If you can solve both of these ill give brainliest with work!

If You Can Solve Both Of These Ill Give Brainliest With Work!

Answers

Answer 1

Answer:

1) 4 ft

2) Length =69

Width=64

Step-by-step explanation:

1) 2x-2+2x-2+x-2+x-2=x+x-1+x-1

6x-8=3x-2

6x-3x=-2+8

3x=6

x=2

plugging it back in, we get for the triangle

2+2-1+2-1=4 (same answer for the rectangle, although it would have a width of zero)

2) w+w+w+5+w+5=266

4w+10=266

4w=266-10

4w=256

w=64

l=64+5=69


Related Questions

1. Label the Type of Slope



Answers

Answer:

positive slope

Step-by-step explanation:

2 cartons of juice in the month of January. In the month of February, she drank twice as many cartons of juice as in
January. How many cartons of juice did she drink in February?

Answers

Answer:

She drank 4 cartons in February.

Step-by-step explanation:You multiply 2x2 because it doubles.

explain what it means to solve a system of equations

Answers

Answer:

um hope this helps :D

Step-by-step explanation:

A system of equations is a collection of two or more equations with a same set of unknowns. In solving a system of equations, we try to find values for each of the unknowns that will satisfy every equation in the system. The problem can be expressed in narrative form or the problem can be expressed in algebraic form.

A collection of two or more equations with the same set of unknowns is referred to as a system of equations. I

What is a system of equations?

A system of equations is a collection of two or more equations with the same set of unknowns. In solving a system of equations, we try to find values for each of the unknowns that will satisfy every equation in the system. The problem can be expressed in narrative form or the problem can be expressed in algebraic form.

If the lines intersect, we identify the point of intersection. This is the solution to the system. The solutions of a system of equations are the values of the variables that make all the equations true.

To know more about a system of equations follow

https://brainly.com/question/13729904

#SPJ2

18 + 19x = 10x + 54
can someone help me with this

Answers

Answer:

The answer is X= 4.

Write an equation of the line that passes through the points ( 4, 2), (0, -6) *

Answers

9514 1404 393

Answer:

  y = 2x -6

Step-by-step explanation:

One form you can use for this purpose is ...

  (x2 -x1)(y -y1) = (y2 -y1)(x -x1)

Filling in the given point values, this is ...

  (0 -4)(y -2) = (-6 -2)(x -4)

  -4y +8 = -8x +32

Generally, we like the equation to have coefficients with no common factors. All of these coefficients can be divided by -4.

  y -2 = 2x -8

This can be rearranged to any form you may like--or left as is.

  y = 2x -6 . . . . . slope-intercept form

what is the range and domain of this question? im unsure​

Answers

Answer:

Step-by-step explanation:

Domain is the independent variable (x)

Range is the dependent variable (y)

For each of these you would just put what x and y are equal to

For the Domain you would put:

0<=x<=3

<= is less than or equal to

For the Range you would put

1<=y<=4

The line is a function

a restaurant starts with 10 dozen pieces of cornbread.every order receives 2 piece of cornbread.At the end of their lunch rush,there are 28 pieces of cornbread left.How many orders did the restaurant take?


Twelve less than two-thirds a number is 48.What is the number?

Can you please help me with those two questions and don’t only do 1 if you don’t know the answer dont comment

Answers

Answer:

32 orders

Step-by-step explanation:

10 dozen = 120

120 - 28x2=28x2=56120 - 56=6464 divided by 2= 32

Find the sum.. -3/2 + 8/5 ​

Answers

Answer: 0.1 or 1/10

Step-by-step explanation:

1/10 is the answer you are looking for

Use the formula (n−2)×180◦ figure out the sum of the angle measures of the Trapezoid.

Answers

Answer: 360 degrees

Step-by-step explanation: There are 4 sides in an angle. Substitute that value in for n and u have: (4-2) x180. After doing that, subtract inside the parenthesis and multiply your difference by 180. You should get 360 degrees. I hoped this helped.

Answer:

360!!!!!!!!!!!!!!!!!!!! ;)

Step-by-step explanation:

Sean adds up all the even integers from 2 to 500, inclusive. Julie adds up all the integers from 1 to 250, inclusive. What is Sean's sum divided by Julie's sum?

Answers

Answer:

Sean's sum divided by Julie's sum is 2.

Step-by-step explanation:

The sum of an arithmetic sequence is:

[tex]\frac{n}{2}(2a+(n-1)d)[/tex]

In Sean's sequence, a = 2, n = 250, and d = 2

In Julie's sequence, a = 1, n = 250, and d = 2

[tex]\frac{\frac{250}{2}(2(2)+(250-1)2)}{\frac{250}{2}(2(1)+(250-1)1)}\\= 2[/tex]

The Sean's sum divided by Julie's sum gives the 2.

What is arithmetic sequence?

An arithmetic sequence is sequence of integers with its adjacent terms differing with one common difference.

If the initial term of a sequence is 'a' and the common difference is of 'd', then we have the arithmetic sequence as:

a, a + d, a +  2d, ... , a + (n+1)d, ...

Its nth term is ; T_n = a + (n-1)d

(for all positive integer values of n)

And thus, the common difference is T_{n+1} - T_n for all positive integer values of n

The sum of an arithmetic sequence is;

[tex]= \dfrac{n}{2}[2a + (n-1)d ][/tex]

In Sean's sequence, a = 2, n = 250, and d = 2

[tex]= \dfrac{250}{2}[2(2) + (250-1)2 ]\\[/tex]

In Julie's sequence, a = 1, n = 250, and d = 2 then;

[tex]= \dfrac{250}{2}[2(1) + (250-1)2 ]\\[/tex]

Therefore, the Sean's sum divided by Julie's sum gives the 2.

Learn more about arithmetic sequence here:

https://brainly.com/question/3702506

#SPJ2

When translating the point (3,5) 5 units up and 3 units to the left, we should get:

Answers

Answer:

(0, 10 )

Step-by-step explanation:

5 units up means add 5 to the y- coordinate

3 units left means subtract 3 from the x- coordinate

Translation rule is

(x, y ) → (x - 3, y + 5 ) , thus

(3, 5 ) → (3 - 3, 5 + 5 ) → (0, 10 )

Terrence took a total of 16 pages of notes during 8 hours of class. In all, how many hours will
Terrence have to spend in class before he will have a total of 18 pages of notes in his
notebook? Assume the relationship is directly proportional.

Answers

16 pages/8 hrs

2 pages/ he

18/2=9

18 pages/9 hrs

9 hours is your answer.

what are the names of three planes that contain Point G ​

Answers

Answer:

Points L, J, and K are collinear.

Step-by-step explanation:

brinlest plz

Answer:

ferns,gymnosperms, and flowering plants are all vascular plants

Step-by-step explanation:

The amount that Ronnie earns, E, in terms of the number of hours that he works, h, is shown in the graph below.



What is the constant of proportionality,
E/H, for this situation?
+/-
.

Answers

Answer:

Pay Rate = Constant of Proportionality = E/h

Step-by-step explanation:

Recall this formula:  Total Pay = (Hourly Pay Rate)*(Number of Hours Worked)

Apparently there was a graph associated with this problem; it's up to you to share all instructions and other info that comes with your question.

Rewriting Total Pay = (Hourly Pay Rate)*(Number of Hours Worked), using E for total earnings and h for the number of hours worked, we get:

E = (Hourly Pay Rate)*h

The relevant constant of proportionality is found by dividing E by h:

Pay Rate = Constant of Proportionality = E/h

Congruent Triangle Combination

Answers

Answer:

1) ΔABC ≅ ΔDBC by Side-Angle-Side (SAS)

2) ΔABC ≅ ΔCDB by Side-Side-Side (SSS)

3) ΔABC ≅ ΔDBE by Angle-Angle-Side (AAS)

4) m∠Y = 53°

5) y = 3

6) ΔABC ≅ ΔEDC by Side-Angle-Side (SAS)

7) ΔABC ≅ ΔADC by Angle-Angle-Side (AAS)

8) ΔABC ≅ ΔADC by Side-Angle-Side (SSS)

Step-by-step explanation:

1) Side AC ≅ Side BD      [tex]{}[/tex]        given

Side BC ≅ Side BC      [tex]{}[/tex]            reflexive property

∠DBC ≅ ∠ACB                [tex]{}[/tex]        given

Therefore ΔABC ≅ ΔDBC by Side-Angle-Side (SAS)

2) Side AC ≅ Side BD      [tex]{}[/tex]        given

Side DC ≅ Side BA      [tex]{}[/tex]            given

Side BC ≅ Side BC      [tex]{}[/tex]            reflexive property

Therefore, ΔABC ≅ ΔCDB by Side-Side-Side (SSS)

3) ∠BAC ≅ ∠DEB                [tex]{}[/tex]        given

Side BC ≅ Side BD      [tex]{}[/tex]               given

∠ABC ≅ ∠DBE                [tex]{}[/tex]            vertically opposite angles

Therefore, ΔABC ≅ ΔDBE by Angle-Angle-Side (AAS)

4) ΔXYZ ≅ ΔABC                [tex]{}[/tex]        given

m∠A = 44°, and m∠C = 83°

m∠B = 180 - (44 + 83) = 53°                [tex]{}[/tex]   Sum of angles in a triangle

m∠Y = m∠B = 53°                [tex]{}[/tex]   Corresponding Parts of Congruent Triangles are Congruent (CPCTC)

5) Given that Triangle GHK is congruent to Triangle TZK

GH ≅ XT, KG ≅ KT, and HK ≅ ZK by the definition of congruency

Therefore, GH = 4 = XT = 3y - 2

4 = 3y - 2

3y - 2 = 4

3y = 4 + 2 = 6

y = 6/2 = 3

y = 3

6) Side BC ≅ Side EC      [tex]{}[/tex]           given

Side AC ≅ Side DC      [tex]{}[/tex]              given

∠ACB ≅ ∠DCE                [tex]{}[/tex]            vertically opposite angles

Therefore, ΔABC ≅ ΔEDC by Side-Angle-Side (SAS)

7) ∠BAC ≅ ∠DAC                [tex]{}[/tex]        given

∠ADC ≅ ∠ABC                [tex]{}[/tex]            given

Side AC ≅ Side AC      [tex]{}[/tex]               reflexive property

Therefore, ΔABC ≅ ΔADC by Angle-Angle-Side (AAS)

8) Side AD ≅ Side BC      [tex]{}[/tex]           given

Side AC ≅ Side AC      [tex]{}[/tex]               reflexive property

Side AB ≅ Side DC      [tex]{}[/tex]                given that the included angle between the two legs side AD and side AC and side AC and side BC are both acute, the third sides side AB and side DC are equal

Therefore, ΔABC ≅ ΔADC by Side-Angle-Side (SSS)

who can ask me a question about addition?

Answers

If x+1,000=4 what’s your answer

What is the slope of the linear function?

Answers

Answer:

the slope is [tex]\frac{7}{4}[/tex]

Step-by-step explanation:

Given: 4y - 7x = 10; solve y

4y - 7x = 10; add 7x to both sides to isolate the 4y variable

4y = 7x + 10; now divide by 4

y = [tex]\frac{7}{4}[/tex]x + [tex]\frac{10}{4}[/tex]; reduce the fraction

y = [tex]\frac{7}{4}[/tex]x + [tex]\frac{5}{2}[/tex]; the slope is

Answer:

m= 7/4

Step-by-step explanation:

Angie and Kenny play online video games. Angie buys 1 software package and 1month of gameplay. Kenny buys 1 software package and 2 months of game play. Each software package costs ​$30. If their total cost is ​$90​, what is the cost of one month of gameplay?

Answers

Answer: $10

Step-by-step explanation:

Angie buys = 1 software package and 1month of gameplay.

Kenny buys = 1 software package and 2 months of game play.

Cost of each software package = $30. Total cost = ​$90​

The total cost is the addition of what Kenny and Angie bought. This will be:

(1 SF + 1 G) + (1 SF + 2 G) = 90

where,

SF = software package = 30

G = game

(1 SF + 1 G) + (1 SF + 2 G) = 90

30 + 1G + 30 + 2G = 90

60 + 3G = 90

3G = 90 - 60

3G = 30

G = 30/3

G = 10

One month of game play cost $10

(HELP!!!) Please Factor Completely:
9x^2y^2-27x^2y-72y^2+216y

Answers

Answer:

Can u space them out so i know which ones are exponents

Step-by-step explanation:

Mr. Bearfield deposited $3,500 in a new investment account. -The investment pays 8% interest compounded annually on this account. -Mr. Bearfield did not make any additional deposits or withdrawals. What is the balance of the account at the end of three years?

Answers

Answer:

In 3 years, you will have $4,408.99

Step-by-step explanation:

The formula used in the compound interest calculator is A = P(1+r/n)^(nt)

A = the future value of the investment

P = the principal investment amount

r = the interest rate (decimal)

n = the number of times that interest is compounded per period

t = the number of periods the money is invested for

Find the y-intercept of a line that passes through the point (-5,-6) and has a slope of 2.

Answers

Answer:

The y intercept is 4

Step-by-step explanation:

Given:

-Given point: (-5,-6)

-Slope of 2

1) Put the equation into point-slope form y - y1 = m(x - x1)

With the given, we can plug it all in using this formula!

-y1 = -6

-x1 = -5

m = 2

(you would change these negative numbers into positives because the equation shows them being subtracted! remember that two negatives make one positive!)

y+6= 2(x+5)

2) Simplify

y+6= 2(x+5)

y+6=2x+10

y=2x+4

With y=2x+4, set x to 0 because the y intercept is where x is equal to 0 and you get 4!

I will give Brainlyest to the first person



A family gathered 12 seashells from the beach bringing the total number of seashells in their collection to 86
Which equation can be used to find, x, the number of seashells in the collection before the 12 were added?

Answers

Answer:

The first selection is the answer.

Step-by-step explanation:

x+12=86

The equation that can be used to find x is x + 12 = 86

A linear equation is of the form:

y = mx + b;

where y, x are variables, m is the slope of the line and b is the y intercept.

Let x represent the number of seashells in the collection before the 12 were added.  Hence to find x, we use the equation:

x + 12 = 86

The equation that can be used to find x is x + 12 = 86

Find out more at: https://brainly.com/question/13911928

Given: 3x + 2y + 7 = 5x +3y +10

Prove: m = -2

please help im very confused :)
also make sure to include the statements and reasonings as shown in the screenshot!

Answers

Subtract 2y from both sides (property of subtraction)
3x + 7 = 5x + y + 10
Subtract 3x from both sides
7 = 2x + y + 10
Subtract 10 from both sides
2x + y = -3
Subtract 2x from both sides
y = y = -2x -3
m = -2

Answer:

See Below.

Step-by-step explanation:

1) Given:

[tex]3x+2y+7=5x+3y+10[/tex]

2) Subtraction Property of Equality (subtract 2y from both sides):

[tex]3x+7=5x+y+10[/tex]

3) Subtraction Property of Equality (subtract 5x from both sides):

[tex]-2x+7=y+10[/tex]

4) Subtraction Property of Equality (subtract 10 from both sides):

[tex]-2x-3=y[/tex]

5) Symmetric Property:

[tex]y=-2x-3[/tex]

6) Slope-intercept form:

[tex]y=mx+b\text{, where $m$ is slope and $b$ is y-intercept.}[/tex]

7) Substitution:

[tex]m=-2[/tex]

Which graph represents a proportional relationship?

Answers

Answer:

If the relationship between two quantities is a proportional relationship, this relationship can be represented by the graph of a straight line through the origin with a slope equal to the unit rate. For each point (x, y) on the graph, ž is equal to k, where k is the unit rate. The point (1, k) is a point on the graph.

NEED HELP ASAP
Given: (DE) is a midsegment of triangle ABC.

Find the value of x and y.

What is the length of (AC)?

Answers

Answer:

X=13. y=5 AC=20

Step-by-step explanation:

To do this we first have to find the value of x... giving the fact that DE is a mid segment, We know that the length of BC is double the length of DE this means that the length of BC equals 16. So, to equal 16 x will have to equal 13 so 13 + 3 = 16. Now we will find the value of y. We do this by looking at the length of ae and ec. AE equals EC so now that we know x equals 13 we can do 13 minus 3 equals 10 for AE. since EC has to equal 10 we can do 10 minus 5 which equals 5. We now know that y equals 5. We can now add this all up to find the length of AC. We would do 10 + 10 = 20. Hope this helps!

The length of AC from the diagram is 25

To get the value of x and y, we will use the similarity theorem of a triangle

BC = 2DE

x + 3 = 2(8)

x + 3 = 16

x = 16 - 3

x = 13

Hence BC = 16

From the given figure;

AE/DE = AC/BC

x-3/8 = (x-3+y+5)/x+3

10/8 = 15+y/13

130 = 8(15+y)

130 = 120 + y

y  = 10

Get the length of AC

AC = 13-3+10+5

AC = 25

Hence the length of AC from the diagram is 25

Learn more here: https://brainly.com/question/23961310

Evaluate each value expression for the given value of x: x-5 , x - =22
pls fast

Answers

Answer:

-18

Step-by-step explanation:

-18

brainlest please

Use substitution to show that 9+6(10-7x) is equivalent to 69-42x.

.

Answers

Answer:

hope this helps

Step-by-step explanation:

9+6(10-7x)

9+60-42x

69-42x

Help please I will give Brainliest!!!!
Josiah invested $96,000 in an account paying an interest rate of 3.5% compounded continuously. Assuming no deposits or withdrawals are made, how long would it take, to the nearest year, for the value of the account to reach $153,400?

Answers

The number of years it will take for the value of the money in the account to reach $153,400 would be = 17 years.

What is simple interest?

Simple interest is defined as the amount of money that is received as an extra cash based on an investment made in an account.

The principal amount of money invested= $96,000

The rate of interest = 3.5%

The total interest on the principal amount = $153,400- $96,000 = $57,400

The time for this investment= ?

Using the formula for simple interest= p×T×R/100

57,400 = 96,000 ×T× 3.5 /100

Make T the subject of formula;

T = 57,400×100/96,000×3.5

T = 5740000/336000

T = 17 years (approximately)

Learn more about simple interest here:

https://brainly.com/question/25793394

#SPJ1

The table shows the results of a survey of 200 randomly selected people on whether they like watermelon,
cantaloupe, or both.
Which is the marginal relative frequency for the people who do not like cantaloupe?

A. 25/91
B. 66/200
C. 91/200
D. 66/91

Answers

Answer:

C

Step-by-step explanation:

Marginal relative frequency for the people who do not like cantaloupe is 0.455

or

91/100

Answer:

C is correct

Step-by-step explanation:

Can somebody plz answer these 3 questions correct!!! Help
(WILL MARK BRAINLIEST

Answers

it increases 3° each hour

3*2= 6

6° after 2 hours

3*3= 9

9° after 3 hours

3*6= 18

18° after 6 hours

6, 9, then 18. Just add 3 every time because it is asking how much it increases. For the first one you multiply it by 2 (2h) which got 6, for the second you multiply it by 3 (3h), and for the last one you multiply it by 6 (6h) which got 18.
Other Questions
need answers asap1. risk factorsa. refers to being in good shapeb. the process and function of the bodyc. social needs, social behaviors, and social problems d. traits that increase the possibility of developing an illness or disease2. diabetesa. a disease in which the body produces and/or uses insulin in an inefficient manner, causing a high level of glucose (sugar) in the bloodb. a disease in which the body does not produce and/or use glucose in an effective manner, causing a high level of cholesterol (fat) in the bloodc. a disease in which the body produces too much insulin, and causes low levels of glucose (sugar) in the bloodd. a disease in which the body does not produce and/or use insulin in a effective manner, causing a low level of glucose (sugar) in the blood 3. flexibility a. the ability of a tendon to move through its full range of motionb. the ability of a joint to move through its full range of motionc. the ability of a muscle to move through its full range of motiond. the ability of a ligament to move through its full range of motion4. cardiovascular fitnessa. a term used to refer to the heart, lungs, and blood vessels. Cardio means heart and vascular means the blood vesselsb. the term used to describe the bodys ability to utilize oxygen at a maximal level of efficiencyc. the state of being free from disease or illnessd. traits that increase the possiblity of developing an illness or disease 5. physiologicala. the processes and functions of the bodyb. the processes of the mind c. social needs, social behaviors, and social problemsd. traits that increase the possiblity of developing an illness or disease 6. _____ is/are a/an aspect(s) that can set physical limits to our fitness potential a. heredityb. heart diseasec. environmentd. both a and c7. a condition in which the pancreas does not produce and/or utilize enough insulin to meet the bodys needsa. type 1 diabetes b. type 2 diabetesc. pancreatitis d. none of the above8. health-related factors refer to:a. cardiovascular efficiency b. muscular strength and endurance c. flexibility, and body composition d. all of the above9. skill-related factors refer to:a. agility and reaction timeb. cardiovascular efficiency c. aerobic endurance d. both a and c10. _____ is defined as the greatest amount of force that a muscle group can exert in a single efforta. muscular endurance b. muscular strength c. flexibility d. range of motion Geographers use two key questions every day. When using these two key questions to study the migration of birds, a geographer would ask "where are the birds going?" and "__________?" Which detail is relevant for an argument to make drivers who run through red lights pay a fee? Even though everyone knows that going through red lights is illegal, they do it anyway. The current fines, which are being used to maintain roads, are generating a lot of money for the city. People do not feel safe on the street because they know drivers are not stopping at red lights. The current fines are not high enough to discourage drivers from going through red lights. simply parmanent tissue real life application please help it's for my project Question 8 (1 point)Choose the correct form of the verb in the preterite. 1. Yo _________ (organizar) bien las cosas en la maleta. aorganiz borganizaste corganiz dorganic Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA