaging, and face-to-face meetings to ensure that everyone is on the same page. Encourage feedback and check-ins regularly to ensure everyone is on the same page.

Learn more about team cohesion here: https://brainly.com/question/30890021

#SPJ1

The rhomboid muscles, often simply called the rhomboids, are rhombus-shaped muscles associated with the scapula


True

False

Answers

Answer:

the answer of this question is true

Explanation:

hoop you known

Select any country severely affected by malnutrition research and explore the causes and effects of malnutrition in that country write a report on it

Answers

Yemen is a country severely affected by malnutrition in recent years.

What were the causes of this malnutrition?Warlike conflicts.Economic collapse.Severe climate changes.Limited access to basic health care.

Yemen is a country situated on the Arabian Peninsula, which has been suffering from extreme malnutrition for many years. This malnutrition has caused effects such as stunted growth of children, a drastic increase in mortality, exposure to severe diseases, low academic performance, and low economic development.

To solve the crisis in Yemen, it is necessary to create public policies that have international collaboration and intervention in the country's civic problems.

Learn more about malnutrition:

https://brainly.com/question/30514873

#SPJ1

Which country spends the most in administrative health care costs?

Answers

The United States spends the most on administrative healthcare costs compared to any other country in the world.
United States is the highest spending country worldwide when it comes to health care! four trillion dollars is used when it comes to health care !

(Hope this helps !~) (ノ´ヮ`)ノ*: ・゚

Have you or someone you know ever had food poisoning? Discuss the symptoms you had. Did you have to seek out medical care or did your body fight off the pathogens on its own? Describe the signs that indicate a person needs to seek out medical help in the case of food poisoning.

Answers

Food poisoning is a common condition that can be resolved on its own within a few days. However, if you experience severe symptoms or are at high risk of complications, seek medical help promptly.

Food poisoning is a common condition caused by consuming contaminated food or water. The symptoms of food poisoning can vary depending on the type of pathogen and the individual's health condition. The most common symptoms include nausea, vomiting, diarrhea, stomach cramps, and fever. In severe cases, food poisoning can lead to dehydration, loss of appetite, and even organ failure.

In most cases, the symptoms of food poisoning resolve on their own within a few days. However, some people may require medical attention, especially if they have severe symptoms, such as dehydration or blood in their stools. People with weakened immune systems, such as the elderly, young children, pregnant women, and those with chronic illnesses, are at higher risk of developing complications and may need medical care.

Signs that indicate a person needs to seek medical help in the case of food poisoning include:

Severe abdominal pain or cramping

High fever

Blood in the stools

Signs of dehydration, such as decreased urination, dry mouth, and lethargy

Inability to keep liquids down for more than 24 hours

Signs of neurological problems, such as blurry vision, muscle weakness, or tingling in the extremities.

Learn more about Food poisoning here:

https://brainly.com/question/16327379

#SPJ1

Juanita, a 42-year-old woman with no significant medical history, has just finished her annual medical appointment. Her doctor told her that her hemoglobin A1c is slightly elevated, putting her in the range for prediabetes.

Her doctor said if she loses 5-10% of her current weight and makes better food choices, her A1c should go down and this will decrease her risk of developing type 2 diabetes in the future.

Juanita stops by your office (an assistant nutrition educator) to get more information.

What questions would you ask Juanita before providing any guidance? Please ask three or more questions that are not answered in the prompt above.
Makeup Juanita's answers to these questions in full sentences, just like in a real conversation.
Describe at least three key components to healthy weight loss that Juanita will be able to implement immediately. This section should be in paragraph format.

Answers

Examples of 3 questions that you should ask her are:

What is your typical daily diet like?What kind of physical activity do you engage in on a regular basis?What are your current weight and height measurements?

Answers to one of these is in the answer below, so you can see the format.

What questions should you ask to Juanita?

So here we have a problem because Juanita has no significant medical history, so we don't know a lot about her.

We only know that she is in the range of prediabetes and has risk of entering in type 2.

So some questions we should ask her are:

What is your typical daily diet like?What kind of physical activity do you engage in on a regular basis?What are your current weight and height measurements?Do you have any food allergies or intolerances?How would you rate your stress level and sleep habits?What kind of support system do you have for making lifestyle changes?

Among a lot others.

Now let's select one of these that Juanita answer:

What is your typical daily diet like?

"I am vegetarian, so i ate mostly vegetables and cereals, but I also have anxiety problems, so i always have some candy or smokes near me"

Now, that is kinda trivial, but for that answer there are really easy things to identify that may affect her weight loss, for example, stop using sweets to control her anxiety.

Now you can try with the other questions and just play with it.

Learn more about diabetes at:

https://brainly.com/question/26666469

#SPJ1

Outline project
on Inform Consent Emergency situation

Answers

Answer: Answer is below <3 Please give brainliest if this helped you :)

Explanation: When patients in an emergency situation lack decision-making capacity, physicians may seek consent from a surrogate decision-maker such as a family member or provide treatment that would be considered appropriate and in the patient's best interest by a reasonable person.

what is the BMI. A, a tool used to measure and evaluate individual weight. B, a tool used to find one’s ideal number of daily calories. C, a tool used to measure the ratio of lean muscle to fat.

Answers

Answer: A is the answer

Explanation:

what is the Urinary Tract Infection(UTI)

Answers

Answer:

Explanation:

A urinary tract infection (UTI) is an infection that occurs in any part of the urinary system, which includes the kidneys, ureters, bladder, and urethra. Most UTIs are caused by bacteria, but they can also be caused by viruses or fungi.

UTIs are more common in women than men, and symptoms can include a frequent and strong urge to urinate, pain or burning during urination, cloudy or strong-smelling urine, lower abdominal pain, and in some cases, fever and chills.

UTIs can be treated with antibiotics, and it's important to seek medical attention if you suspect you have a UTI, as untreated UTIs can lead to more serious complications such as kidney damage or sepsis.

How are deaf babies similar to normal hearing babies when it comes to the sequence of languages learning

Answers

Answer:

Explanation:Deaf babies are similar to normal hearing babies in terms of the sequence of language learning. Both groups of babies go through similar stages of language development, regardless of whether they are hearing or deaf.

In the first few months of life, babies are able to differentiate between the sounds of all languages. As they grow and develop, they begin to focus more on the sounds of the language(s) they are exposed to on a regular basis. By the age of six months, both deaf and hearing babies start to babble, making sounds that resemble the language(s) they hear around them.

Around the age of one, babies typically start to say their first words, and by the age of two, they begin to combine words into simple phrases. Both deaf and hearing babies follow this sequence of language development, although the rate of progress may vary depending on factors such as exposure to language and the quality of the language input they receive.

One key difference between deaf and hearing babies is that deaf babies may have more difficulty acquiring spoken language due to their inability to hear sounds. However, they can still learn language through visual and tactile means, such as sign language and other forms of visual communication.

Hope it helps (:

Deaf babies and normal hearing babies are similar in the sequence of language learning. They both start with babbling, which is a pre-linguistic stage where they make sounds without meaning. Then, they move on to one-word utterances, where they use single words to communicate their needs and wants.

What is next output?

Next, they learn two-word combinations and simple sentence structures to express more complex ideas. Finally, they acquire more complex grammar and vocabulary to communicate effectively.

The only difference is that deaf babies will learn sign language as their primary mode of communication, whereas hearing babies will learn spoken language as their primary mode of communication.

Overall, the sequence of language learning is similar for deaf and hearing babies, but the methods and timing of language acquisition may be different due to the different sensory inputs available to them.

Learn more about language learning at:

https://brainly.com/question/30528154

#SPJ2

Benefits of getting help with the conflict:

Answers

Mitigate Stress. Unresolved conflicts lead to higher levels of anxiety and stress. ...
Enhance Emotional Connection. The most significant benefit from conflict therapy is that it helps you build a stronger connection with both yourself and others. ...
Deepen Relationships. ...
Achieve Goals.
It is helpful to know patient needs
It’s make patients feel better
It’s make people easier to share everything with you

Mrs Jones is ready to have some crowns placed on her anterior teeth. Discuss what is needed for the first impression.

Answers

First impressions: The first phase in the fabrication (manufacturing) of various prostheses, like as crowns and dentures, preliminary impressions are utilised for diagnostic purposes.

How does a dentist make a crown impression?

Heavy body and light body addition silicone, along with a firm bespoke tray and a precise clinical method, are often used to create the most accurate impressions. Nevertheless, a rigid stock tray can also be utilised with these materials.

In the imprint tray, heavy body silicone is often utilised as a foundation material. The imprint tray is then put over the teeth and filled with heavy body, pushing the light body into the preparation's surrounding crevices after a low viscosity substance has been injected around it.

learn more about anterior teeth

https://brainly.com/question/17196517

#SPJ1

Match each scenario to the strategy the person is using to avoid risky situations. Danita has an odd feeling about something. She turns down Greta's invitation to go camping. Jonas asks what Petra wants to do before going on a date with her. Know who will be there. Know what the plan is. ہ​

Answers

Answer:

Danita has an odd feeling about something. She turns down Greta's invitation to go camping.

Strategy: Avoidance

Jonas asks what Petra wants to do before going on a date with her. Know who will be there. Know what the plan is.

Strategy: Risk reduction/planning

Explanation:

Many experts reject Harris' theory concerning the influence of peers. How does Harris defend
and support her theory? Do you agree or disagree with the theory?

Answers

Answer:

To defend her theory on the influence of peers, Harris argues that the way children turn out is not necessarily determined by their upbringing or the behavior of their parents, but rather by their peers and the social environment they experience outside of the family. Harris believes that children learn to adopt the behaviors, beliefs, and values of their peer group as they try to fit in and establish their social identity.

Harris also cites evidence from studies that show that peers can have a more significant influence on a child's behavior and personality than parents. For example, studies have found that children who move to a new school or neighborhood can undergo significant changes in their behavior and personality to conform to the norms of their new peer group. Harris believes that this shows that peer influence is a powerful force that should not be underestimated.

However, many experts reject Harris' theory, arguing that parents and family environment have a significant impact on a child's development, particularly in the early years. They believe that children learn from their parents through modeling, observation, and reinforcement, and that parents play a crucial role in shaping a child's beliefs, values, and personality.

Whether one agrees or disagrees with Harris' theory is a matter of perspective and interpretation of the available evidence. While peer influence is undoubtedly significant, it is also clear that parents and family environment can have a significant impact on a child's development. Therefore, it is essential to consider multiple factors and perspectives when trying to understand how children develop and the role of different factors in their development.

Explanation:

Harris's theory contends that peer influence and the social environment children experience outside of the home are more important in shaping who they become than their upbringing or the actions of their parents.

Harris's theory is in defense of her theory on peer influence. Depending on how one views the evidence and interprets it, one may or may not agree with Harris' theory.

While peer pressure is unquestionably important, it is also obvious that a child's family and home environment can have a big impact on their development. Hence, it is crucial to take into account a variety of variables and viewpoints when attempting to comprehend child growth and the impact of various variables.

Learn more about environment, here:

https://brainly.com/question/13855827

#SPJ2

State 5 nursing measures that can be done for patient with Cardiac disorders.
20. Describe the different stages of edema. What fluid compartment is affected.

Answers

For the first one it would be. assessment, diagnosis, planning, implementation and lastly evaluation. For the second one- Grade 1: Immediate rebound with 2 millimeter (mm) pit. Grade 2: Less than 15-second rebound with 3 to 4 mm pit. Grade 3: Rebound greater than 15 seconds but less than 60 seconds with 5 to 6 mm pit. Grade 4: Rebound between 2 to 3 minutes with an 8 mm pit. The type of fluid would be extracellular fluid compartment.

HLP PLEASE ITS DUE ASAP ( Philosophy of Animals ) Only if you know how to answer if your in college
Be sure to include an introduction. An introduction should do the following:
o Introduce the reader to the topic. That is, explain in general terms
what the topic is, what the issue(s) is(are), and why the reader should care
about it.
o Introduce the reader to what will be done in the essay: explain briefly what will be the
different parts of the essay, that is, provide a roadmap
• Make sure the structure of your paper matches the roadmap provided in the introduction
• Cite all sources using both in-text citations and a works cited page.

What are the main features that distinguish anthropocentric and non-anthropocentric
positions?
- What are one or two characteristics (like, recognizing intrinsic value to all living beings
or recognizing intrinsic value only to sentient beings, having a principle of noninterference etc…) that you believe a non-anthropocentric position should rather not
have?
Specify, for each of these characteristics, which non-anthropocentric position seen in
class does include this feature and why you believe it is a problematic one. Include
reference to the author and publication presenting/discussing this position.
- What are one or two characteristics (like, recognizing intrinsic value to all living beings
or recognizing intrinsic value only to sentient beings, having a principle of noninterference etc…) that you believe a non-anthropocentric position should have?
Specify, for each of these characteristics, which non-anthropocentric position seen in
class already does include this feature and why you believe it is a valuable one. Include
reference to the author and publication presenting/discussing this position.
- How do you apply your position, made of the rejection or endorsement of the features
discussed in your essay, with respect to other forms of life to everyday life?

Answers

Answer:

Introduction:

Understanding the moral and religious ramifications of interactions between humans and non-human animals is the focus of the field of animal philosophy. This area of study has important implication for how society views and treats animals. In this essay, we will discuss the main traits that separate objectivist and non-anthropocentric positions. We'll also look at the characteristics a non-anthropocentric perspective should or shouldn't have, as well as how these positions relate to real-world situations.

Anthropocentric vs. Non-Anthropocentric Positions:

Whereas non-anthropocentric perspectives recognize the intrinsic value of non-human animals and/or the environment, anthropocentric positions see humans as the only beings with intrinsic value. The complete rejection of any use of animals by humans is one aspect that a non-anthropocentric viewpoint should not contain. The animal rights perspective, which believes that all uses of animals are evil, is a good example of this viewpoint. This viewpoint neglects the potential advantages some uses of animals may have for both people and animals.

A non-anthropocentric attitude, on the other hand, should recognize the due to the increasing of every living thing, whether or not they are aware. The biocentric viewpoint, which argues that all living things have intrinsic worth that should be valued, acts as an example of this point of view. This point of view is useful because it acknowledges that all living things have a right to exist and grow.

Application to Everyday Life:

The animal rights perspective, that rejects all human use of animals, can cause issues in daily living. For example, major improvements in human health have resulted from animal use in medical research. In these situations, it's crucial to make sure that animals are handled with respect and dignity. The biocentric perspective, which recognizes the objective value of all living things, can guide us in treating animals and the environment with greater respect and consideration in our daily lives.

Conclusion:

In conclusion, gaining a thorough understanding of animal philosophy requires understanding the differences between anthropocentric and non-anthropocentric perspectives. While avoiding a full rejection of all uses of animals, a non-anthropocentric viewpoint should acknowledge the importance of all living things. We may work to create a more just and compassionate society for all living things by applying these ideas into our daily lives.

Explain how u can use a number line to show that 3 and 6 and 1 and 2 are equivalent fractions

Answers

If you had a number line for each, and one number line went up to 2, half of it would be one. For the other number line if it went up to 6, half of it would be 3.

According to the Death Penalty Information Fact Sheet, which of the following statements are true? (All information as of May 20th, 2021.)

Answers

Answer:

The death penalty is a punishment that has been practiced since the Babylonian era. This practice is still being used today in some of the most technologically and civilized countries like the United States despite the democratic, technological, and educational advancements we made as a society. The first documented death penalty was in the U.S. in 1608, where George Kendall was executed for being a spy from Spain. Since that date, many people have been convicted to death for robbery, arson, witchcraft, and murder. This sparks the big question is the death penalty justified since its existence in the eighteenth century. The answer is no because the death penalty is inhuman from a legal, moral, and ethical standpoint.

   There are no laws against the death penalty at the federal level. The one that comes the closest would be the Eight Amendment of the United States constitution. It states that the federal government shall not award cruel punishments that amount to tremendous torture; the idea behind this amendment is to restrict the government from handing down any excess sentence to any individual (The Library of Congress, 2012.) Sadly, these said laws are not clear, which leads to different interpretations; This is why some states regarding the death penalty have their laws even after rulings from the Supreme Court. For instance, in 1972, the supreme court vacated the nation's death row declaring that the death penalty is unconstitutional. The states instantly retaliated and replaced some of the terminology's penalties. The supreme court went even further and reduced some crimes that come under the extent of the punishment. Death can never be an appropriate punishment, especially in this society that does not give criminals retribution. When they are sought out to live in a confined territory for the rest of their lives, it gives the criminal a higher chance to atone for their sin. A common argument is that the death penalty will be a deterrent; later on, it is not true based on the U.S.'s statistics with homicide rates in the last couple of decades. The murder rate has climbed to up to 120% in 1963 and 1980, and just alone in New York, this statistic goes up to 400%. This presents the idea that the death penalty is inappropriate and there is always another possibility for a wrong ruling, but this shows that nothing can be done about it.

One of the most common reasons for the death penalty is an emotional response by society when another human dies in another human's hands based on their actions; the immediate emotional response is anger and vengeance towards that human. However, after a couple of years, there is sorrow in people's hearing, and the idea of revenge is lost. Yes, time is the best healer in this case, but that does not mean the perpetrator should go without punishment. Instead, they should be given a punishment that is rational and moral. Will there be closure with killing the perpetrator? Not because irrespective of the killer never coming back to life. The death penalty reasoning is that the criminal should suffer the last few seconds, such as their victim. These ideologies never hold any excellent being in our society. Even though the death penalty has existed for centuries on U.S. soil, it is not deterred people from committing a crime. This makes the death penalty a revengeful action fueled by emotion and makes it spiteful in the spur of the moment that has no implications or wants for anyone involved. Therefore there is another reason to abolish the death penalty.

The supreme court and social court Should reflect people's shared values and maturity over time. Awarding this capital punishment is a cruel way to discipline an individual, and it goes against the values the U.S. constitution holds. Furthermore, death penalties are unchangeable, and for those reasons, the courts should favor the life of confinement in prison. While criminals are punished for society's well-being, they should not have to be in the way of life. Life in prison will give the same amount of deterrence and retribution, which is why life in prison is a more appropriate form of punishment. In short, the death penalty is barbaric from a legal, ethical, and moral standpoint; therefore, it should be abolished from our society immediately.

Mr. Taylor has been admitted for possible sepsis, dehydration, and mild acidosis. Which nursing action would be most appropriate to take

Answers

If necessary, administering intravenous hydration. Patient and family education on potential causes of dehydration. Administering replacement electrolytes as necessary.

Nursing interventions for sepsis should be carried out promptly and correctly.management of the infection.control of fever.pharmaceutical treatment.checking the blood levels.evaluating physiologic condition.Providing nursing care for metabolic acidosisAdministering sodium bicarbonate intravenously to increase blood pH.treating ketoacidosis by giving insulin and intravenous fluids.Dialysis or renal replacement treatment, if necessary.Nursing Dehydration treatment options:patient is reminded of the need of oral intake.

Learn more about sepsis here:

https://brainly.com/question/30386476

#SPJ1

How many levels are on the pyramid

Answers

Answer:

if you are talking about the pyramid in memphis tennessee there are 3 levels mabye 4

Explanation:

That first one is wrong. The correct answer is 5.
Other Questions
For the function p = 2 - 3q. what is the instantaneous rate of change function? A piece of property contains 1,758.1066 sq. yards. How many yards are on each side of the square? How did the passage of Jim Crow laws in the South affect Black Americans?A. Jim Crow laws forced Black Americans to move North.B. Jim Crow laws forced Black Americans to move to Africa.C. Jim Crow laws took away rights from Black Americans.D. Jim Crow laws encouraged the development of the sharecroppingsystem. PLEASE HELP ME MATH. I WILL GIVE BRAINLISEST mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply. true or false? two proofs are required to establish the provable equivalence of two sentences of tfl. Why was the National Association of REALTORS Code of Ethics created? One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference? Which graph represents the solution to inequality which atomic particles are in a unique cloud outside of the nucleus of the atom? HELPPPPPPPPPPPP Plsss Solve 4^-2x 4^x = 641) Rewrite the equation using the same base. 2) Solve for x. Remember to show all work.PLEASE SHOW ALL WORK FOR BRAINLIEST PLEASEEE A buffer solution is prepared by adding NaH2PO4 to a solution of H3PO4. What happens if KOH is added? (1 point) one of the one-way functions used in public key cryptography is integer multiplication/factorization. multiplying two integers is easy, but factoring is hard. the number 3174277 is the product of two primes.what is the smaller of the two primes?what is the largest of the two primes? the second punic war a. saw the eventual victory of carthage over rome. b. saw hannibal invade italy from greece. c. won spain for rome and resulted in roman control over the western mediterranean. d. produced a great victory for the romans over hannibal at the battle of cannae. e. all of the above