Find the 12th term of the geometric sequence 2, 10,50,...

Answers

Answer 1

The first term of the geometric sequence is 2 and the common ratio is 5. So, the 12th term of the geometric sequence is 97656250.

Geometric sequence:

Important information:

Given geometric sequence is 2, 10,50,...

We need to find the 12 th term.

In the given geometric sequence, the first term is [tex]a=2[/tex] and the common ratio is [tex]d=\dfrac{10}{2}=5[/tex].

The nth term is:

[tex]a_n=ar^{n-1}[/tex]

Where [tex]a[/tex] is first term, [tex]r[/tex] is common ratio.

The 12th term is:

[tex]a_{12}=2(5)^{12-1}[/tex]

[tex]a_{12}=2(5)^{11}[/tex]

[tex]a_{12}=97656250[/tex]

Therefore, the 12th term of the geometric sequence is 97656250.

Find out more about 'Geometric sequence' here:

https://brainly.com/question/17321783

Answer 2

Answer: 97656250.

Step-by-step explanation:

dm


Related Questions

HELP!! Kate gets a paycheck twice a month. Every month, a total of $345.67 is deducted from her paychecks for taxes. If she has received 7 paychecks so far this year, which best represents the total effect the taxes have had on the amount she has earned??
–$2,419.69
–$1,209.85
$1,209.85
$2,419.69

Answers

The answer is 2,419.69

Answer:

d

xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

mZ1 = 6x and mZ3 = 120 Find the value of x when p is parallel to g.

Answers

Answer:

20

Step-by-step explanation:

m Z1=mZ3 = 120

120÷6=20

X=20

what is 2/5 of 110??

Answers

Answer:

44

Step-by-step explanation:

Remember that "of" in math means the same as multiplication.

2/5 * 110 = 44

Answer:

44

Step-by-step explanation:

2/5×110

of in mathmatics means multiplication

Therefore, the answer is 44

Simplify the expression.
4² . 4². 4²

Answers

Answer:

16.16.16

Step-by-step explanation:

please let me know if I'm wrong

but I learned that you don't do 4×2 you have to multiply 4 twice by itself so it would be 16 because 4×4=16

what are the domain and the range ​

Answers

Answer:

Domain 1,3,5,7,9,11

Range 5,6,7,8,9,10

Drag the tiles to the correct boxes. Not all tiles will be used.
Match each equation with a value of x that satisfies it.

Answers

Answer:

2, - 3, 18

Step-by-step explanation:

1). [tex]\sqrt[3]{1-x}[/tex] = - 1

( [tex]\sqrt[3]{1-x}[/tex] )³ = ( - 1)³

1 - x = - 1 ⇒ x = 2

2). [tex]\sqrt{x^2 +7}[/tex] = 4

( [tex]\sqrt{x^2 +7}[/tex] )² = 4²

x² + 7 = 16 ⇒ x = ± 3 ; x = - 3

3). [tex](x-2)^{\frac{1}{4} }[/tex] = 2

[tex][(x-2)^{\frac{1}{4} }] ^{4}[/tex] = [tex]2^{4}[/tex]

x - 2 = 16

x = 18

one step equations, solve:
-6=y+2

Answers

Well I don’t know if you want to know how to solve it but y = -8
y=-8 are u in middle school or something

Write the equation of the line through the given points (3, 5) and (-3,-3) in the three different forms.

Point-Slope Form
Slope-Intercept Form
Standard Form

Answers

Answer:

y-5=1/3(x-3)

y=1/3x+4

no standard form

Step-by-step explanation:

Seth's family plans to drive 220 miles to their vacation spot they would like to compare the drive in 4 hours

Answers

Answer:

i think the answer is 55.

Step-by-step explanation:

220 divided by 4 = 55.

Answer:

i don t think i completely understand but they drive 55 miles every hour

Step-by-step explanation:

if this is not your question plz clarify so i can help :)

Select the better deal in the pair. Then give the unit rate for the better deal.

$56/25 gal
or
$32.05/15 gal

Answers

Answer:

The better deal is $32.05/15 gal

Step-by-step explanation:

Divide:

56/25

=2.24

32.05/15

=2.13666667

=2.14

The second one is a better deal

3. Formulate 900 lbs of a 35% CP ration using Soybean Meal (46% CP) and Oats (12% CP). How many pounds of soybean meal will be used? How many pounds of oats will be used?

Answers

Answer:

The amount of Soyabean = 608.82 pounds.

The amount of Oats  = 900-608.82 = 291.18 pounds.

Step-by-step explanation:

Given that the Soybean Meal has 46% CP and Oats has 12% CP.

The total amount of ration is 900 lbs of 35% CP.

Let x pounds of Soyabean has been used, so,

the amount of Oats = 900-x lbs.

The CP amount in 900 lbs mixture will be equal to the sum of CP amounts in x lbs Soyabean and 900-x lbs Oats, i.e

35% of 900 = 46% of x + 12% of (900-x)

[tex]\Rightarrow \frac{35}{100}\times 900=\frac{46}{100}\times x+\frac{12}{100}\times (900-x)[/tex]

[tex]\Rightarrow 35\times 900 = 46x + 12\times 900 - 12 x[/tex]

[tex]\Rightarrow 34x= 900(35-12)[/tex]

[tex]\Rightarrow x = (900\times 23)/34[/tex]

[tex]\Rightarrow x = 608.82[/tex] lbs.

So, the amount of Soyabean = 608.82 pounds.

The amount of Oats  = 900-608.82 = 291.18 pounds.

HELP!!
Select the correct answer.
Scientists studying biodiversity of amphibians in a rain forest have discovered that the number of species is decreasing by 2% per year. There are currently 74 species of amphibians in the rain forest. Which logarithmic function models the time, , in years, it will take the number of species to decrease to a value of n?

Answers

Answer:

Option A: f(x) = log_0.98 (n/74)

Step-by-step explanation:

We are told that that the number of species is decreasing by 2% per year.

Thus, number of species each year is 98% or 0.98 of number of species the previous year. .

We are told that there are currently 74 species of amphibians in the rain forest.

Thus, n/74 will represent a fraction of the current number of species.

Thus, the logarithmic function that models the time can be written as;

f(x) = log_0.98 (n/74)

Answer:

A. f(n) = log0.98(n/74)

(got it right on edmentum)

for your assurance please look at the picture below↓

Michelle has 3
3 cups of cereal. A serving of cereal is cup. How many servings of cereal does Michelle have?

Answers

Answer: 4/5

Step-by-step explanation:

Add, subtract, multiply or divide all for of these numbers to get a result equal or close to 51.

Numbers: 7, 8, 5, 6

You cannot add any new numbers. Please help i've been stuck on this for an hour now. :(​

Answers

7*8-6+5=55

6*5+7+8=45

5*7+8+6=49

I will continue in the comments

A high school coach needs to buy new athletic shorts for 15 members of the basketball team. The coach must spend less than $200 and needs to determine how much he can spend per pair of shorts.

Answers

Answer:

Well i dont know the answers but it is 13.33

Step-by-step explanation:

He can spend 13 dollars per pair of shorts

can someone please help me with please and thank you

Answers

Answer:

47 DEGREES

Step-by-step explanation:

AOB + BOC = 180 (STRAIGHT LINE)

THEREFORE

(3x + 124) + (6x + 29)  = 180

9x + 153 = 180

9x = 27

x = 27/9

x = 3

THEREFORE

6x + 29

(6*3) +29

18 + 29

47 DEGREES = BOC

what is 0.969696 repeating as a fraction?

Answers

Answer:

[tex]\frac{32}{33}[/tex]

Brody had his computer repaired at Store A. His bill was:
Initial Repair Cost = $1,200
Sales Tax of 6 percent = $72.00
Gratuity of 15 percent
Explain how you would calculate the gratuity for the
services provided.

Answers

Answer:

Add the repair cost and tax to get the total amount. Then multiply the total amount by 0.15 to find the gratuity.

Step-by-step explanation:

This is sample response

The gratuity for the services provided is $190.8 if the Initial Repair Cost = $1,200, the Sales Tax of 6 percent = $72.00, and the Gratuity of 15 percent.

What is the percentage?

It's the ratio of two integers stated as a fraction of a hundred parts. It is a metric for comparing two sets of data, and it is expressed as a percentage using the percent symbol.

It is given that:

Brody had his computer repaired at Store A. His bill was:

Initial Repair Cost = $1,200

Sales Tax of 6 percent = $72.00

A gratuity of 15 percent

Total cost = 1200 + 72 = 1272

The gratuity for the services provided = 0.15x1272 = $190.8

Thus, the gratuity for the services provided is $190.8 if the Initial Repair Cost = $1,200, the Sales Tax of 6 percent = $72.00, and the Gratuity of 15 percent.

Learn more about the percentage here:

brainly.com/question/8011401

#SPJ2

PLEASE HELP I ONLY HAVE 17 MORE MINUTES!!!!

Answers

The answer is B- k= 1/6

Answer:

A. 6

Step-by-step explanation:

6/1 = 6

Tell me a fun fact about horses I will give brainliest to whoever tells me one I don’t know (I have been riding for 12 years) so I know a lot about horses also don’t answer this just for the points or else you will get reported

Answers

Answer:

Horses can sleep both lying down and standing up.

Step-by-step explanation:

If a train travels 1,600 km in 16 hours, how fast is it moving?

Answers

Answer:

100km per hour

Step-by-step explanation:

16/16= 1 hour

1600/16= 100

Convert 2x + 37y = 18 to point-slope form.

Answers

Answer:

y = -2/37x + 18/37

Step-by-step explanation:

2x + 37y = 18

-2x            -2x

37y = -2x + 18        (Divide 37 on both sides)

Y = -2/37x + 18/37

what is a tanslation in math

Answers

Answer:

A translation moves a shape up, down or from side to side but it does not change its appearance in any other way. Translation is an example of a transformation. A transformation is a way of changing the size or position of a shape. Every point in the shape is translated the same distance in the same direction

Step-by-step explanation:

0.62, 0.38, 0.35, 0.49, 0.1, 0.21, 0.54, 0.6, 0.51, 0.28 Least to Greatest *

Answers

Answer:

0.25

Step-by-step explanation:

Answer:

0.1, 0.21, 0.28, 0.35, 0.38, 0.49, 0.51, 0.54, 0.60, 0.62.

the value of y varies directly with x. when y = 7.5, x = 5. what is the value of y when x = 80?.

Answers

Answer:

Step-by-step explanation:

120 = y. the ratio is 3:2

80/2 is 40

40 times 3 is 120

120:80 = 3:2

Which statement is true about 1?
A. It is a prime number.
B. It is a composite number.
C. It is a whole number that is neither prime nor composite.
D. It is not a whole number.
Please dont be greedy and answer the question saying something like "i have no idea" Thanks

Answers

Answer:

C. It is a whole number that is neither prime nor composite.

Step-by-step explanation:

A prime number is a number that has two factors: one and another number. Thus, since 1 only has one factor (itself), it cannot be a prime number.

However, a composite number must have more than two factors, which 1 doesn't have either.

Since 1 is a whole number (not a decimal or fraction), and it is neither prime nor composite, the answer would be C.

Have a nice day!

Answer:

C!

Step-by-step explanation:

hope it helped

which pair of numbers shows an integer and its opposite?
1 point
A.7 , -7
B.7 , 1/7
C.-7 , 1/7
D.1/7 , 1/7

Answers

The answer is A. 7 , -7 because and integer is a whole number not a fraction. Answers B, C, and D all have fractions.
The answer is a because the absolute value of -7 is 7 therefore the answer to the question is simply a

Percy planted 4 tomatoes plants the first week of spring. He planted 11 tomato plants the second week of spring. What is the percent increase in the number of plants Percy planted?

Answers

Answer:

[tex]\%\ Increase = 175 \%[/tex]

Step-by-step explanation:

Given

[tex]Initial = 4[/tex]

[tex]New = 11[/tex]

Required

Determine the percentage increase

This is calculated using the following formula:

[tex]\%\ Increase = \frac{|New - Initial|}{Initial} * 100\%[/tex]

[tex]\%\ Increase = \frac{|11 - 4|}{4} * 100\%[/tex]

[tex]\%\ Increase = \frac{|7|}{4} * 100\%[/tex]

[tex]\%\ Increase = \frac{7}{4} * 100\%[/tex]

[tex]\%\ Increase = 1.75 * 100\%[/tex]

[tex]\%\ Increase = 175 \%[/tex]

PLEASE HELP! ILL GIVE YOU BRAINLIEST!

Answers

Answer:

A.

Step-by-step explanation:

It is the final step when doing math like that.

4. A map has a scale of 1 inch = 100 miles. The distance between two cities is 7.25 inches. If a car travels
50 miles per hour, about how long will it take to get from one city to another?
hours

Answers

Answer:

14.5 hours/14 hours 30 minutes

Step-by-step explanation:

The distance between the two cities is 7.25•100=725 because you multiply the scale distance by the scale.The number hours is 725/50=14.5 hours because you divide the distance by 50 (the miles per hour).
Other Questions
hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date. Est ce que quelqu'un pourrait bien corriger mon expression ecrite ou donner son avie dessus s'il vous plait