You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.

Answers

Answer 1

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

Answer 2

There is a 75% chance that each offspring will be tall. Therefore option C is correct.

When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.

The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.

The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.

Therefore option C  There is a 75% chance that each offspring will be tall is correct.

Know more about genotype:

https://brainly.com/question/31515990

#SPJ5


Related Questions

Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?


It increases the probability that moving water will promote gene flow from one population to another.

It increases the chance of the recombination of alleles, leading to genetic drift in the population.

It increases opportunities for offspring to compete for limited resources.

It increases the probability that some offspring will survive long enough to reproduce.

Answers

Answer:

increases opportunities for offspring to compete for limited resources.

Definition: a macromolecule that contains carbon, hydrogen, oxygen, and nitrogen, which is used by the body for growth and repair.

Answers

Answer:

Proteins

Explanation:

Proteins are the main building block of the body. They are required for proper growth of the organism.

The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass

Answers

Answer:

A

Explanation:

The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^

Explanation:

A because im big brain

Please help!! Any word is greatly appreciated :) thanks <3

Answers

Stem anatomy

WORD DEFINITION

Monocot Plant where Xylem and Phloem are arranged in bundled scatters

Node Location on the stem where leaves and buds are attached

Corm A bulb-shaped specialized stem that is made of solid stem and had no leaves

Stolon Specialized stem that is usually horizontal and above the soil

Specialized Stems Bulbs, Corm, Rhizomes, and Tubers

Apical Meristem Actively growing tip found inside a terminal or lateral bud

Terminal Bud End of stem or branch

Xylem Cells in the stem where they carry UP water and minerals

Lenticel A mark on the outside of the stem that allows gas to be exchanged

Lateral Bud Bud that is found on the side of the branch

Sapwood Part of woody stem that actively conducts water and dissolved minerals

Bulb Specialized stem made of short, flat stems and contains many fleshy leaves

Dicot Plant where it's Xylem and Phloem are arranged in a circle

Inter Node Area on the stem that lies between 2 leaves/buds

Leaf Scar Scar left when a leaf falls off

Bud Scale Scar Area in the stem that shows the location of last years bud

Phloem Tube-shaped cells that carry DOWN water and minerals

Tuber Specialized stem that's tip is swollen with stored food

Rhizome A specialized stem that is thick and runs horizontally under the soil

Bud Scale Small protective structure that can be seen on the outside of a bud

Vascular Cambium Area inside stem where new Xylem and Phloem are made

Explanation:

hope this here helps you

I attached the words in order down below

What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.

Answers

Answer:

.

Explanation:

Answer: A, C, D. Hope this helps:

Explanation: Open Photo ;)

The different forms of the beef cattle color gene are called_

Answers

The answer is right there click on it 271 the beef is colored red

The different forms of the beef cattle color gene are called "alleles"

What are alleles?

Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.

In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.

The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.

Learn more about alleles, here:

https://brainly.com/question/14104138

#SPJ6

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose

Answers

Answer:

 A

Explanation:

     

6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.

Answers

Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?

Explanation:

Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-

Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-

The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-

A new strain of influenza breaks out in New York City-

The population of rabbits and a population of deer are both feeding off the same plants in the same area-

Hurricane Katrina forced thousands of people to leave New Orleans-

65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.

Answer choices: Density Dependent
Density Independent

Answers

Answer:

Density Dependent

Explanation:

i think hope it helps

is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands

Answers

Answer:

false

Explanation:

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

What is the process of the digestive system?

Answers

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

Please Help I will mark bRAINLIEST

Answers

Answer:

d

Explanation:

In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Question C. please... :) And NO FILES I WILL REPORT YOU!

Answers

The best way to describe it would be “the pattern of the graph is constantly changing as it goes thru series of increased and decrease through out the years”

which type of specialized cells would be found in an animal’s neuvous system?

Answers

Animal nerve cells are specialized cells called neurons. Depending upon function, these cells can be divided into sensory neurons, interneurons, and motor neurons.

The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.

What is the nervous system?

The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.

Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.

Therefore, the correct option is D. Cells that can transmit signals around the body.

To learn more about the nervous system, refer to the link:

https://brainly.com/question/29355295

#SPJ2

The question is incomplete. Your most probably complete question is given below:

Cells that transport oxygen are found in the blood.

Cells that secrete hormones to trigger cellular responses.

Cells secrete enzymes to break down food.

Cells that can transmit signals around the body.

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity​

Answers

Answer:

Gender Role

Explanation:

How people already see how people should act. Example- Be a man.

Answer:

b. sex

Explanation:

edge 2021

An eastern screech owl, a carnivore, might compete with which organism most intensely for resources?
A. hawk (secondary consumer)
B. mountain lion (secondary consumer)
C. wren (primary consumer)
D. mouse (primary consumer)

NO LINKS PLEASE

Answers

i think it would be A

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat

Answers

The correct answer is D

In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.

A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________

B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.

C. A short winged fly can be described -using words as what?

D. What type of inheritance is this called?

Answers

Answer:

A. Normal Wings= Ww, Small Wings=ww

B. All offspring will have short wings because short wings trait is recessive.

w. w

______

w| ww |ww|

————-

w|ww |ww |

______

Explanation:

please help asap

Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:

Answers

Answer:

humans- exposes them to the ultra-violet rays of the sun causing cancer

animals- causes the pollution of gases found within the atmosphere

plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants

Environment- causes global warming

A moon has less mass than a star and more mass than a planet it orbits.
•True
•False

Answers

It is false bc the mass of moon is less than 1/2 of earth, and earth is tinier than ANY STAR

Create a food chain with a producer and 3 consumers.

Answers

Answer: dandelion is consumed by bees, grasshoppers, and butterflies.

Answer:

primary consumers, secondary consumers, tertiary consumers.

Explanation:

Hope this helps

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

what are the three age categories labels between childhood and adulthood

Answers

Answer: Early adolescence, middle adolescence, and late adolescence.

brainliest or a thank you please :)) <33

Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

I need URGENT help with 16 through 18 pls!!!

Answers

Answer:

16. Directional Selection

17. Disruptive Selection

18. Stabilizing Selection

19. Natural Selection

20. Adaptation

Explanation:

In population genetics, directional selection/positive selection is a mode of natural selection in which an extreme phenotype is favored over other phenotypes.

Disruptive Selection would show phenotypes (individuals with groups of traits) of both extremes but have very few individuals in the middle.

Stabilizing Selection. Occurs when individuals at the extremes of the range of characteristic are selected against. This means that the "average" individuals are selected for.

Other Questions
EASY! which equation can be used to solve x in the diagram??a) 13x - 5x = 180b) 5x + 13x = 90c) 5x + 13x = 180d) 5x = 13xno links picture above Find the shaded area.Round to the nearest tenth if necessary Plsss help will mark brainliest why does the sky appear orang or red at sunset and sunrise? Which type of organisms get their energy directly from the Sun?A ProducersB DecomposersC First-level consumersD Second-level consumers The _____ was the application of reason to improve government and society?A- Scientific Revolution B- ConsistoryC- Enlightenment D- Reformation From 1981 to 2011, the United States focused on reusable space shuttles. Many successful shuttle launches completed scientific and military space missions during this time. However, the space shuttle program was marred by two major tragedies. On January 28, 1986, the space shuttle Challenger exploded 73 seconds after liftoff. All seven people on board died, including a teacher named Christa McAuliffe. McAuliffe would have been the first civilian in space. The second tragedy occurred on February 1, 2003. The shuttle Columbia was returning from a 16-day research mission when it disintegrated while reentering Earths atmosphere. The seven-person crew died. After each of the disasters, space shuttle operations were suspended for more than two years.Based on the text, which of the following statements is true?AChallenger exploded at the beginning of its mission, and Columbia exploded at the end of its mission.BThe Challenger disaster took place in 2003, and the Columbia disaster took place in 1986.CBoth Challenger and Columbia were carrying teachers on board.DBoth the Challenger and the Columbia disasters had survivors. 3. Identify the pair of angles as complementary, supplementary, both, or neither.a. supplementaryb. complementary and supplementaryc. neitherd. complementary I need help asap!!!!!!! PLEASE HURRY!!!! I am being timed!31 POINTS!!!!!!!!!!!!!!!!!!Which sentence in this excerpt shows that Tom Canty is not satisfied with being a mock (pretend) prince?By-and-by Tom's reading and dreaming about princely life wrought such a strong effect upon him that he began to act the prince, unconsciously. His speech and manners became curiously ceremonious and courtly, to the vast admiration and amusement of his intimates. A) But Tom's influence among these young people began to grow now, day by day; and in time he came to be looked up to, by them, with a sort of wondering awe, as a superior being. He seemed to know so much! and he could do and say such marvellous things! and withal, he was so deep and wise! Tom's remarks, and Tom's performances, were reported by the boys to their elders; and these, also, presently began to discuss Tom Canty, and to regard him as a most gifted and extraordinary creature. Full-grown people brought their perplexities to Tom for solution, and were often astonished at the wit and wisdom of his decisions. B) In fact he was become a hero to all who knew him except his own familythese, only, saw nothing in him.Privately, after a while, Tom organised a royal court! He was the prince; his special comrades were guards, chamberlains, equerries, lords and ladies in waiting, and the royal family. Daily the mock prince was received with elaborate ceremonials borrowed by Tom from his romantic readings; daily the great affairs of the mimic kingdom were discussed in the royal council, and daily his mimic highness issued decrees to his imaginary armies, navies, and viceroyalties.After which, he would go forth in his rags and beg a few farthings, eat his poor crust, take his customary cuffs and abuse, and then stretch himself upon his handful of foul straw, and resume his empty grandeurs in his dreams.C) And still his desire to look just once upon a real prince, in the flesh, grew upon him, day by day, and week by week, until at last it absorbed all other desires, and became the one passion of his life.One January day, on his usual begging tour, he tramped despondently up and down the region roundabout Mincing Lane and Little East Cheap, hour after hour, bare-footed and cold, looking in at cook-shop windows and longing for the dreadful pork-pies and other deadly inventions displayed therefore to him these were dainties fit for the angels; that is, judging by the smell, they werefor it had never been his good luck to own and eat one. There was a cold drizzle of rain; the atmosphere was murky; it was a melancholy day. At night Tom reached home so wet and tired and hungry that it was not possible for his father and grandmother to observe his forlorn condition and not be movedafter their fashion; wherefore they gave him a brisk cuffing at once and sent him to bed. D) For a long time his pain and hunger, and the swearing and fighting going on in the building, kept him awake; but at last his thoughts drifted away to far, romantic lands, and he fell asleep in the company of jewelled and gilded princelings who live in vast palaces, and had servants salaaming before them or flying to execute their orders. And then, as usual, he dreamed that he was a princeling himself. Pi approx A cylinder has a height of 20 yards and a diameter of 18 yards . What is its volume ? Use 3.14 and round your answer to the nearest hundredth . please answer the math question, I will give brainlie'st to the first to answer correctly and has a very easy to understand layout for the answer. Please explain how you figured it out.15 + 4(10 - 2 5) + 7 =722182767 The capital budgeting committee of the Caldwell Pipe Corporation is evaluating the possibility of replacing its old pipe-bending machine with a more advanced model. Information on the existing machine and the new model follows: Existing machine New machine Original cost $200,000 $400,000 Market value now 80,000 Market value in year 5 0 20,000 Annual cash operating costs 40,000 10,000 Remaining life 5 yrs 5 yrs Refer to Caldwell Pipe Corporation. If the company buys the new machine and disposes of the existing machine, corporate profit over the five-year life of the new machine will be ________ than the profit that would have been generated had the existing machine been retained for five years. Solve for x to the nearest 10th.410 = 1080(0.915)^x RENAME 11/12 / 8/9 AS A MIXED NUMBER The groom looked ________ when his bride began yelling furiously at the wedding planner. which of the following is equivalent to 2:1 FOODS HIGH IN PROTEIN RELEASES ENERGY A. FASTB. QUICKLY C. SLOWLY According to Chargoffs rule: A always bonds with _________ and G always bonds with _________. 1)A,G2)C,T3)G,A4)T,C What tape job would be appropriate for a an athlete with a grade 1 finger sprain?