Which question about dogs could be answered through scientific investigation

Answers

Answer 1

Answer:

How fast does an Australian terrier grow? is a dog question that could be answered scientifically because growth can become a dependent variable that can be influenced by independent variables such as food, water, habits, and others.

Explanation:


Related Questions

Select the correct answer.
Which activity does NOT contribute to global warming?
OA Driving cars
B. Releasing gases
C. Walking
OD Burning fuel

Answers

Answer:

walking

Explanation:

C. Walking doesn’t cause any harm to the environment or cause any sort of environmental change due to global warming issues. Walking is safe opposed to using fossil fuels.

If you know that small sharks and large sharks are the top two consumers in a food chain, which of the
following pairs would start your food chain?
O dinoflagellates, ocean sunfish
O copepods, ocean sunfish
energy from sun, dinoflagellates
O energy from sun, copepods

Answers

Answer:

Dinoflagellates

Explanation:

Dinoflagellates are algae

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Answers

Answer:

1. heat is collected from the earth

2. heat is used to change water into steam

3. steams turns a turbine

4. generators produce electricity

Explanation:

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

Answers

Answer:

Well I need more information to answer that question.

Explanation:

Explanation:

can I have a picture of the question please


5. Explain the process through which natural selection can lead to a new species of organism.

Answers

Answer:

Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to specistion, where one species gives rise to a new and distincly different species.

LOOK AT PIC!!!!!!!!!!!!!

Answers

Answer: black

Explanation:

Yes

Answer:

wow it is blank

Explanation:

please help with this biology question!

Answers

Answer:

mito

Explanation:

Answer: mitochondria

Explanation: don't have mitochondria for energy production, so they must rely on their immediate environment to obtain usable energy

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

The salamander is an amphibian, so it has a as it grows and develops. The adult form is different from the larva because the adult .

Answers

Answer: The options are not given, here are the options from another website.

A. metamorphis

B. pupae stage

C)simple life cycle

Question 2

A)breathes through lungs

B. forms a pupa

C. lives completely underwater

The correct answers are A A.

Explanation:

Salamander go through process of metamorphosis that reproductive changes. They have a larvae stage that breathe through gills because the larvae are inform of a fish and gave gills for respiration while the adults breaths through lungs. The larvae stage develops 30 days after hatching and can possibly change into an adult like 60 after hatching.

Answer:

metamorphosis

Breathes through its lungs

I hope this helps

What does "reliability" mean in these sentences?

Answers

Answer:

The first one is correct

Answer: The first one, the quality of being able to be trusted.

Don't really know how to explain but being reliable is being trustworthy and responsible.


Students are growing plants in pots on the windowsill of
their classroom. After spring break, a student notices
that one of the potted plants furthest from the
windowsill has changed shape, as shown below....Which
statement best explains why this plant grew at a
different angle? *

A) A plant growth hormone accumulates in the shaded side
of the stems, causing the lower leaves to fall off.

B) A plant growth hormone accumulates in the shaded side of the stems, stimulating those sides to grow faster and
bend toward the light.

C) A plant hormone accumulates in the unshaded side of
plant cells, causing the plants to grow. much faster

D)A plant hormone accumulates in the shaded side of plant
cells, stimulating the plants to produce more flowers.

Answers

Answer:

ANSWER : B I think i am not sure i hope it helps

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Answers

Cutting chicken and tomato on the same cutting board

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

GVC – Understand how humans depend on and affect natural resources.
Learning Targets:
ESS4.1 – Construct an explanation for how the availability of natural resources, the occurrence of natural hazards, and changes in climate affect human activity.
ESS4.2 – Use computational thinking to explain the relationships between the sustainability of natural resources and biodiversity within a system.
ESS4.3 – Design solutions for developing, managing, and utilizing energy and mineral resources based on cost benefit rations on large and small scale
ESS4.4 – Design solutions for a major global or local environmental problem based on one of Earth’s systems.

Answers

Answer:

Hope It Help

Explanation:

That's all I know

energy is stored during photosynthesis. true or false

Answers

True because plant needs them

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

Name one basic characteristic for classifying organisms.
If you are sure then only give the answer otherwise you can leave.​

Answers

Answer:

The more basic characteristic for classifying organisms is the kind of cells they are made of because different organisms may share same habitat but may have entirely different form and structure.

I hope it's helpful for you...

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in the mountains will change over the next 1,000 years (assuming conditions remain stable)?

Question 2 options:

I predict that the proportion of individuals with big blood vessels living in the mountains will decrease because there is a variation in blood vessel size and those with the smaller blood vessels can store more red blood cells than larger vessels, so more oxygen can be moved to the body cells. Therefore, they have a better chance of surviving and passing this trait on to their offspring.


I predict that the proportion of individuals with big blood vessels living in the mountains will stay the same because there is a variation in blood vessel size and that variation will remain in a population. The is what is so cool about humans, we are all so unique.


I predict that the proportion of individuals with big blood vessels living in the mountains will increase because there is a variation in blood vessel size and those with the bigger blood vessels can deliver more oxygen to the body cells and therefore have a better chance of surviving and passing this trait on to their offspring.


I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Answers

Answer:

Over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the number of red blood cells it makes, not its blood vessels.

Explanation:

Evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection

What is blood vessels?

The blood vessels are the components of the circulatory system that transport blood throughout the human body.

I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Hence, option D is correct.

Learn more about blood vessels here:

https://brainly.com/question/4601677

#SPJ2

Explain how a school bus uses all of these energy types.

-Mechanical
-Chemical
-Electrical
-Thermal

Answers

Answer:

Mechanical

94 percent of all school buses in America are powered by diesel engines because of their reliability, durability and safety. Almost half of these (46 percent) rely on the cleanest, near-zero emission diesel engine technology.

Chemical

school bus uses petroleum as chemical potential energy.

Electrical

An electric bus draws electricity from the power grid and stores it in a battery that can be recharged once the electricity has been used up. This basically mirrors the way our electronics work. We plug them in and let the battery charge and then use them wirelessly until it's time to charge again

Thermal

They heat the cold coolant from engine's block to 160° F in as little as one hour, then pump it back to the vehicle's engine and heat exchangers. The result: engine is preheated and the vehicle's heat exchangers distribute an abundance of heat to the vehicle's interior.

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

Answers

Answer:

A and C would least be affected

Explanation:

because a doesn't live off of insects and see if insects do disappear it still has seed stuff all back on

Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

What is the survival of the fittest?

This theory suggests that the fittest organisms survive in the environment and reproduce.

The fittest organisms have most of the required traits to survive. Bird A eats the seeds, Bird -B eats the insects, and bird C eats both seeds and insects,

Therefore, Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

Learn more about survival of the fittest:

https://brainly.com/question/1226176

Compare primary succession and climax community. Be sure to identify how long-term survival of species is dependent on resources that may be limited.

Answers

Answer:

Primary succession is the colonization of species of organisms on life-less barren lands after a volcanic eruption, newly formed land, or sand dunes. Lichens and mosses are the known primary succession community of organisms that helps in developing conditions for secondary succession by breaking rocks and providing soil.

After a fair amount of time, there are new species of organisms that grow and colonize in the land and these are, and ultimately the community becomes fairly stable. A climax community is a more stable, mature community that undergoes little or no change which can live for hundreds of years on the land.

The long-term survival of species is dependent on various kind of resources that may be limited, this can be explained by the lichens and mosses that have enough amount of nutrition and resources during primary succession but as new organism comes with complex structure and competes with these lichens and mosses their number decline due to limited amount of resources.

How can G and cloning be used in medical science

Answers

Answer:

for testing differnt cures on animals

Explanation:

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

Answers

Answer:

losing weight after childbirth

Explanation:

This contributes to the disease being the second leading cause of death of Americans. Losing weight after childbirth.

What can high blood pressure cause?

Factors that can lead to high blood pressure have: A diet high in salt, fat, and/or cholesterol.

Chronic diseases such as kidney and hormone problems, diabetes, and high cholesterol.

Family background, quite if your parents or other close relatives have high blood pressure.

Thus, option "A" is correct,  Losing weight after childbirth.

To learn more about childbirth click here:

https://brainly.com/question/16013075

#SPJ2

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

Other Questions
Can someone help me I dont know the answers convert 5.3 g water to mL water Alana bought fabric to make scarves lf the fabric costs $5.50 per yard how much fabric did she buy for $26.40?A 0.48 yards B 2.4 yards C 4.8 yards D 48 yards PLEAS EHELP ME I AM BEGGING YOU!!!!!!! EXTRA POINTS AND BRAINLIEST Question 7 (10 points)What is the best way to clean raw produce and reduce your risk of food poisoning?abWash the produce with soap and warm water, if it's firm scrub with a clean vegetable brush then wash with soap and warm wasSpray the produce with a solution of 1 cup vinegar to 4 cups water, then rinse.Gently rub the produce under cold running water, if it's firm scrub with a clean vegetable brush under running water,Soak the produce in cold water for 10 minutes, then rinse in warm water.dQuestion 8 (10 points)Foods that spoil easily are also known as perishable foods or potentially hazardous foods.TrueFalseQuestion 9 (10 points)Which of the following actions does NOT help prevent cross-contamination?abDiscard and do not reuse any sauce or marinade that has be used on raw foods.Rinse raw meat and poultry before preparing food.Wash dishes and utensils that have been used for raw meat, poultry, seafood or eggs before using them again for other foods.Keep raw meat, poultry, seafood, and eggs apart from other foods in your shopping cart, grocery bags and refrigerator.dHelp!! the area of the retina on which the light rays focus is the how does dna control the traits of living organism? Order the number \pi ,3, and \sqrt(11 )from least to greatest how long does it take for caterpillars to turn into butterflies imagine you are the nurse manager for nurses on your floor. ever since the new patient management system came online, productivity has been lower than expected. under which circumstance do you decide to develop a training program for the nurses? How did American independence affect women?A.It gave women rights equal to those of men.B.It guaranteed that women would be protected from mistreatment.C.It gave women a larger role in government.D.It failed to give women rights or protections. What would you do to both sides of the equation to solve for x?10x=5 Which is a signal word for simple present? * 1.now 2.last year 3.often 4.ago What is a hung jury? "Quitters Inc." by Stephen KingCrossword puzzle Plz I need help this is due in 3 hours What information is entered into Block 4 on the CMS-1500 claim for a workers' compensation case? Which of the following is true statement about speed?a) Speed has no magnitude and direction b) Speed has magnitude but no direction c) Speed has both magnitude and direction D) speed has magnitude but no direction De qu forma interpreta usted la metfora utilizada por Jorge Manrique nuestras vidas son los ros / que van a dar en el mar / que es el morir What is the value of the 3 in this number?5,400,387,214 is the value of this number. which of the following companies is the easiest type to set up