Who made the greatest discovery, Christopher Columbus, Bartholomeu
Dias, Vasco da Gama, or Ferdinand Magellan? Defend
your decision

Answers

Answer 1

Answer:

Ferdinand Magellan

Explanation:

l hope it's helpful to you


Related Questions

Who was the first president elected in the 20th century

Answers

Answer:

Theodore Roosevelt, I believe

Explanation:

The 20th century started in 1901, Theodore was president during 1901.

Answer:

Theodore Roosevelt

Explanation

This Theodore Roosevelt because the 20th century started in 1901 and Roosevelt was elected in 1901

Help ASAP with saq will give brainlist

Answers

Answer:

aaa Asia love kjajsjajajajzjajzkzjzjzK sorry no speak inglish

Explanation:

plis sorry bye bye

The Pax Romana was:
A:200 years of stability.
B: an experiment in democracy.
C: a giant stadium, in which gladiators fought battles.
D: a deadly plague that killed more than 30% of the population of the Roman Empire.
Please help!

Answers

The answer is A, hope this helps

How did Nazi rule affect the lives of German people? Select three answers.

The media was censored to promote only Nazi ideology.
Nazi propaganda was shown to children.
Students were encouraged to question authority and beliefs.
Intense nationalism and shows of patriotism were widespread.
Couples were encouraged to limit the size of their families.
Women were expected to attend university and work.

Answers

Answer:

See explanation

Explanation:

The media was censored to promote only Nazi ideology. (True)

Nazi propaganda was shown to children. (True)

Students were encouraged to question authority and beliefs. (False)

Intense nationalism and shows of patriotism were widespread. (True)

Couples were encouraged to limit the size of their families. (False)

Women were expected to attend university and work. (False)

Hope this helps!

The Nazi rule affect the lives of the German people are

The media was censored to promote only Nazi ideology.Nazi propaganda was shown to children.Intense nationalism and shows of patriotism were widespread.

What is Nazism ?

Nazism exists as a form of fascism, with disdain for liberal democracy and the parliamentary system. It includes fervent antisemitism, anti-communism, scientific racism, and the usage of eugenics in its creed. Its revolutionary nationalism originated in pan-Germanism and the ethnic-nationalist neopagan Völkisch movement which had been a major aspect of German nationalism since the late 19th century, and it existed strongly influenced by the Freikorps paramilitary parties that emerged after Germany's beating in World War I, from which came the party's underlying "cult of violence".

Hence, The Nazi rule affect the lives of the German people are

The media was censored to promote only Nazi ideology.Nazi propaganda was shown to children.Intense nationalism and shows of patriotism were widespread.

Learn more about Nazism refer to

https://brainly.com/question/13817923

#SPJ2

Explain how the North relied on the slaves of the South.

Answers

Answer:The northern economy relied on manufacturing and the agricultural southern economy depended on the production of cotton. The desire of southerners for unpaid workers to pick the valuable cotton strengthened their need for slavery.

Explanation:

Most white northerners viewed blacks as inferior. Northern states severly limited the rights of free African Americans and discouraged or prevented the migration of more. There was a minority of northerners called abolitionists who were vocal about ending slavery. They opposed slavery in the new territories because they were sick and tired of the South having a majority in the legislative and executive branch. Because of the 3/5s compromise, the South was able to get an upper hand at representation. As the new territories opened up, the North wanted the Wilmot Proviso. Hope this helps! Mark brainly please!

How did the Jefferson inauguration differ from the inauguration today?

Answers

Answer:

He wore plain clothes, walked to the senate and took oath of office.

Explanation:

Helped by the ONE & ONLY #Queen aka #$DRIPPQUEENMO

how did the trail of tears affect native populations in the future

Answers

The extent of the loss of life among migrants has an impact on the ability of people to maintain community structures such as clan and kin relationships. Loss of large numbers of family members through epidemic disease and the rigors of removal disrupt communities. It also decimated relations between natives and Colonial Americans.
It resulted in a lot of Cherokee people being killed and those who were not murdered were forcibly relocated into “Indian Territory”.
Hope this helps

look at picture please

Answers

Answer:

A.

Explanation:

Answer: separate but equal

Explanation: b

Immigrants form asia came to America through blank in California

Answers

Answer:

The first major wave of Asian immigration to the continental United States occurred primarily on the West Coast during the California Gold Rush, starting in the 1850s.

Explanation:

Hope this helps:)


In the Polynesian myth, the heroic god Tane spent time among the humans and became close to them. Meanwhile, the god Atea was battling for power with Tane. In order to help Tane, the thunder god, Fatutiri, gave Tane the gift of the power of lightning. He set one condition, though: Tane was not to use it against Atea until Atea was old. Tane kept his promise, and waited until Atea was gray-haired. At that time, the gods Tane and Atea battled in a fire-making contest. Using the lightning, Tane won; his fires couldn’t be extinguished. Tane killed the god Atea, but set Atea’s spirit free. After this battle, fire was given to humans as a gift because it had been made stable.

What can you infer about the ancient Polynesians and their relationship with the gods.

Answers

Answer:

The answer is A

Explanation:

I hope this helps you and have a good day! (^w^)

The Greeks believed in gods and goddesses who, they thought, had control over every part of people's lives. The Ancient Greeks believed that they had to pray to the gods for help and protection, because if the gods were unhappy with someone, then they would punish them. The gods are biased towards humans. When lucky, a god may take a liking towards a human and try to make sure that they succeed. On the other, when a god doesn't like a human they will do almost anything to make sure that the human's life is miserable.

Answer:

a

Explanation:

Who is Amelia Bloomer and what was her significance?

Answers

Answer:

She was a social activist, and worked to try to change  woman's  strict clothing styles and rules.

What major event got the US involved in the fighting of WWII?

Video Notes: https://youtu.be/Objoad6rG6U <---- Crash Course Vid

Answers

Answer:

Pearl Harbor Attack

Explanation:

Surprise aerial attack on the U.S. naval base at Pearl Harbor on Oahu Island, Hawaii, by the Japanese that precipitated the entry of the United States into World War II.

Answered by none other than the ONE & ONLY #QUEEN herself aka #DRIPPQUEENMO!!

HOPE THIS HELPED!!

What do you know about the Renaissance? Check all that apply.

It began around the 14th century.
It was a time of European exploration.
The word Renaissance means rebirth.
It was a time of advancement in the arts, science, and philosophy.
Michelangelo, Leonardo da Vinci, Donatello, and Raphael were all artists from the Renaissance.

Answers

DONT CLICK THE LINK IF YOU GET ONE SEE COMMENTS FOR ANSWER

All the statements which are given apply truly for the Renaissance. Renaissance began around 14th century which means rebirth. Thus, all of the above are correct.

What is Renaissance?

The word "renaissance" in French means "rebirth." A rebirth of classical knowledge and wisdom occurred during the Renaissance, a time in European history.

The Renaissance, a new age of study that fostered the development of novel ideas and some of the most significant moments in Human history, had a significant impact on European cultural history. The French Revolution, which altered the political climate of Europe, and the Age of Discovery, which resulted in the discovery of the continent of North America, were two of the most significant. Beginning with the 14th-century revival of study based on ancient sources, the Renaissance as a cultural movement included an inventive blooming of Latin and common literature.

Therefore, we can conclude that all of the above is correct.

Learn more about Renaissance here:

https://brainly.com/question/13577111

#SPJ3

HELP PLZ WILL MARK BRAINLEST

Answers

Answer: The answer to the first question is English. I’m not sure about the second question though. I’m really sorry

Explanation:

why were the huns so strong as a whole?

Answers

Answer:

The advantage the Huns had was that their leader was extremely capable and adaptable listening to hostages, prisoners, or anyone will a skill he needed he would absorb into his hordes. It was really Attila himself that made the Huns so successful much like Alexander's empire after his death it disintegrates.

Explanation:

The advantage the Huns had was that their leader was extremely capable and adaptable listening to hostages, prisoners, or anyone will a skill he needed he would absorb into his hordes. It was really Attila himself that made the Huns so successful much like Alexander's empire after his death it disintegrates.

Hope this helped! Bye!

Final Reflection:
Provide a short
analysis overall
presidential
performance
of James Monroe

Answers

Answer:

James Monroe was the last American President of the “Virginia Dynasty”—of the first five men who held that position, four hailed from Virginia. Monroe also had a long and distinguished public career as a soldier, diplomat, governor, senator, and cabinet official. His presidency, which began in 1817 and lasted until 1825, encompassed what came to be called the "Era of Good Feelings." One of his lasting achievements was the Monroe Doctrine, which became a major tenet of U.S. foreign policy in the Western Hemisphere.

The success of the South's economy did not depend on slave labor.truemor false​

Answers

Answer:

Explanation:

True

How did the American Revolution change the lives of African Americans and Native Americans?

Answers

don’t click on the link please report it. the answer is the american revolution gave african american and native americans right as opposed to the way they were being treated by white people


8. Leaders of decolonization movements are often seen as
__________
to the imperial country.
A.helpers
B.rebels
C.dictators

Answers

Answer:

B. Rebels.

Explanation:

Decolonization is the process by which a colonized state or nation rebels against the imperial power under whose power the colony is. This will include revolts or any form of dissatisfaction or anger against the power ruling it.

In this case, decolonization movements will aim to free the nation from the governing foreign authority. And those leaders who organize or lead such movements will be seen as rebels, terrorists, dissenters, oppositions, etc. With the aim to overthrow the power ruling them, and desiring to free the people from such ruling hands will make them 'enemies' of the imperial country. They will be seen as 'rebels', rebelling against the authority, the government, the power ruling them.

Thus, the correct answer is option B.

Some oil-rich countries around the Persian Gulf are experiencing population booms as their fast-growing economies attract foreign workers

Answers

Answer:

True

Explanation:

It is TRUE that Some oil-rich countries around the Persian Gulf are experiencing population booms as their fast-growing economies attract foreign workers.

This is evident in the fact that the Persian Gulf which covers areas such as Saudi Arabia, United Arab Emirates, Kuwait, Oman, Qatar, etc., has a population growth of economic migrants that passed over 50 percent between 2005 to 2015. This is according to Pew Research Center. The population rose from 19 million to 31 million

50 points!!HURRY

so pick two of these strategies (such as marches, legal challenges, boycotts, civil disobedience, and sit-ins) used by activists in the civil rights movement, then discuss:

1.examples of how the strategy was used.

2.how effective the strategy was, and why.

then

3.Use evidence from the lesson, as well as from your knowledge of social studies, to support your conclusions.

Answers

Answer:The most popular strategies used in the 1950s and first half of the 1960s were based on the notion of non-violent civil disobedience and included such methods of protest as boycotts, freedom rides, voter registration drives, sit-ins, and marches. hops this helps :D

While the U.S. Constitution initially gave most of the responsibility for foreign affairs directly to the President, what is the name of the separate Department that was established within the executive branch to handle U.S. foreign relations?
A. Homeland Security
B. State
C. Commerce
D. Treasury

Answers

Answer:

B. State

Explanation:

The Secretary of State deals with foreign affairs

I NEED REASONS TO LIVE IN ATHENS FOR AN ESSAY PLEASE GIVE ME REASONS + BACK ROUND INFO IF YOU CAN!

Answers

   Weather. Greece is in fact a blessed country for the weather that it has. ...

   Islands. Who has never dreamed of visiting the famous Greek islands? ...

   Safety. ...

   Food. ...

   Nightlife. ...

   People similar to Brazilians. ...

   Peaceful life. ...

   Prices and courtesies.

i hope this helps!

Safety, food..... etc

what is the difference between police investigation and police reform

Answers

Answer:

Explanation:

Police Investigation:

a criminal investigation is an applied science that involves the study of facts that are then used to inform criminal trials. A complete criminal investigation can include searching, interviews, interrogations, evidence collection and preservation, and various methods of investigation

Police reform:

The history of law enforcement in the United States includes many efforts at police reform. Early efforts at police reform often involved external commissions, such as the Wickersham Commission, that spelled out reforms but left to the police to implement them, often with limited success.

Who is the only person that can grant Henry VIII a divorce?

Answers

Answer:
Pope Clement Vll

Glad to help :)

Louis XIV is also known as _____ .
a.
“the Sun King”
b.
“the Catholic King”
c.
“The Divine King”
d.
“The Boy King”

Answers

Answer:

The Sun King

Explanation:

King by divine right. At the start of his reign, before turning to more political allegories, Louis XIV chose the sun as his personal emblem. The sun is the symbol of Apollo, god of peace and the arts; it is also the star which gives life to all things, rising and setting with unfailing regularity.

Answer:

a.

“the Sun King”

Explanation:

Known as the “Sun King,” Louis XIV centralized power in the monarchy and reigned over a period of unprecedented prosperity in which France became the dominant power in Europe and a leader in the arts and sciences

good luck

please mark me as a brainliest

During Jackson's presidency nearly all the states expanded suffrage to all _____ in the United States. Jackson supported the trends toward _____

Answers

Answer:

1. all white men

2. greater democracy for the common man

Explanation:

During Jackson's presidency, nearly all the states expanded suffrage to all WHITE MEN in the United States. Jackson supported the trends toward GREATER DEMOCRACY FOR THE COMMON MAN.

Andrew Jackson's period as the President of the United States was characterized by many things among which is Jacksonian democracy and the rise of the common man. This includes conceptions of expanded suffrage, manifest destiny, patronage, laissez-faire economics, among others.

Answer:

1. White Men

2. Involving common people in the democratic process

Explanation:

I took the test on edmentum


What even became a symbol of America's lack of support for the Vietnam
Conflict?

Answers

The USA became involved in Vietnam because it feared the spread of communism. The United States got involved in the Vietnam conflict to keep communism from spreading throughout Southeast Asia.

Will give brainliest:

A classmate asked me to send a pic of my Spanish assignment. I’m a nice person but how do I tell her no nicely? I don’t want to face consequences of plagiarism if she steals the answers. What do I do

Answers

Answer:

Just explain that you dont want to as you don't  want any trouble for either of you.You are under no obligation to give her your answers.

Explanation:

Just be honest that’s all it takes you don’t need to explain honesty goes a long way

Why should you be skeptical when viewing posts on the internet?

Answers

Answer: becuase sometimes posts are bias.

Explanation: if a post say 1 billion dollar giveaway but asks for emails and pws and stuff its probably scam

Other Questions
Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line?