Yes, or No about Meiosis

Yes, Or No About Meiosis

Answers

Answer 1

11. YES, Anaphase I is different from anaphase during mitosis because in Anaphase I, homologous chromosomes are separated, while in anaphase during mitosis, the sister chromatids are separated.

Anaphase I is the stage of meiosis I where the homologous chromosomes, consisting of two sister chromatids, are separated and pulled towards opposite poles of the cell by the spindle fibers. This separation is facilitated by the shortening of microtubules attached to the kinetochores of the chromosomes. During Anaphase in mitosis, the sister chromatids of each chromosome are separated and pulled to opposite poles of the cell.

12. YES, Telophase I is different from telophase during mitosis because in Telophase I, the cells produced have half the number of chromosomes as the original cell, whereas in telophase during mitosis, the cells produced have the same number of chromosomes as the original cell.

Telophase I marks the end of meiosis I, during which the two homologous chromosomes have been separated into two different cells. Therefore, the number of cells created from the original cell at the end of Telophase I is two. During Telophase in mitosis, the chromosomes have been separated into two identical nuclei, which means that the number of cells remains the same.

To know more about anaphase, visit:

https://brainly.com/question/13766396

#SPJ1


Related Questions

A synapse involves two cells, a _______________ cell that sends the signal, and a _______________ cell that receives the signal

Answers

A synapse is a specialized junction between two cells that allows them to communicate with each other. The cells involved in a synapse are the presynaptic cell, which sends the signal, and the postsynaptic cell, which receives the signal.

The presynaptic cell is typically a neuron that has a specialized structure called an axon terminal that releases chemical messengers called neurotransmitters. When an action potential travels down the axon of the presynaptic cell, it triggers the release of neurotransmitters into the synaptic cleft, a small gap between the presynaptic and postsynaptic cells. The postsynaptic cell is typically another neuron, a muscle cell, or a gland cell. When neurotransmitters bind to receptors on the postsynaptic cell, they trigger a change in the electrical properties of the cell, either depolarizing or hyperpolarizing it. This change in electrical potential can lead to the firing of an action potential in the postsynaptic cell, or to a change in the activity of the target cell. Overall, synapses are crucial for communication between cells in the nervous system, allowing for the transmission of information and the integration of complex behaviors and functions.

To know more about presynaptic cell click here:

brainly.com/question/30264920

#SPJ4

what was the most significant conclusion that gregor mendel drew from his experiments with plants quilzet biology chapater 14

Answers

The most significant conclusion that Gregor Mendel drew from his experiments with plants was that heredity is determined by discrete units called genes.

Genetics is the scientific discipline that examines how characteristics are passed from one generation to the next. It also analyses the mechanisms underlying these processes. Gregor Mendel, an Augustinian monk, established the groundwork for genetics with his work on pea plants, which he published in 1866.

Mendel's key conclusion was that heredity is determined by discrete units called genes, which occur in pairs. These genes are passed from one generation to the next in a predictable manner, obeying the principles of probability. In addition, Mendel discovered that these genes may be dominant or recessive in their expression.

According to Mendel's model, these genes combine in a predictable manner during reproduction, with each parent contributing one of two possible versions of a gene to their offspring. This interaction creates the genetic diversity seen within and between populations.

Learn more about genetics here:

https://brainly.com/question/30459739

#SPJ11

g he estrous cycle has 4 phases. the first phase is called estrous . during this phase the stimulates the developments of follicles and the follicular cells secrete . this hormone stimulates the production of and the thickening of the endometrium. when reaches a peak, and ovum is released. this phase is called

Answers

The hormone stimulates the production of cervical mucus and the thickening of the endometrium. When estrogen reaches a peak, an ovum is released in a process called ovulation. This phase is called estrus.

Most mammalian species, including domestic animals like cows, pigs, and horses as well as some wild species, have an estrous cycle, which is a reproductive cycle. The female reproductive system undergoes a number of hormonal and physical changes over the course of the cycle, which are what define it.

Proestrus, estrus, metestrus, and diestrus are the four phases that make up the estrous cycle. Each phase is distinguished by particular physiological and hormonal changes that get the female ready for sex and potential pregnancy.

Proestrus is the first stage of the estrous cycle. The follicular cells in the ovaries emit the hormone oestrogen during this period, which promotes the growth of follicles.

To know more about estrous click here

brainly.com/question/9531456

#SPJ4

when isolating the solid after recrystallization using vacuum filtration what solvent should you use to aid in the rinse from the erlenmeyer flask to the vacuum filter funnel?

Answers

Use a nontoxic solvent to help with the rinse from the erlenmeyer flask to the vacuum filter funnel when vacuum filtering is being used to isolate the solid after recrystallization.

To get rid of any solvent contaminants that are on the crystals' surface during the recrystallization process, we keep the volume of the rinses low. The solvent should be non-volatile, non-flammable, and non-carcinogenic. The solvent should boil in the range 50–120°C.

Impurities should either be insoluble in the hot solvent or soluble in the cool solvent. The substance and solvent must not interact in any way. An ideal crystallization solvent should be unreactive, cheap, and have minimal toxicity. It is also vital that the solvent have a reasonably low boiling point.

Learn more about recrystallization Visit: brainly.com/question/30670227

#SPJ4

what type of organisms are the mushroom, bacteria, and worms

Answers

The organisms such as mushrooms, bacteria, and worms belong to different kingdoms of life. The mushroom is a fungus, the bacteria are prokaryotes and the worms belong to the animal kingdom.

An organism refers to any living entity that is capable of responding to the environment, feeding, reproducing, and developing. Organisms are classified into various categories depending on different criteria, they can be classified based on their structure, function, or the kingdom of life they belong to. Fungi are multicellular organisms that are found in diverse habitats, they are characterized by their filamentous and microscopic structure. Bacteria are single-celled organisms that are ubiquitous, they are found in the air, soil, and water.

Learn more about kingdoms of life: https://brainly.com/question/1275968

#SPJ11

What are the main man-made greenhouse gases?

Answers

Several major greenhouse gases that result from human activity are included in U.S. and international estimates of greenhouse gas emissions:

Carbon dioxide (CO2)Methane (CH4)Nitrous oxide (N2O)Industrial gases: Hydrofluorocarbons (HFCs) Perfluorocarbons (PFCs) Sulfur hexafluoride (SF6) Nitrogen trifluoride (NF3)

Without the green house effect, the Earth's average temperature would be closer to -18 °C than it is today, at roughly 15 °C. The concentrations of both natural and man-made glasshouse gases (GHGs) in the atmosphere are, however, rising due to human activity, which strengthens the glasshouse effect and causes climate change.

Emissions from human activity include deforestation, agriculture, and the manufacturing of cement, as well as emissions from the burning of fossil fuels like coal, oil, and natural gas. The increase in greenhouse gases in the atmosphere during the past 150 years, according to the Intergovernmental Panel on Climate Change (IPCC), is almost entirely attributable to human activity.

To know more about greenhouse gas click here:

https://brainly.com/question/6636239

#SPJ4

viewing these beautiful blossoms is a yearly japanese tradition. what kind are they?

Answers

The beautiful blossoms which are viewed as a yearly Japanese tradition are Sakura blossoms.

'What are Sakura blossoms?'

Sakura blossoms or cherry blossoms, also referred to as Prunus serrulata, are one of the most renowned symbols of Japan. These beautiful flowers are a significant part of Japanese culture and are regarded as a symbol of the fleeting nature of life because of their brief lifespan.

These delicate flowers come in a variety of colors, including pink, white, and yellow, and can be seen blooming throughout Japan during the spring season. Sakura blossoms are viewed as an essential part of Japanese life and culture and are a widely recognized symbol of Japan. They represent the nation's resilience, beauty, and ability to flourish despite challenges.

know more about Sakura blossoms here

https://brainly.com/question/28456359#

#SPJ11

which of the following is not a functional characteristic of wbcs? which of the following is not a functional characteristic of wbcs? diapedesis ameboid motion positive chemotaxis granulosis

Answers

Granulosis is not a functional characteristic of white blood cells (WBCs).

A white blood cell (WBC) is a type of blood cell that defends the body against infection and diseases. The white blood cell (WBC) is also known as the leukocyte, which is produced in the bone marrow and circulates in the bloodstream. WBCs are necessary for the body's immune response, and they help in the identification of antigens.

The functions of white blood cells are:

Ameboid motion: It means a kind of movement seen in WBCs which help to move by producing finger-like projections called pseudopodia.

Diapedesis: This is a kind of process where the white blood cells leave the bloodstream by squeezing through the capillary walls.

Positive chemotaxis: The ability of WBCs to move towards the chemical signals produced by damaged tissues or invading microorganisms. WBCs can follow chemical signals to the site of an infection or injury.

The function of granulosis is not included in the function of white blood cells. Granulosis refers to the structure of granules present in the cytoplasm of some cells like granulocytes and mast cells.

For more such questions on white blood cells, click on:

https://brainly.com/question/13051716

#SPJ11

What is the type of mutation that shifts the reading frame of the genetic message by inserting or deleting a nucleotide?

Answers

The type of mutation that shifts the reading frame of the genetic message by inserting or deleting a nucleotide is called a frameshift mutation.

Frameshift mutations are a type of genetic variation that can occur during DNA replication or repair, and they involve the addition or deletion of one or more nucleotides from a DNA sequence that is not divisible by three.

Frameshift mutations can have significant effects on an organism, as they alter the reading frame of the genetic code downstream of the mutation site, leading to a different amino acid sequence and potentially a non-functional protein. Frameshift mutations can also cause premature termination of protein synthesis if they introduce a premature stop codon.

Frameshift mutations can be caused by mutagens such as certain chemicals, radiation, or errors during DNA replication. They can also occur naturally as a result of genetic recombination or replication errors.

To learn more about frameshift mutation

https://brainly.com/question/14364090

#SPJ4

Guppies are small fish that live in South American rivers. They can have different- sized spots on their bodies.The river bottoms are covered in rocks. Guppies with spots that are the same size as the rocks on the bottom are harder for bigger fish to see and catch.The diagram below shows a population of guppies that live in a river. At time 1, the population had the same number of guppies with small and large spots. At time 2, after many generations, there were many more guppies with small spots and fewer guppies with large spots in the population.How did the environment change between time 1 and time 2? How did the population change?You cannot tell how the environment changed. With each generation, more guppies passed on the gene for small spots to their offspring.The rocks became smaller. With each generation, more guppies with small spots survived long enough to pass on the gene for small spots to their offspring.The rocks became smaller. Guppies with small spots are more likely to survive, so the guppies with large spots changed to have small spots.The rocks became smaller. Guppies with small spots are more likely to survive, so both kinds of guppies passed on the gene for small spots to their offspring.

Answers

The population of guppies changed as there were many more guppies with small spots and fewer guppies with large spots at time 2. This change in the population suggests that guppies with small spots had a survival advantage over those with large spots.

From the given information, we can conclude that the rocks at the bottom of the river remained the same size, but the guppies with small spots were harder for bigger fish to see and catch, making them more likely to survive and pass on their genes to their offspring. Therefore, with each generation, more guppies with small spots survived long enough to pass on the gene for small spots to their offspring, resulting in the population with many more guppies with small spots and fewer guppies with large spots at time 2.

So, the correct answer would be: The rocks remained the same size. Guppies with small spots are more likely to survive, so the guppies with large spots changed to have small spots.

To learn more about offspring

https://brainly.com/question/26287597

#SPJ4

describe the different arrangements of genetic info in prokaryotic and eukaryotic cells: chromosome loop, chromatin, linear chromosomes

Answers

In prokaryotic and eukaryotic cells, genetic information is organized differently due to their distinct structures. In prokaryotes, genetic information is present in loop.

What is the genetic arrangement in prokaryotes and eukaryotes?

In prokaryotic cells: 1. Chromosome loop: Prokaryotic cells, such as bacteria, typically have a single, circular chromosome in the form of a loop. This loop is called the bacterial chromosome and contains all the genetic information required for the cell's functioning.

In eukaryotic cells: 1. Chromatin: Eukaryotic cells have a more complex organization of genetic material. The DNA is packaged with proteins called histones, forming a complex called chromatin. Chromatin is further organized into structures called nucleosomes. 2. Linear chromosomes: Unlike prokaryotic cells, eukaryotic cells contain multiple, linear chromosomes.

These chromosomes are housed within the cell nucleus, providing an additional layer of organization and protection for the genetic material. In summary, prokaryotic cells have a single chromosome loop, while eukaryotic cells have chromatin and multiple linear chromosomes.

Learn more about Genetic information here:

https://brainly.com/question/6748577

#SPJ11

neon is a non-reactive gas that does not interact with other elements. How does the properties of neon compare to those of xenon? Why?

Answers

This means that because they already contain the required eight total s & p electrons at their outermost energy level, they do not interact with other elements.

Describe an element in its simplest form.

A crucial component of a whole. a simple molecule that cannot be divided into smaller components or transformed into another substance is referred to as in chemistry. An atom, which is made up of protons, neutrons, and electrons, is the fundamental unit of an element.

How is an element created?

Substances that cannot be reduced to a simplified form are considered elements. A distinct atomic number serves as an identifying feature. In the atomic numbers, which emphasizes elements with related properties, the elements are arranged according to their atomic number.

To know more about Elements visit:

https://brainly.com/question/13025901

#SPJ1

During inflammation, fluid will passively diffuse out of blood vessels into the nearby infected tissue. This implies all of the following EXCEPT:
a. The osmolarity of the fluid surrounding infected tissues is higher than the plasma.
b. The surrounding tissue will swell with excessive fluids.
c. Nearby capillaries have become more permeable.
d. B-lymphocyte will differentiate to become plasma cells.

Answers

During inflammation, fluid will passively diffuse out of blood vessels into the nearby infected tissue. This implies that the osmolarity of the fluid surrounding infected tissues is higher than the plasma, the surrounding tissue will swell with excessive fluids, and nearby capillaries have become more permeable. However, it does not imply that D. B-lymphocyte will differentiate to become plasma cells.

Inflammation is a body response to injury or infection, and it often results in redness, swelling, heat, and pain. It is caused by increased activity of the immune system and an increase in blood flow to the affected area. The increase in blood flow leads to a decrease in plasma osmolarity due to the movement of water out of the capillaries and into the surrounding tissue. This leads to an increase in tissue osmolarity and causes the tissue to swell. The increased permeability of the capillaries causes increased movement of molecules out of the capillaries and into the surrounding tissue, resulting in  tissue swelling with excessive fluids.

This process is passive and does not involve B-lymphocytes, which are white blood cells that are responsible for the production of antibodies. Therefore, the diffusion of fluid during inflammation does not imply that B-lymphocytes will differentiate to become plasma cells. Therefore the correct option is D

Know more about tissue  here:

https://brainly.com/question/14491139

#SPJ11      

1. Explain the difference between
transcription and translation in DNA.
Make sure you are able to take a DNA
segment and transcribe it and
translate it into mRNA and proteins.

Answers

Transcription is the process by which an RNA molecule is produced from one of the DNA strands whereas translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein.

What is the difference between transcription and translation in DNA?

Transcription is the process by which RNA polymerase enzyme reads the DNA sequence and synthesizes an RNA molecule that is complementary to one of the DNA strands.

During transcription, the DNA double helix is unwound, and the RNA polymerase enzyme adds nucleotides to the growing RNA molecule following the base-pairing rules of A-U and G-C. The resulting RNA molecule is called messenger RNA (mRNA), and it carries the genetic information from DNA to the site of protein synthesis.

Translation, on the other hand, is the process by which the mRNA molecule is used to synthesize a specific protein. Translation occurs in the ribosome, where transfer RNA (tRNA) molecules with attached amino acids bind to the mRNA codons in a complementary fashion. This process results in the formation of a polypeptide chain that folds into a functional protein.

To demonstrate these processes, let's take the following DNA segment as an example:

DNA sequence: TACAGCGACGCGTATCGAGG

Transcription:

The first step in transcription is to identify the DNA strand that will serve as the template for the RNA synthesis. In this case, we will use the template strand (the complementary strand to the coding strand).

Template DNA strand: ATGTCGCTGCGCATACTCC

The RNA polymerase enzyme will read this template strand and synthesize a complementary RNA molecule by adding nucleotides to the growing chain. The resulting mRNA molecule will have the same sequence as the coding strand (except for U instead of T).

mRNA sequence: AUGUCGCUGCGCAUACUCCG

Translation:

The mRNA sequence can now be translated into a protein sequence using the genetic code, which is a set of rules that determine how the nucleotide sequence of an mRNA molecule is translated into the amino acid sequence of a protein.

AUG-UCG-CUG-CGC-AUA-CUC-CG

Using the genetic code table, we can determine the amino acid sequence of the protein:

AUG: Methionine

UCG: Serine

CUG: Leucine

CGC: Arginine

AUA: Isoleucine

CUC: Leucine

The resulting protein sequence is: Met-Ser-Leu-Arg-Ile-Leu.

Learn more about transcription and translation at: https://brainly.com/question/11214205

#SPJ1

Think about the long sections of peeled celery. Did you see what you thought you would see? Based on what you observed, what can you conclude about the movement of water through the celery stalk? Explain your reasoning. (8 points)

Answers

Since it has many xylem tubes in the stalk and so quickly absorbs water, celery is a useful plant for illustrating capillary action. The light green foliage will change to a reddish and blue hue.

How does water flow within a celery stalk?

Permeability motion be demonstrated by flow of water through celery. Both plants and people depend on capillary movement. Water travels upward from the plant's root system through stems to the leaves and branching. The nutrients and minerals that the plant requires for growth are present in the water that travels through the stem.

What was the celery experiment's outcome?

The experiment also with celery stick indicates that this occurs using specialized tubes, known as xylems, which absorb the food colouring. Celery leaves' poration speeds up the process, and you may speed it up even more by blow drying the leaves.

To know more about capillary visit:

https://brainly.com/question/15471683

#SPJ1

true/false: the primary advantages induced enzymes bestow on the cell are energy and resource conservation.

Answers

It is TRUE that the primary advantages induced enzymes bestow on the cell are energy and resource conservation.

Induced enzymes are enzymes that are synthesized by the cell in response to a specific substrate or environmental condition. The primary advantage of induced enzymes is that they allow the cell to conserve energy and resources by only producing the enzymes when they are needed. Induced enzymes help the cell to regulate its metabolism and respond to changes in its environment in a flexible and efficient way. By producing enzymes only when they are needed, the cell can avoid wasting energy and resources on unnecessary metabolic pathways. Therefore, the statement that the primary advantages induced enzymes bestow on the cell are energy and resource conservation is true.

To know more about induced enzymes

brainly.com/question/30354727

#SPJ4

how will the owls most likely be affected by a sudden sharp increase in local populations of rodents?

Answers

The owls are likely to benefit from a sudden sharp increase in local populations of rodents as they are one of the main predators of rodents.

As the rodent population increases, the owls will have more food available to them, leading to an increase in their reproductive success and survival. This, in turn, could lead to an increase in the owl population in the area. Additionally, a higher prey density could attract other predators to the area, providing the owls with potential competitors for food.

However, if the rodent population experiences a sudden decline, the owl population could be negatively affected as they rely heavily on rodents as their primary food source. In summary, an increase in the rodent population would likely benefit the owl population, but a decrease could lead to a decline in the owl population.

To learn more about competition, here

https://brainly.com/question/13298131

#SPJ4

how much does your alcohol intake increase by switching from beer to liquor?

Answers

Switching from beer to liquor can significantly increase alcohol intake, as liquor typically has a higher alcohol content than beer.

The amount of alcohol intake increase depends on various factors such as the volume of alcohol consumed, alcohol content in each drink, and the individual's body weight and metabolism.

Generally, a standard serving of beer (12 ounces) contains about 5% alcohol by volume, while a standard serving of liquor (1.5 ounces) contains about 40% alcohol by volume. This means that drinking one shot of liquor is equivalent to consuming about 2.5 bottles of beer in terms of alcohol content.

Therefore, switching from beer to liquor can result in a significant increase in alcohol intake and can increase the risk of alcohol-related harms such as impaired judgment, accidents, and addiction. It is essential to drink responsibly and in moderation regardless of the type of alcoholic beverage consumed.

To know more about alcohol intake, visit the link given below:

https://brainly.com/question/14309609

#SPJ4

a kind of mutation that can change every amino acid that follows the point of mutation is called ?

Answers

A frameshift mutation is a type of mutation that can alter every amino acid that follows the point of mutation. It occurs when a single nucleotide is inserted or deleted within a gene sequence. This insertion or deletion alters the reading frame of the gene, resulting in a different sequence of amino acids which can have serious consequences.

For example, if a single nucleotide is inserted, the amino acid sequence will be shifted forward by one codon, resulting in a completely different protein product.

Similarly, if a single nucleotide is deleted, the amino acid sequence will be shifted backward by one codon, resulting in a completely different protein product. Frameshift mutations can cause a wide range of problems, from minor phenotypic changes to complete loss of function.

For example, a frameshift mutation in a gene that codes for a hormone receptor could lead to the cell not being able to recognize the hormone, resulting in the cell not performing its usual function. As such, frameshift mutations can have serious consequences and can result in serious diseases.

Know more about frameshift mutation here

https://brainly.com/question/14364090#

#SPJ11

What are the three things all cells have in common?

Answers

Cell membrane
Nucleus
Cytoplasm

Hormones that causes love, chemical structure of them ?​

Answers

The hormones that are commonly associated with love and romantic attraction are oxytocin, vasopressin, dopamine, and serotonin.

What are the hormones associated with love?

The hormones associated with love and romantic attraction are oxytocin, vasopressin, dopamine, and serotonin.

Oxytocin and vasopressin are both neuropeptides, which means they are made up of chains of amino acids. Oxytocin is composed of nine amino acids, while vasopressin is composed of nine or ten amino acids, depending on the species. Both hormones are produced in the hypothalamus and are released from the posterior pituitary gland.

Dopamine and serotonin are both neurotransmitters, which means they are chemical messengers that transmit signals between neurons in the brain. Dopamine has a chemical structure that includes a catechol group, which is a group of atoms consisting of a benzene ring and two hydroxyl groups. Serotonin has a chemical structure that includes an indole group, which is a bicyclic ring structure containing a nitrogen atom.

Learn more about hormones at: https://brainly.com/question/8162998

#SPJ1

when a second inhibitory postsynaptic potential (ipsp) arrives at a single synapse before the effects of the first ipsp have disappeared, what is occurring?

Answers

When a second inhibitory postsynaptic potential (IPSP) arrives at a single synapse before the effects of the first IPSP have disappeared, it leads to the summation of IPSPs.

The resulting inhibitory effects are greater than that of either IPSP acting alone. This type of summation is referred to as temporal summation. Summation is the process by which neurons add up inputs received from other neurons. In the case of IPSPs, temporal summation is one of two types of summation that can occur.Temporal summation refers to the summation of two or more EPSPs from a single input over time, and spatial summation refers to the summation of two or more EPSPs from multiple inputs that occur simultaneously at different places on the postsynaptic neuron's dendrites.

More on IPSP: https://brainly.com/question/28192397

#SPJ11

if a cell required 1/64th the amount of morphogen found at the posterior pole to form part of a leg, how far from the posterior pole would the leg form?

Answers

The leg will form 1/64th the distance from the posterior pole as the morphogen concentration found at the pole.

Morphogens are substances that give rise to different cell types in a developing embryo. They diffuse from a source and create a concentration gradient that regulates cell differentiation.

Therefore, we can say that the concentration of morphogen is directly proportional to the distance from the source. If a cell required 1/64th the amount of morphogen found at the posterior pole to form part of a leg, then it should be 1/64th the distance from the posterior pole.

This means that the distance from the posterior pole is inversely proportional to the concentration of morphogen, so,

Distance from the posterior pole = k/concentration of morphogen

where k is a constant of proportionality.

If we assume that the concentration of morphogen is c at the posterior pole, then the concentration of morphogen at the distance x from the posterior pole is given by:

c/x = 1/64

solving for x:

x = 64c

Therefore, the distance from the posterior pole is 64 times the concentration of morphogen.

substituting the value of c:

x = 64 × c = 64 × 1 = 64 units.

Therefore, the leg will form 64 units from the posterior pole.

Know more about morphogen here:

https://brainly.com/question/7493873

#SPJ11

Looking at the cross between a heterozygous and a homozygous dominant animal for the trait of hair color below. Black hair is dominant (B) to white hair (b). If the father has the genotype of (BB) and the mother has the genotype (Bb), describe how you would complete the Punnett square and then describe what the possible offspring's hair color could be based on the punnett square.

Answers

In complete dominance the dominant allele hides the expression of the recessive allele. Genotype: 50% homozygous dominant BB. 50% heterozygous Bb. Phenotype: 100% black hair.

What is complete dominance?

Complete dominance is an inheritance pattern that occurs when the dominant allele of a gene masks the expression of the recessive allele. This is evident in heterozygous individuals who carry both alleles and only express the dominant phenotype.

In the exposed example, B (black hair) is dominant over b (white hair)

Cross: father x mother

Parentals) BB   x   Bb

Gametes) B   B    B    b

Punnett square)     B        B

                        B    BB     BB

                        b    Bb     Bb

F1) Genotype:

1/2 = 50% of the progeny is expected to be homozygous dominant BB

1/2 = 50% of the progeny is expected to be heterozygous Bb

   Phenotype: 100% of the progenny is expected to express black hair

You can learn more about complete dominance at

https://brainly.com/question/1953851

#SPJ1

true or false? according to bill gates's talk, covid-19 could be the last pandemic if we take the right steps?

Answers

It is FALSE that according to Bill Gates's talk, COVID-19 could be the last pandemic if we take the right steps.

While Bill Gates has talked about the importance of taking steps to prevent future pandemics, he has not made a definitive statement that COVID-19 could be the last pandemic. In fact, he has emphasized that the world needs to be prepared for the possibility of future pandemics, as viruses can emerge unexpectedly and rapidly spread across the globe. Gates has advocated for investing in disease surveillance and research, developing vaccines and therapeutics, and improving global cooperation to better respond to future outbreaks.

To know more about COVID-19

brainly.com/question/30975256

#SPJ4

which finding, when combined with the data in the passage, is most likely to lead researchers to conclude that the 5-ht2a and 5-ht2b receptor subtypes mediate serotonin-dependent liver regeneration?

Answers

The finding that the 5-HT2a and 5-HT2b receptor subtypes are involved in liver regeneration mediated by serotonin is most likely to lead researchers to conclude that these receptor subtypes mediate serotonin-dependent liver regeneration.

This is because the passage states that serotonin is involved in liver regeneration and that the 5-HT2a and 5-HT2b receptor subtypes are known to interact with serotonin. This suggests that these receptor subtypes are implicated in the process of liver regeneration and may be responsible for mediating the effects of serotonin.

Furthermore, the passage also states that these receptor subtypes are expressed in the liver and may play a role in liver regeneration. This further supports the idea that the 5-HT2a and 5-HT2b receptor subtypes are involved in mediating the effects of serotonin on liver regeneration.

Taken together, this evidence supports the conclusion that the 5-HT2a and 5-HT2b receptor subtypes mediate serotonin-dependent liver regeneration.

Know more about serotonin here

https://brainly.com/question/30822986#

#SPJ11

in the cell line that entered mitosis, why do you think there was a delay before the onset of mitosis after exposure to gamma radiation?

Answers

When a cell line enters mitosis, the delay before the onset of mitosis is because of the cell cycle checkpoint.

What is the effect of gamma radiation on cell line?

Gamma radiation is known to induce double-stranded breaks in the DNA of cells that can lead to cell death. When cells are exposed to gamma radiation, the DNA damage in the cell can cause a delay before the onset of mitosis.

During this delay, the cell activates the DNA damage checkpoint to check for any damage in the DNA of the cell. This checkpoint delay allows time for the cell to repair any damage in the DNA before proceeding into mitosis.

In summary, the delay before the onset of mitosis in the cell line that entered mitosis after exposure to gamma radiation was due to the cell cycle checkpoint.

Read more about Gamma radiation here:

https://brainly.com/question/1686231

 #SPJ11

6. Which hamsters are the parents of the mystery hamster? Include evidence to prove that they are the correct parents.

Answers

Answer:

to determine the parents of the mystery hamster, genetic testing or analysis would be necessary. The analysis would involve comparing the genotype of the mystery hamster to those of the potential parents.

If the mystery hamster has short fur, it could have a genotype of either homozygous dominant (FF) or heterozygous (Ff). In this case, the potential parents would need to have at least one dominant allele (F) to pass on to the offspring. If the mystery hamster has long fur, it could have a genotype of homozygous recessive (ff) or heterozygous (Ff). In this case, both parents would need to have at least one recessive allele (f) to pass on to the offspring.

Based on the comparison of the genotype of the mystery hamster with those of the potential parents, the correct parents could be identified. If the mystery hamster has a genotype of FF, then both of its parents must have the dominant allele F. If the genotype is Ff, then one parent must have Ff and the other parent could have either FF or ff. If the genotype is ff, then both parents must have the recessive allele f.

Therefore, the correct parents of the mystery hamster can be determined based on the match of their genotype with that of the offspring. The genetic analysis and matching of the genotype would provide the evidence needed to prove that the identified parents are indeed the correct ones

Sort each description by the type of RNA it describes (tRNA, mRNA, rRNA).
a) contains an anticodon
b) specifies the amino acid sequence for a protein
c) contains exons
d) has amino acids covalently attached
e) is a component of ribosomes
f) is the most abundant form of RNA
Multiple choice:
A) a, b, d - TRNA, c - MRNA, e, f - FRNA B) a, c - TRNA, b, d - MRNA, e, f - rRNA C) a, e, f - FRNA, b - mRNA, c, d - TRNA D) None of the above

Answers

RNA it describes (tRNA, mRNA, rRNA) a, b, d - tRNA, c - mRNA, e, f - rRNA. The Correct option A)

a) Describes tRNA, which contains an anticodon that base-pairs with a codon on mRNA during translation to bring the correct amino acid to the growing protein chain.

b) describes mRNA, which specifies the order of amino acids in a protein by carrying the genetic information from DNA to the ribosome during translation.

c) describes mRNA, which contains exons that code for amino acids and introns that are spliced out during processing.

d) describes tRNA, which has an amino acid covalently attached to it that matches the anticodon sequence.

e) describes rRNA, which is a component of ribosomes along with proteins and assists in the binding and positioning of mRNA and tRNA during translation.

f) describes rRNA, which is the most abundant type of RNA and constitutes a large proportion of the ribosome.

Therefore, the correct answer is C) a, e, f - FRNA, b - mRNA, c, d - TRNA.

Learn More about RNA

https://brainly.com/question/25979866

#SPJ4

the process that pushes food through the esophagus is called___

Answers

Answer:

peristalsis

Explanation:

Other Questions
rock produced by solidification of molten material, either lava or magma is called ?/ which emerging technology has made it possible for every enterprise to have access to limitless storage and high-performance computing? 1 point machine learning big data cloud computing internet of things Courtney has a headache, and takes 250mg of Tylenol. The amount, A of Tylenol remaining in her body after n hours is given by the formula A=250(.73)^n. How much of the Tylenol remains in her body after 4 hours? In not less than five hundred words, explain with an examples statistical hypotheses and law like hypotheses. cheese costs $4.20 per pound. if ms. Rivera spent $6.30 on cheese, how many pounds did she buy? In cambodia, the khmer rouge created_____policies that caused famine and starvation. which of the following is/are false? select all that apply. a -- it represents an embedded sub-process. b -- it represents a global sub-process c -- it represents a terminate end event d -- xor-split needs to be replaced with an and-split to avoid a behavioral anomaly. who was the first female electrical engineer in the united states? what invention is she known for? !! URGENT !! The following data points represent the number of points the Hawaii Eagles football team scored each game.17,33,28,23,10,42,317,33,28,23,10,42,317, comma, 33, comma, 28, comma, 23, comma, 10, comma, 42, comma, 3Using the data, create a histogram. 1. El ftbol en Espaa tiene unamuy grande. 2. Para muchos espaoles, el futbol se convierte en (becomes) una3. Mari Carmen cree que comete un error (makes a mistake) cuando describe al ftbol en Espaa como un4. El estadio ms grande de Europa se llamay es la casa delgracias a5. Durante un famoso juego, el Bara le gan al Real Madrid por un marcador (Score) depateado (kicked) por Ronaldinho. 6. David Beckham firm (signed) un contrato conpor 250 millones de dlares. review the demographics for each market segment. you can find an overview of the total market size and the size of each market segment on the segments/summary tab. which market segment represents the greatest portion of the entire market at close to 36%? Which series has a sum of 20? Why is Confucianism considered a philosophy instead of a religion? Confucius believed all things in nature have spirits. Confucius never wrote any of his ideas down for his followers. Confucius teachings are more about ethics and behavior than religion. Confucius believed that there is only one god. the school nurse is providing information to parents of adolescents about prevention of cervical cancer. which information is included in the teaching? 3/10 - Write a paragraph/story using at least 4 words. What is the value of f? The revenue, in billions of dollars, for a company in the year 2002 was $2.7 billion. One year later, in 2003, the revenue had risen to $3.4 billion. In 2005, the revenue climbed to $3.9 billion, before falling to $2.7 billion in 2008. The revenue, r, in billions of dollars, for the company, is a quadratic function of the number of years since 2002, x. what is the vertex of the function? heavy dna ( n15 dna), hybrid dna, and light dna ( n14 dna) can be separated by centrifugation. if cells containing n15 dna are transferred to a medium with only n14 nh4cl as a nitrogen source, what percent of daughter molecules are composed of hybrid dna after 2 generations? How did the 14th Amendment affect citizenship in the United States?It extended US citizenship to formerly enslaved, newly freed people.It limited US citizenship to people born in the United States.It limited which foreign-born people could become US citizens.It extended US citizenship to anyone living in the United States. M is the midpoint of line AB and N divides the line BC in the ratio 1:3 ,given that vector AM=a and vector AC=C(a) express vector AN in terms of a and c(b) Show that vector NM=(2a-3c)