Can someone pls help me with these?

Can Someone Pls Help Me With These?

Answers

Answer 1

Answer:

They voted in June to charge pupils a fee to participate in sports and music activities.

2. According to last night's newspaper,

Vaccinations are becoming increasingly accessible.

3. We purchased a secondhand couch and chair and had them delivered.

fixed such that it seems to be brand new

4. Janine informed her mother that she needed to purchase

a little more milk

5. Dogs are permitted at restaurants in France.

6. Lewis sobbed for some minutes after scraping his knee, but it soon stopped.

7. Marianne confided in Jenny that she was concerned about

Her mother's ailment

8. In my high school, you didn't have to receive all A's to be considered successful; you simply had to put in the effort.

your capability

9. Maria adorned Ann's hair with ribbons after braiding it.

Explanation:

There it is pharaphresed

Answer 2

1. In June, they voted to charge a fee for students to

participate in sports and music programs.

2. In last night's newspaper, it states that

vaccinations are becoming more widely available.

3. We bought a used couch and chair and had it

repaired so it looks like new.

4. Janine told her mother that she needed to buy

more milk.

5. In France, they allow dogs in restaurants.


Related Questions

Like magic a crepe forms

Answers

You're a Wizard Harry

Answer:

wow

Explanation:

i'm confused, did you forget a pic?

_moment when I heard / was accepted to the university, but I know I was very excited.
I don't remember the
a. precise
b.fundamental
c. vibrant
d. paramount
A

Answers

Answer:

A.

Explanation:

The correct word to complete the given sentence would be 'precise.'

The term precise is derived from the Latin word praecis which means 'cut short.' The word precise means something that is marked with accuracy and exactness.

The speaker in the given statement is asserting that he/she doesn't remember that exact moment when he/she heard about being accepted to the university, but remembers being excited upon hearing the news.

Therefore, option A is correct.

where is this story taking place?

Carrie walked through the doors of the building with her package in hand. There was no line so she walked right up to the
counter. She handed the man her package. He placed it on a creaky scale, turned a knob, and adjusted some weights.
"One pound and four ounces," He said, writing down the number on a ledger. He did some multiplication on a notepad and
looked up at her from behind his glasses. Then he asked, "It's going to Boston?" She nodded." That'll be 44 cents." She
opened her change purse and removed the coins, placing them on the counter." Thank you kindly, Sir," she remarked
before departing

Answers

Answer:

Post office

Explanation:

I'm assuming that the post office mainly handles packaging and weights, in order to ship certain items that can't typically be delivered through traditional mailbox methods. Hope this helps :)

Please help with these grammar questions:

The caravan was tired of ""travelling for long hours"" in the desert.

Gerundial phrase
Participle
Adverb
Participle adjective

I try to reach any person ""who has some advance knowledge of my subject"".

Adjective phrase
Adverb phrase
Adverb clause
Adjective clause

Since time immemorial, female segment of the society is oppressed because of male chauvinism.

Simple sentence
Complex sentence
Compound sentence
Compound complex sentence

He replied ""he was the boss of the entire crew."" The underlined part of the sentence

Adverb clause
Adverb phrase
Adjective clause

The ""divide"" among real brothers was heart breaking.

Noun
Verb
Adjective
Adverb

The mother set the table for her children on last Friday.

Simple Present
Simple Future
Simple Past
Past Perfect

The letter brought a tiding ""for"" the candidate as he had been selected.

Coordinate Conjunction
Adjective
Adverb
Preposition



I can give you the details of the incident ""but"" I fear you won’t get it.

Adversative
Co relative
Illative
Sub ordinate

The weather ""has been"" getting slightly warm today.

Linking verb
Modal verb
Helping verb
State verb

Answers

Answer:verb is slightly

Explanation:

Which of the following sentences uses the word desolate correctly? a. Most people see the desert as a desolate place offering only hardship and discomfort. b. The crowds of people made the fairground feel desolate.

Answers

Answer:

a) most people see the desert as a desolate place offering only hardship and discomfort

Explanation:

Identify Two possible reasons for unemployment​

Answers

Answer:

can't work and can't get a job

ESSAY, COMPLETE THE FULL ESSAY, ITS NOT HARD. LOOK AT THE LINKS. I NEED ALL HELP ASAP, PLEASE READ THE INSTRUCTIONS AND WRITE THE FULL ESSAY.

Answers

One time I had a party at my house. I invited all my friends and family and we had a blasts. It was a special day because o haven’t seen my friends in a while and I thought it was a perfect time. I think it was special because I missed them so much and they looked really different. We laughed, talked, played games, order McDonald’s, and it was the best day of my life. It was me, Mariah, Tyler, Sarah, Maddison, and some family members. It made me feel very happy and proud of everything and it made me feel loved. I think it was funny when Mariah spit out her gum and it landed on the dog so the dog was funny when the dog peed on my friends foot. I still laugh about it today.

How did Jim Crow affect life in Montgomery?

Answers

Starting the Montgomery Bus Boycott. the Supreme Court after 381 days finally listed segregation on public buses unconstitutional. "the Montgomery Bus Boycott helped eliminate early barriers to transportation access."

What conflicts (internal AND external) do you see developing in the story, the giver? Cite evidence from the Chapters 1-5 to support your response.

Answers

Answer: Some conflicts in The Giver include an external conflict between Jonas and his society, an inner conflict of Jonas versus himself, and various external conflicts with others in his society as Jonas gains information about the past that they lack.

Explanation:

hello! I hope your having good day now I have a question, what is a good song that you love to listen to? And that you recommended to me?

Answers

Answer:

A good song that I love to listen to would be My Tears are becoming a sea. And I would recommended you to listen to it! :) Btw your amazing okay?

Explanation:

Which one is right grammatically:

Every player should feel proud of (his/their) team.

Answers

Answer:

their?

Explanation:

What is the best way to find a particular word on an Internet page?
by using a Web address
by clicking the Like button
by using Find or Find on this Page feature

Answers

Answer:

by using Find or Find on this Page feature

Explanation:

You can also click control+f to full up a fast "find" bar.

Help plsssssssssssssssssssssss thanks so much ㋛

Answers

Answer:

A

Explanation:

Read the excerpt from "Lessons of Dr. Martin Luther King, Jr."

Economic pressure is the only language the growers speak, and they are beginning to listen.

Please, boycott table grapes.
Will give brainliest
Which persuasive element does Chavez use in this passage?

using words to connect with the audience
using facts to support an argument
stating a clear purpose or goal
creating a strong introduction

Answers

Answer:

The answer is C. stating a clear purpose or goal

Explanation:

I did the test on edge 2021

Answer:

C: Stating a clear purpose or goal.

Explanation:

Same as the guy above me.

What is an example of self concept?

Answers

Answer:

example: beliefs such as "I am good friend" or "I am a kind person" are part of an overall self-concept.

Explanation:

the boy sat on his bed , crying (compound)

Answers

Answer:

The boy sitting in bed cryed

The boy sat on the bed crying

What are the most important parts of a multimedia presentation? How do we organize and plan a presentation? What are some suggestions or strategies we should utilize when preparing to give a presentation? *

Answers

Answer:

1. There are seven elements - text, graphics, photographs, sound, animation, video and interactivity - that can be included in a multimedia presentation. A TRUE multimedia presentation combines all of these elements.

2. Frame the need that the product, service, or idea addresses.

Describe the need in more detail.

Describe the ways in which your solution addresses the need.

Describe the benefits of buying in to your solution.

Get agreement on a next step.

3. Consider the audience and what they already know. ...

Visualize the stage and setting. ...

Determine your objectives. ...

Build your presentation. ...

Practice. ...

Confront nervousness. ...

Hook your audience. ...

Speak clearly.

Explanation:

Type the verb or verb phrase in this sentence. Press Enter. On Wednesday, the jury will have been meeting for a month.​

Answers

Answer: “will have been”. Is the verb phrase

Explanation:

How many combination of air
heads are there.

Answers

Over 16 different flavors

Which of these are characteristics of a video news report?

visual modality
auditory modality
written text
facts or information
hands-on interaction
real-time reporting

Answers

Answer:

A,B,D,F

Explanation:

correct on edg

A video news release (VNR) is a video piece that appears to be a news story but was produced by a public relations firm, advertising firm, marketing company, corporate, or government organization.

The characteristics are Options A, B, D, and F.

What are VNR's detractors?

VNR critics have labeled the method dishonest or a propaganda tactic, especially when the segment is not identified as a VNR to the audience.

VNR producers disagree, comparing their use to that of a video press release and pointing out that editorial judgment on the worthiness of a VNR's content, in part or whole, remains in the hands of journalists, program producers, and others.

The Federal Communications Commission in the United States is now investigating VNRs.

For more information about VNR refer to the link:

https://brainly.com/question/20613539

#SPJ2

c : the place where you play games like tennis.​

Answers

Answer:

Badminton. Just like Tennis, Badminton is a game that requires rackets.

Pickleball. Of course our favorite choice Pickleball

Squash. Squash is all about playing indoors or somewhere enclosed.

Beach Tennis.

Racquetball.

Soft Tennis.

Platform Tennis.

Basque Pelota

Which of these best explains why a suspect who is exonerated is let out of
jail?
A. The prefix ex-means "innocent."
B. The prefix ex-means "out of."
C. The prefix ex-means "moral."
D. The prefix ex-means "law."

Answers

Answer:

The answer is B

19 Answer: Co-

Explanation:

Who is Jim Trainum?
Serial Podcast Season 1: Episode 8

Answers

Answer:

the guy with a hat ??

Explanation:

i think so look this is for important questions ONLY!

Compare and contrast the imagery of the sea every time the fishermen speaks to the fish. How do these setting description contribute to the theme of the story?

Answers

Answer:

The setting descriptions represent how bad and greedy the wishes of the fisherman's wife are, every time he goes back to the flounder and asks for another luxury.

Explanation:

hope this helped<3

'I have never seen such a community spirit,' said the tourists

In reported speech​

Answers

Answer: He said that he has never seen such a beautiful sunset and he wants to to watch the sun go down , sipping a cup of coffee with few smokes

Explanation:

Which statement best evaluates the effect of adding descriptive detail in the
second version of the passage?
Passage 1:
"Ready or not, here I come! I walked around, checked behind the
curtains, and then picked up each couch cushion. I tried not to laugh
when I heard a noise from behind the couch. Then I walked behind the
couch. "There you are!" Jaxon ran straight to my arms.
Passage 2:
"Ready or not, here I come." Walking slowly around the living room,
glanced behind the curtains and then playfully peeked under each
couch cushion. "Wow, Jaxon is such a good hider! I'll never find him,"
said aloud, trying to keep my laughter to myself. A giggle escaped
from behind the couch. 'I wonder if he could be hiding behind here.
With that, I jumped around the couch and exclaimed, "There you are!"
Thrilled to be found, Jaxon jumped up and ran straight to my arms.

Answers

Answer:

D: it makes the passage more interesting by enabling the reader to visualize the scene.

Answer:

D

Explanation:

Which argument is the best example of circular reasoning?
A. Oil painting is the cool new trend you just have to take part in.
B. Cats are the best pets, and only difficult people think otherwise.
C. You must make dinner tonight because it's clear that you should.
O
D. My brother is class president, so naturally I should be treasurer.

Answers

C is the best example of circular reasoning

Need help please, it's urgent. about organizational structure of prose. Thank you.

Answers

It’s about wolves, your answer should be right.

Pls pls help!!!! With these two questions!!! Thank you if your able to answer! :))))

Answers

Explanation:

the second question) despite everything she still believed that they'd get through this. the story of Anne tells us how to to never lose hope.

this is reading misplaced modifiers if your good at this help me quick

Answers

Kayla watched the dogs play in her pyjamas.

Other Questions
what is the mRNA in TACCGGATGCCAGATCAAATC? What is the mean for the data shown in the dot plot? 4 5 6 10 In a sequence of numbers, a4=3, a5=5, a6=7, a7=9, and a8=11.Which recursive rule can be used to find the nth term of the sequence, an? a1=3; an=an1+2 a1=3; an=2an1 a1=3; an=2an1 a1=3; an=an1+2 What are two elements of a governments foreign policies?promoting democracy within the countrys bordersforming military alliances with other countriesstrengthening international trade relationsproviding health care to citizens of the countryimproving the education standard in the country Need help real quick haha plsNumbers as answers only, no variables pls. thank u! :) Plz help is is my last 3 questions I will give you 50 points for helping I need help this is needed by tomorrow morning :) How did the protests change during the 1960s?Choose all correct answers.Women and Mexican Americans joined other groups to protest inequality.College students organized more silent, peaceful marches than they had in earlier years.Riots in major cities led to destruction and death. Why the allied powers pinpointed Germany at the person guilty for starting world war 1 How did the mandates after World War I create conflict in Southwest Asia? A. Jews and Arabs were given their own separate mandates. B. Mandates were forced to adopt French or English as an official language. C. Mandates were required to adopt democratic forms of government. D. The borders of mandates often ignored ethnic and religious divisions. I have of an hour to finish 6 homework assignments. How much time can I spend on each assignment? Mention the ways of safe abortion(like what should the woman do??)need help fast what is a flowchart and write it's work Maria counted the number of candies in ten different boxes. the number of candies are 57 38,45,49,52,56,41,50,61, and 60. What is the mean absolute deviation of the number of candies. Today is your birthday, and you decide to start saving for your college education. You will begin college on your 18th birthday and will need $4,000 per year at the end of each of the following 4 years. You will make a deposit 1 year from today in an account paying 12 percent annually and continue to make an identical deposit each year up to and including the year you begin college. If a deposit amount of $2,542.05 will allow you to reach your goal, what birthday are you celebrating today Zinc metal reacts with aqueous copper(II) chloride, as shown in this equation. If 3.03 x 1021 atoms of zinc react, how many grams of Cu will form? Show the sequence of conversions necessary, then calculate the numerical answer. Zn (s) + CuCl2 (aq) ---> ZnCl2 (aq) + Cu (s) An equation is represented by the model belowWhat is the value of x that makes the equation true?If you can may someone explain how to do this also? Thanks! PLEASE HELP WILL GIVE BRAINLIEST Genghis Khan Expanded the Mongol Empire by: A. forming alliances with kingdoms that had more powerful militaries.B. using his vast wealth to purchase huge amounts of foreign land.C. convincing foreign leaders to adopt the Mongol religion.D. invading territories with highly skilled warriors on horseback. which phase of cell division is shown?