5(−3.4k−7)+(3k+21) find the sum

Answers

Answer 1

Answer:

-14k - 14

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Algebra I

Combining Like Terms

Step-by-step explanation:

Step 1: Define expression

5(-3.4k - 7) + (3k + 21)

Step 2: Simplify

Distribute 5:                         -17k - 35 + 3k + 21Combine like terms (k):       -14k - 35 + 21Combine like terms (Z):       -14k - 14
Answer 2

Answer:

−14k−14

Step-by-step explanation:

View attached picture!

Consider Brainliest!

5(3.4k7)+(3k+21) Find The Sum

Related Questions

HELPP!! BRAINLIEST??

Answers

Answer:

answer number 4 I believe

Answer:

Its... x > 17

Step-by-step explanation:

1. Since the arrow is pointing to the left of the graph it means greater than.

2. The circle is also not filled in so it does not mean greater than or equal to.

3. The circle is open so that means it is JUST greater than.

Answer: x > 17

A recipe for two dozen cookies calls for 234cups of sugar. How much sugar is needed to make one dozen cookies?wat dis 0-0:>

Answers

If it’s 234 it should be 117
234 divided by 2 = 117!

Which point is not on the graph of the function y = x + 2?

(3, 5)
(6, 8)
(7, 9)
(2, 0)

Answers

Answer
Either
3,5 or 2,0
3,5 Is what I found
Hope this helped

After 10 weeks, how much money would William have in his bank account?

A.$165

B.$170

C.$200

D.$314

Answers

Answer:

if he earned $20 a weak after ten weeks it would be $200

Option A is correct,  $165 is the account balance of Willian after 10 weeks.

What is a function?

A relation is a function if it has only One y-value for each x-value.

Given that William bank account is modeled by the function f(x)=12x+45

f(x) equal to twelve times of x plus forty five.

Where x represents the number of weeks and f(x) represents the total balance.

45 represents the initial amount.

x represents the number of weeks.

We have to find the account balance after 10 weeks.

Plug in x as 10 to find the amount after 10 weeks.

f(x)=12(10)+45

When twelve is multiplied with ten we get 120,

=120+45

Add 120 and 45 we get

=165

Hence, $165 is the account balance of Willian after 10 weeks.

To learn more on Functions click:

https://brainly.com/question/21145944

#SPJ3

William bank account is modeled by the function f(x)=12x+45

Where x represents the number of weeks and f(x) represents the total balance.After 10 weeks, how much money would William have in his bank account

But all this-the mysterious, far-reaching hair-line trail, the absence of sun from the sky, the tremendous cold, and the strangeness and weirdness of it all-made no impression on the man.



What can you infer about the man from the excerpt above?

Answers

Answer:That the man is undaunted by the weather and is very solemn.

Step-by-step explanation:

If the man is completely unaffected by the bad weather that means he is very focused or serious about something.

Hope this helps :)

two separate questions

3(5x) - 6x = 27



3(2x) + 8(-4x) = 57 + 47

Answers

1st question: x = 3
2nd question: x = -4

The city council voted on a new tax. 18 council members voted in favor of the tax. The council has 90 members. What percentage of the council members voted in favor of the tax?

Answers

Answer:

20%

Step-by-step explanation:

18/90 = .2

Decimal to Percentage Rule: Multiply by 100

.2 * 100 = 20

20%

Hope this helps!  Have a nice day!

Answer: 20%
Explanation: You can set up a ratio. 18 / 90 to x / 100. x is the percentage of a full 100. Cross multiply, which gives you 1800 and 90. Divide, which gives you 20.

Who else hate khan academy?

Answers

Answer:

samme

Step-by-step explanation:

Answer:

Me i tho im forced to watch it for school

Step-by-step explanation:

what is x if f(x) is 64 in the function below?
f(x) = 4^x

Answers

Answer:

4

Step-by-step explanation:

Answer:

3.40282367×10^38

Step-by-step explanation:

4^(64)=3.40282367×1038

Which of the following simplifies the expression shown below?

Answers

Answer:

C

Step-by-step explanation:

I just took the same quiz :/.... Please mark me Brainliest :D

I need help with this question.
Help needed!!!!!!!

Answers

Answer:

32

Step-by-step explanation:

Answer:

The answer is A

Step-by-step explanation:

The answer is A because the possibilities of the possibility that the answer is 'A' is just another possibility, so you just have to trust that possibility of a possibility and answer A ;)

Find the following:
9 11/60 − 3 13/80

Answers

9 44/240 - 3 39/240= 6 5/240

Answer: 6 1/48

Answer:

Step-by-step explanation:

Let reformat the problem. :)

[tex]9\frac{11}{60} -3\frac{13}{80}[/tex]

Then we turn the equation in improper fractions.

[tex]\frac{551}{60} -\frac{253}{80}[/tex]

Then we need to have common denominators

Which is 240.

After solving, we get the answer [tex]\frac{1445}{24}[/tex]

PLEASE HELP IF YOU NEED ME TO TELL YOU THE INFO FOR A.) I WILL
b) During the shot put event, Alayna throws the ball 32.45 feet while her teammates
throw 28.34 feet, 26.59 feet, and 33.11 feet. Use an estimation strategy to determine about how many total feet were thrown by the team. Describe the estimation strategy you used to solve the problem. (2 points)

Answers

28.34 can be estimated to the nearest number, which is 28. 26.59 can be estimated to the nearest number, which is 27. 33.11 can be estimated to the nearest number, which is 33. 28+27+33=88
It is 88 I checked the other girls answer and they are right :)

Hello there, can someone help me with this question? Thanks!

Answers

Answer: option 1, I would say.

Hope I help, Xd.

Answer:the answer is D i do my best to help and if it did say thanks and if you need anymore questions you need annswered feel free to ask me and if it did help plz rate me brainest ok hope you have a good night

Step-by-step explanation:

Edward doesn't know how to do math. Can you help me help him lol

Answers

Answer: d = 147/4 or 36.75

Edward didn't isolate for 'd' by rearranging the terms.

(4/7)d = 21 (Multiply both sides by 7 to get rid of the 7 on the left side)

4d = 21 · 7

4d = 147 (Divide both sides by 4 to isolate for d)

d = 147/4 or 36.75

Already answered that lol sujdiff

Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.

Show that the ratios
10/20
and
30/60
form a proportion by finding a common multiplier.
Show that the ratios in part (a) are equal by writing them in simplest form.

Answers

Answer:

Step-by-step explanation:

(A) We need to show both fraction of same proportion.

Ratio 1:  

If we multiply by 3 at numerator and denominator

(B) Now we simplify both ration into simplest form

Step-by-step explanation:

Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8
B. 16
C. 32
D. 64​

Answers

Answer:

A

Step-by-step explanation:

Use the Pythagorean Theorem( a^2 + b^2 = c^2(hypotenuse)

6^2 + b^2 = 10^2

36+b^2 = 100

b^2 = 64

b = 8(Use square root rule)

A

Hope this helps!  Have a nice day!

Answer:

8

Step-by-step explanation:

Use pythagorean therom: a^2 + b^2 = c ^2

6^2 + b^2 = 10^2

36 + b^2 = 100

b^2 = 64

square root both sides to get rid of the ^2

sqaure root of 64 = 8

square root of b^2 = b

b = 8

Stacy and Neil painted 280 ft2 of their living room wall with 4/5 gallon of paint. How many square feet can they paint with 4 gallons of paint?

Answers

Answer:

56

Step-by-step explanation:

Divide 280 by 4/5 and get 14 then multiply by 4 and get 56

Answer:

1400 ft2

Step-by-step explanation:

if 280 ft2 comes from 4/5 of 1 gallon of paint, then do 280 x 4, because their are 4 gallons of paint. after you x that it will be 1120 ft2. but the extra 1/5 paint from all 4 of the gallons comes out to 4/5 so add 280 ft2 to that 1120 ft2.

it comes out to 1400 ft2.

Select all the correct answers.
Terry is an up-and-coming florist who specializes in weddings. He uses 5 roses, 3 daisies, and 4 bundles of green filler to make one bouquet. If r is the cost of a rose, d is the cost of a daisy, and f is the cost of a bundle of green filler, which expression represents the cost for making 75 bouquets?
75r +75d + 75f + 12
(5r + 3d + 4f) + 75
75(5r) + 75(3d) + 75(4f)
75(5r + 3d + 4f)

Answers

Answer: The last two are right

Step-by-step explanation: 75x5= $375, 75x3=$225, 75x4=$300.

Add all the sums together and you will get the cost of 75 bouquets, which is $900. - NUMBER 3

5+3+4=12, 12x75=$900

Sorry if I'm wrong first time doing this.

Answer:

option (4) is correct. 75( 5r + 3d + 4f ) expression represents the cost for making 75 bouquets.

Step-by-step explanation:

Given: r is the cost of a rose, d is the cost of a daisy, and f is the cost of a bundle of green filler.

Terry uses 5 roses, 3 daisies, and 4 bundles of green filler to make one bouquet.

Thus, cost of one bouquet = cost of each flower used × number of flower used.

Total cost of one bouquet= 5r+3d+4f

Thus, cost for making 75 bouquets = 75 × cost of one bouquet

= 75( 5r + 3d + 4f )

Thus, option (4) is correct. 75( 5r + 3d + 4f ) is the correct expression to represents the cost for making 75 bouquets

What side corresponds to AB?



LM
LN
MO
NO

Answers

Answer:

LM

Step-by-step explanation:

divide 6 by 4 and you would get the scale factor and then you would know which side corresponds with which

Charles decides to use the method of proportions and similar
triangles to find the height of a lamppost. He measures the length of
the post's shadow and finds it is 10 feet long. Then he holds a 12-inch
ruler perpendicular to the ground and finds that it casts a 4-inch
shadow. How tall is the lamppost?
a. 2.5 ft c. 30 ft
b. 4.8 ft d. 120 ft

Answers

Answer:

C. 30 ft.

Step-by-step explanation:

10 = x

12 = 4

Divide by 4

1inch shadow = 3 inches height

1 inch of a shadow is 3 inches

10 feet is 120 inches

120 * 3

360 inches height = 30 ft

Consider Brainliest!

I think it might be A. Since sometimes shadows can come off longer than the actual object.

Which equation shows the best estimate for 4,310 ÷ 72 using compatible numbers?
A. 4,900 ÷ 70 = 70
B. 4,200 ÷ 70 = 60
C. 4,000 ÷ 80 = 50
D. 4,000 ÷ 100 = 40

Answers

Answer:

[tex]follow \: me \: please[/tex]

Step-by-step explanation:

A sent telegram to b will you sell your car qoute lowest price B sent replay lowest price 50000 A sent second telegram ti B i agree to by car for 50000 B transfer refused to sell it there any contracy between A qnd B and can A Sue B for breach of contract give reason

4310 / 72 = 59.86. The closest equivalent is 60, so the answer is B.
B. 4200 / 70 = 60

MATH HELP PLEASE!!! USA TESTPREP!!

Answers

Answer:

B.) -3

Step-by-step explanation:

Answer:

B -3

Step-by-step explanation:

An office supply stores marks up their prices by 30%. Which of the following could be items sold by the store? Select all of that apply.

office chair: cost: $72, selling price: $94.50
printer paper: cost: $4.60, selling price: $5.98
box of paper clips: cost: $1.20, selling price: $1.65
file cabinet: cost: $60, selling price: $78

Answers

Answer:

printer paper: cost: $4.60, selling price: $5.98

office chair: cost: $72, selling price: $94.50

Step-by-step explanation:

SORRY IF IM WRONG.

A restaurant orders corn tortillas and flour tortillas. The ratio of the number of corn tortillas to the number of flour tortillas is 2 : 3. What is the ratio of the number of flour tortillas to the total number of tortillas?
3 : 8

3 : 5

2 : 8

2 : 5

Answers

Answer:

The answer  is 3:5

Step-by-step explanation:

Since the Ratio is to flour tortillas to total, we already know that the number of flour tortillas is 3.  

The total number is 5. If you add up both flour tortillas and corn tortillas the total number would be 5.

The ratio would be 3:5

Corn to flour
2:3
Flour to total
3:5
You answer is 3:5

HELLP WILL MARK BRAINLIEST!!!

Answers

Answer:

Step-by-step explanation:

First add then multiply x

Answer:

X = 10

Step-by-step explanation:

1. The first step is to Subtract 6.1 on both side

1.4x + 6.1 =  -7.9

      -6.1       -6.1

2. The second step is to divide 1.4 on both side.

1.4x = 14

/1.4    /1.4

The solution is x = 10

Mark and Dennis help their grandfather make rootbeer. They need 4 pounds of sassafras to make one barrel of rootbeer, but they only have 1 pound.

How much rootbeer can they make?

Answers

Answer:

im not sure if i have a answer but here's what i have

Step-by-step explanation:

4 x 1=4

4/1=4

4-1=3

4+1=5 but im pretty sure it's one of the first two srry i wasn't much help

i think they could only make one fourth of the recipe

[PICTURE ATTACHED] HHHEEELLLPPP PLEASE! :((

Answers

Answer:

the 3 chose

Step-by-step explanation:

Please help due tmr
The Diver: (-6, 3)
The whale: (-7, -6)
The Treasure: (7, 3)

Explain how you know for the question below.

1. If Captain Sullivan lost his map but he knew the coordinates of the diver and the treasure, how could he find the distance between the diver and the treasure?

If Captain Sullivan lost his map but he knew the coordinates of the diver and the treasure, how could he find the distance between the diver and the treasure?

Answers

Just watch anime screw work

This histogram represents a sampling of recent visitors to the mall on a Friday night, grouped by their ages


In which interval is the median located?

40-49
30-39
20-29
10-19

Answers

Answer:

30-39 as where

Step-by-step explanation:

Example: find the Median of 12, 3 and 5

Put them in order:

3, 5, 12

The middle is 5, so the median is 5.

The age range of the 10th and 11th tourists would be 20 to 29.

What is the significant use of graphs in real life?

Graphs are a not unusual place technique to visually illustrate relationships withinside the statistics. The reason for a graph is to provide statistics that are too severe or complex to be defined appropriately withinside the textual content and in much less space.

A bar-like graph known as a histogram is used to display numerical data. The frequency of the data is shown on the y-axis, and the median of the data is shown on the x-axis as a measure of central tendency.

It calculates the median value among a group of observations.

There are 20 observations (visitors),

1, 2, 3,5,6, 7, 8, 9,| 10, 11, | 12,13,14,15,16,17,18,19,20

the median is 10 and 11 or 10.50

there are 9 numbers on either side of 10 and 11

Therefore, The 10th and 11th visitors would be found in the age group 20 - 29

Learn more about graphs here:

https://brainly.com/question/17267403

#SPJ3

Other Questions
Please select the word from the list that best fits the definitionDoctors appointment today at 3:20pma.term calendarsb. weekly schedulec. daily organizer hellpppppp please I will give brainliest DUE 10:00 PM HELP ASAP. When Sarah left your house this morning her cell phone was 80% charged and then it started to lose 8% charge for each hour there after write an equation for B in terms of tea representing the charge remaining in series battery as percentage t hours after Sara left her house A news report says that 9% of middle school students are on the track team. There are 600 students in your middle school How many students in your school would you expect to be on the track team? HE Pad SATTE BAR HG West nus SAUNA w 1 PLEASE HELP! THIS A TIMED QUIZ!!Scientists found an artifact that has 25% of Carbon-14 left. Based on how much Carbon-14 is remaining, how old is the artifact that was found?A). 17,100 yearsB). 5,700 yearsC). 22,800 yearsD). 11,400 years Please help asap! Ill give brainliest!What theme does the excerpt convey?It is right to be wary of the unknown.Pride interferes with progress.Manners must be displayed in all situations.Strange animals cannot be trusted. What is your response? Why do u think sunny asks so many questions? anyone out there an expert on dreams?? Estimate 511 x 637 by first rounding each number so that it only has 1 nonzero digit. what would you do when you grow up?*Career* And explain why! During a formal group discussion, participants should be prepared toO lead the conversation and prompt others to speak. O persuade others to agree with their viewpoint. O interrupt other speakers when necessary. O take turns both listening and speaking. This is easyGive me a name and quote about video games being good or badIt can be by you.If you want 3.Lakpa buys 20 items for Rs 6000. He sells them at Rs 390 each. Calculate: (a)His total profit on the deal.(b)His percentage of profit on the deal What is the allele number for the following sequence? (3pts)GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA The relevant production range for Challenger Trailers, Inc. is between 120,000 units and 190,000 units per month. If the company produces beyond 190,000 units per month:__________. A. the fixed costs and the variable cost per unit will not change B. the fixed costs may change, but the variable cost per unit will remain the same C. the fixed costs will remain the same, but the variable cost per unit may change D. both the fixed costs and the variable cost per unit may change Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive How do you do this question? Abdul made $252 for 12 hours of work.At the same rate,how many hours would he have to work to make $105 XYZ Corporation, whose common stock is currently selling for $40 per share, is having a rights offering. The terms of the offering require 10 rights plus $35 to subscribe to one share of stock. Compute the theoretical value of a right before the ex-rights date.