Why is it important that animals have different characteristics? Include at least two examples of animals and their characteristics.​

Answers

Answer 1

Answer:

some animals have 4 legs and some have 2

Explanation:


Related Questions

What affect do glass panels have on temperature google doc

Answers

Answer:

wdym

Explanation:

What is the optimal pH for Enzyme B?

Answers

Answer:

6,7.77.0

Please correct Ok ?

1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?

Answers

Answer:

1.

contrast between mitosis and meiosis

Mitosis

- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)

- exact number of chromosome in offspring

- no recombination or crossing over

- no pairing found

- major phase: prophase, metaphase, anaphase, telophase

Meiosis

- takes place in sex cells to form gamete formation during sexual reproduction

- half of the chromosome number found in gametes of the parents thus, known as reduction division

- due to crossing over takes place recombination  found.

The pairing of chromosomes takes place

- major steps:

Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and

Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase

2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.

The major events are as follows:

G1- RNA and protein synthesis takes place and cell grows in size

S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.

G2-  RNA and Protein synthesis continues.

How are cancerous cells different from normal cells?

Answers

Answer:

Cancer cells differ from normal cells in many ways that allow them to grow out of control and become invasive. One important difference is that cancer cells are less specialized than normal cells. That is, whereas normal cells mature into very distinct cell types with specific functions, cancer cells do not.

Explanation:

Hope this helps ya!!

What methods would the body use to provide a
person with energy throughout a race?
DONE
C
Intro

Answers

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Therefore, during the whole process, the three energy systems used are:

the ATP-PC System

the Glycolytic system

the Oxidative system

Answer:

The methods the body would use to provide a person with energy throughout a race is using the ATP in the muscle cells for the first 3 seconds.

For the next 8 to 10 seconds, the body replaces the used ATP and produces more.

Within the next 90 seconds of the race, anaerobic respiration is used up to make more ATP (Adenosine triphosphate).

Explanation:

Explain how exercise and an active lifestyle can improve bone health
and bone density.

Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.

Answers

Explanation:

explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of

Question 2 of 9

Corn seeds were germinated (grew and put out shoots after a period of dormancy) in a dark room

placed in the light, 75 of these seedlings turned green. Which conclusion about chlorophyll (the

plants can most reasonably be drawn from this information?

(1 point)

DA. Light is the only factor that controls the production of chlorophyll

.

B. Darkness is the only factor that prevents the production of chlorophyll.

IC Light and vitamins are necessary for chlorophyll production.

D. Light and some other factor are necessary for chlorophyll production.

----Page 2 of 9----

Answers

Answer:

The correct answer is option D.  Light and some other factors are necessary for chlorophyll production

Explanation:

By this experiment, it is clear that light is the major factor that helps in the production of chlorophyll in seedlings or plants. In this study, placing the seeds in the light turns 75 seedlings green which is possible by the production of the green pigment, chlorophyll only. So, it is proved that light is a key factor in the production of chlorophyll.

Besides light, there must be some other factors (mineral nutrition and chemical metabolites) that also play role in the production of chlorophyll or increase or decrease of the chlorophyll production as few seedlings did not turn green in the study.

Which fossils provide information as to the mode of formation of an oxygen-rich atmosphere by about 2 billion years ago?

Answers

Answer:

The fossils that provide information on the formation of an oxygen-rich atmosphere are the stromatilites from the Precambrian era. These are layered and columnar fossils consisting mainly of cyanobacteria which were the original life form back then. These bacteria took in carbon dioxide and produced oxygen by photosynthesis as early as 2.5 billion years ago (the earth is about 4.5 billion yrs old).

Explanation:

What are internal structures?

Answers

Answer:

Internal structures are the inner pieces and parts that keep organisms alive, help them grow, and help them reproduce.

Explanation:

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

Identify the three types of neurons, and explain the function of each type

Answers

Answer:

Sensory neurons help you:

taste

smell

hear

see

feel things around you

Explanation:

Motor neurons

Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.

Interneurons

Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.

A baseball is tossed into the air, forming an arc. Mark the following points:
1. Kinetic energy is the highest
2. Potential energy is the highest
3. Kinetic energy is converted in potential energy
4. Potential energy is converted into kinetic energy

Answers

Answer:

it is number 3 .............

Answer:

Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.

which best describes the results of mendels work with pea plants a) he figured out the fastest way to grow pea plants. b) he showes that pea plants do not pass traits to their offspring. c) he found the basic ideas about genetics. d) he discovered the scientific method.

Answers

Answer:

its C

Explanation:

The Ebola virus can often have symptoms similar to bacterial pneumonia, an infection of the lungs. These symptoms include chest pains, shortness of breath, and fever. Which statement best summarizes the differences between these two diseases? (SC.6.L.14.6)a.Viruses can replicate because they are living organisms, while bacteria cannot. b.Viruses are not living organisms, but bacteria are living. c.Viruses can be beneficial to live organisms but bacteria are often infectious. d.Viruses are living organisms, while bacteria are not.

Answers

Answer:

Eblow is a terrible thing.

Explanation:

Answer:

I think its, option b) Viruses are not living organisms, but bacteria are living.

Explanation:

The other options don't fit "summarize the differences b/w bacteria and virus", or simply don't make sense...  

Bacteria can replicate as well, not only virus, so that cannot be a difference

The virus is often the one being more dangerous, there is something called "good bacteria"

A virus isn't  living, (for the sake of this answer), and we all know for sure that bacteria is living

So, that's how option b is correct

I hope this helped you!!

Which cell organelle is most responsible for ensuring that the cell obtains the necessary materials to maintain homeostasis?

Answers

Answer:

i’d say mitochondria

Explanation:

mitochondria is the “powerhouse of the cell”

If the atomic number of an element is 6 and its mass number is 13, how many neutrons
are
contained in the nucleus?
19
8
7
6

Answers

Answer:

There will be 7 neutrons in a carbon isotope with an atomic mass of 13.

Explanation:

The number of protons in the carbon isotope will be the same as the atomic number, 6, so if we need an atomic mass of 13 there will be 7 neutrons, as 6+7=13.

If the atomic number of an element is 6 and its mass number is 13, there will be 7 neutrons. Therefore, the correct statement is option C.

What is atomic number?

Atomic number is the number of protons found in the nucleus of an atom of a specific chemical element. The atomic number is also equal to the number of electrons orbiting around the nucleus in a neutral atom.

Mass number is the total number of protons and neutrons found in the nucleus of an atom and is represented by the symbol A. The mass number is used to determine the atomic mass of the atom.

The atomic number of an element is the number of protons present in its nucleus, which is 6. The mass number of an element is the total number of protons and neutrons in its nucleus, which is 13. So, the number of neutrons in the nucleus can be calculated by subtraction of the atomic number from the mass number.

The formula is number of neutrons = Mass number - Atomic number.

Therefore, there are 7 neutrons in the nucleus of the given element.

Learn more about the atomic number here:

https://brainly.com/question/16858932

#SPJ2

help idk this answer ​

Answers

Answer:

d

Explanation:

Higher energy contained in the sugar molecules produced by photosynthesis comes from
A. light
B. water molecules.
C. ΑΤΡ.
D. carbon dioxide molecules.

Answers

Answer:

A

Explanation:

light

ffjcddssdfghcxdsssswefgcfdd

Comes from the reduction of carbon dioxide molecules

Alana wants to measure the speed at which drops of precipitation fall to the ground in Los Angeles.
Which statement identifies a way Alana uses technology to complete her experiment?
O She observes daily rainfall data from multiple weather stations throughout the city.
O She graphs the relationship between rainfall speed and time using graphing paper.
O She analyzes a map to determine different places to collect rainfall for the study,
O She estimates how fast rain falls by studying the sky at different locations in the city.

Answers

Answer:

She observes daily rainfall data from multiple weather stations throughout the city.

Explanation:

most bacteria reproduce by

Answers

Answer: Most bacteria rely on binary fission for propagation.

Explanation: Hope this helps have a great day!

Answer: Most bacteria reproduce by binary fission, also know as propagation.

Rough ER is mostly responsible for
making -__-, whereas smooth ER is
mostly responsible for making

Answers

Explanation:

The rough ER, studded with millions of membrane bound ribosomes, is involved with the production, folding, quality control and despatch of some proteins. Smooth ER is largely associated with lipid (fat) manufacture and metabolism and steroid production hormone production.

What type of cloud is Cloud A? What kind of weather might you expect when you see clouds of this type?

Answers

Answer:

Cloud A is a cumulus cloud. When these fluffy, white clouds are in the sky, you can expect fair weather.

Explanation:

The most important part of mitosis is to correctly divide the
Cell membrane
Cytoplasm
DNA
Organelles

Answers

Answer:

DNA

Explanation:

Plants and animal cells are examples of
cells
O prokaryotic cells
O eukaryotic cell

Answers

Answer:

eukaryatic which the RH whitthakar was divided PLANTAE and animalia kingdoms in eukaryotes

For the last 30 years, human use of fertilizers has had a significant impact on the nitrogen

cycle. Which statement explains how fertilizers impact an ecosystem?

O Fertilizers increase the amount of fixed nitrogen available in the ecosystem.

O Fertilizers decrease the amount of nitrogen fixed by organisms living in the ecosystem.

O Fertilizers kill off important nitrogen fixing bacteria.

Fertilizers decrease the amount of fixed nitrogen available in the ecosystem.

Answers

Answer:

It's C

Explanation:

Hope this helped :)))

The fertilizers show a significant impact on the nitrogen cycle as the fertilizers kill off the important nitrogen fixing bacteria which are present in the soil. Thus, the correct option is C.

What is Nitrogen cycle?

Nitrogen Cycle is a biogeochemical process through which the nitrogen present in the environment is converted into many different forms, consecutively passing from the atmosphere to the soil to the living organisms and back into the atmosphere after decomposition. It involves several processes including the nitrogen fixation, nitrification, denitrification, decay and putrefaction of the nitrogen compounds.

Intensive fertilization of the agricultural soils of normal soil can increase the rates at which nitrogen in the form of ammonia is volatilized in the environment and lost to the air. It can also speed the microbial breakdown of ammonium and nitrates in the soil which results into enhancing the release of nitrous oxide. In addition to this, excessive use of fertilizers also kills the nitrogen fixing bacteria present in the soil.

Therefore, the correct option is C.

Learn more about Nitrogen cycle here:

https://brainly.com/question/1615727

#SPJ2

which enzyme attaches the ozaki fragments?

Answers

Answer:

DNA ligase,joins the okazaki fragments together into a single DNA molecule

Answer:

DNA ligase attaches the ozaki fragments.

Explanation:

In my thought it's the answer.

can somebody do 4 and 5 for me

Answers

Answer:

4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.

5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.

Explanation:

4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.

5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.

pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.

Genetic counselors work mostly with
1 school counselors.
2 researchers in genetic engineering.
3 elderly adults who live in care facilities.
4 couples who are planning to have children.

Answers

Answer: couples who are having children

Explanation:

I got it right on my quiz

What is the contour interval of this map?

Answers

Answer:bird creek

Explanation:

Which mutation below would result in the greatest amount of change in the proteins that code for a particular trait?

(Please help I will reward)


A. inserting three nucleotides

B. deleting three nucleotides

C. deleting one codon

D. deleting two nucleotides

Answers

Answer:

Mutations are errors in codons caused by changes in nucleotide bases. Some mutations may not have much effect. For example, if the codon GAA becomes the codon GAG, because the genetic code is degenerate, the codon will still code for the amino acid glutamate. Such ineffectual mutations are called silent mutations. Some mutations, however, can have a huge affect on coding for amino acids, which can in turn affect what proteins are produced, which can have a profound effect on cellular and organismal function.

Other Questions
You know the measure of the exterior angle which forms a linear pair with the vertex angle. Describe two ways you can find measures of the interior angles of the triangle. An anthem is usually a song about national pride. How is this word used ironically in Wilfred Owen's "Anthem for Doomed Youth"?His anthem is about people who refuse to enlist to serve their own country.OB.His anthem is about unpatriotic people who wage war against their own country.OC. His anthem is about undignified death and devastation in the name of one's country.OD. His anthem is about the obscenity of killing other humans in the name of one's country. What does it mean for a word to contain a feeling?A. The sound of the word seems related to the emotions it implies.B. The emotions of the word are independent of the sounds.C. The word comes from an ancient language such as Latin or Greek.D. The word does not have any synonyms or related words. Select the correct answer. Claire, an ecologist, is finding it difficult to identify an interaction in nature because of changing environmental conditions and the complex indirect interactions of multiple species. Which interaction is Claire trying to find in nature? During a period of 112 minutes, a music station played 40 minutes of commercials. Whatis the ratio of music they played to commercials they played? 9 3/4 as a percent step by step i need the answer to this please help A gas has a pressure of 65.0 mmHg at 740K. What will be the pressure at 300K if thevolume does not change? invisible force, What is most likely the meaning of the word hypothesi. O foolishly believed thoughtfully guessed O already knew o boldly proclaimed 2 3 Bob buys eggs and potatoes at the store. He pays a total of $25.92. He pays $2.57 for the eggs. He buys 5 bags of potatoes that each cost the same amount.What equation can be used to determine the cost, x, of each bag of potatoes? Video is now a permanent part of journalism. Based on what you know about the development of the photojournalism, which BEST explains how this became popular?Graphic designers were able to create chyrons to identify news organizations.Video footage became cheap and efficient to produce and could be made daily.Graphic designers prefer to work with video footage, so they changed photojournalism.Video footage is now much more available than photography, replacing photos entirely. Write out everything. Fill in the blank.1. _____ volunteered to lead westerners campaign and surveyor along the Ohio and Kentucky rivers.2. _______ a young French man bought his own ship and arrive in America in 1777.3. I was dressed as a man and fought in served battles, who I am?_____.4. The ______ were _____ foreign soldiers who fought not out of loyalty, but for pay.5. Patriot troops led by ________ captured Montreal in _____.6. ______ an experience military officer and train the American troops.7. On October 11, 1777, ______ was forced to surrender his entire army to General Horatio Gates.8. The Continental army was running very low on ___ and ___.Write these two questions in a complete sentence.1. Why did the Patriots called John Paul Jones a naval hero?2. What Marquis de Lafayette did to help support the Patriots in the Revolution Your friend and her parents are visiting colleges. They leave their home in Enid, Oklahoma, and drive to Tulsa, which is 107 mi east and 18 mi south of Enid. From Tulsa, they go to Norman, 83 mi west and 63 mi south of Tulsa. Where is Norman in relation to Enid? Ammonia (NH3) is the active cleaning ingredient in Windex and is also the main contributor to the odor of stale cat urine. Ammonia has a Hvap of 23.35 kJ/mol and a Svap of 97.43 J/molK. What is the normal boiling point of ammonia For which value of Theta is tan Theta equal to sin Theta?A. piB. pi/2C. pi/4D. pi/6 Who else hate khan academy? 4) What are all the subsets of (3, 5, 7)? A researcher studying koi fish collected data on three variables, A, B, and C. The following residual plots show the residual for a model for predicting each variable from the age of the fish.A conclusion that a linear model between the variable and age is appropriate is supported by which plot or plots?1.)A Only2.)B Only3.)C Only4.)A and C only 5.)B and C only Tristn wants to build a square garden in his backyard if the garden is going to be 64 ft2 how many feet of material will he need for the perimeter of the garden cultural traits of mexico