Which of the following is correct about turnover number (kcat) and the specificity constant for an enzyme?
A. The kcat reveals how well an enzyme works.
B. kcat Vmax/[ES]
C. The specificity constant is defined as (kcat)(Km)
D. The specificity constant is defined as kcat/Km.

Answers

Answer 1

Answer:

B

Explanation:

Specificity constant-The ratio of Kcat/Km is called as specificity constant.

 Kcat-Turn over number

 Km-Michaelis constant

Specifictiy constant is the measure of enzyme efficiency .


Related Questions

2. Based on your results, can any conclusions be draw as to the types of habitats likely to contain the most microbes?

Answers

Answer:

Yes.

Explanation:

Yes, conclusions can be drawn from the types of habitats the most microbes likely to present because different microbes needs different types of environmental conditions. Some microbes needs moist and cool environment and can't survive in warm and dry environment while some microbes survive in dry and warm environment and die in moist and cool environment so we can draw conclusion from their habitat types.

Two rabbits have different parents. One rabbit has ears that flop over, and the other rabbit has ears that stand straight up. Why do the rabbits have ears with different shapes?

Answers

Answer:

The rabbits have different versions of the gene for ear shape, which instruct for different proteins that make differently shaped ears. A Father sheep has curly wool while a Mother sheep has straight wool.

Explanation:

I majored in Biology

Answer:

Explanation: Each rabbit has a different ear shape because they have different versions of the gene for ear shape that connect together to make different ear shapes. - D

Chromosome structure can be microscopically observed best during​

Answers

i believe the answer is mitosis

Monitoring levels of which two gases would help determine the human
impact on air quality?
A. Methane
B. Water vapor
C. Carbon dioxide
D. Oxygen

Answers

Answer:

A. Methane  

C. Carbon dioxide

Explanation:

Methane and carbondioxide are the two gases that determine the human  impact on air quality because these gases are produced due to human activities. Methane gas is used in homes for cooking and heating purpose while on the other hand, carbondioxide gas is released from burning of fossil fuels in the engine of vehicles and industries for making different products. These two gases greatly affect air quality.

Answer:

a and c your welcome my children

Explanation:

Which is a step of the scientific method in environmental science? A. Testing a hypothesis B.Carrying out research C.Collecting ideas from boocks is a step in the scientific method. The step that follows this step involves forming A.a judgment B.a conclusion C .notes .

Answers

Answer:

The correct answer is Option B (Carrying out research). The step that follows this step involves forming B.a conclusion

Explanation:

The Natural environment  around us is a function of both the living things and the non-living things. So, environmental science is the study of the natural environment around us. This study includes how to tackle environmental problems and further study on how humans could be impacted by the interactions with their environment. The scientific method is a step taken towards ensuring development in a field by bringing new discoveries and challenging existing beliefs through scientific tests and research. Generally, for most scientific methods of many fields, it starts with:

1. Observations

2. Making inquiry which involves asking questions

3. Forming a hypothesis, which means making untested assumptions

4. Conducting an experiment to check the hypothesis

5. Analyze the results

6. Publish the results

The correct answer is Option B (Carrying out research). Because it involves the scientific method highlighted above. The step that follows this step involves forming B.a conclusion

Do all three bird species occupy the same niche? Explain .

Answers

Answer:

None of the birds have the same niche.

Explanation:

They all have different niches because of the food they ate. Over time, they were gentically changing to adapt to their own food.


Citrus trees create their seed by a method of asexual reproduction by a process called

Answers

Answer:

Some plants can produce seeds without fertilization. Either the ovule or part of the ovary, which is diploid in nature, gives rise to a new seed. This method of reproduction is known as apomixis. An advantage of asexual reproduction is that the resulting plant will reach maturity faster.

Explanation:

Answer:

Apomixis

Explanation:

Apomixis is the method of asexual reproduction.

Hope this is correct, have a great day.

Can the change in cyclin concentration during mitosis be explained by the fact that the cell divides in two and thus divides the material in the cell into two smaller volumes

Answers

Answer:

No, because cell division is expected to decrease not only the net amount of cyclin molecules in daughter cells but also the volume of these daughter cells compared to the original parent cell, and therefore the concentration should be nearly equal.

Explanation:

When a cell divides to produce two daughter cells, the cell components including its previously duplicated genetic material (DNA), organelles, signaling molecules, fatty acids (lipids), proteins, etc., are distributed into daughter cells. These daughter cells have a smaller volume compared to the original parent cell. In consequence, the concentration of cellular components (including cyclin proteins) should be similar between parent cell and daughter cells.

Are you for, against or undecided on GMOs? Explain.
Please give your opinion <3

Answers

Answer:

AGAINST for sure

Explanation:

ive personally raised GMO animals and they have no life. like chickens at the age of 8 weeks the breasts on GMO chickens are so large they are unable to walk and if u do not butcher them they will have heart attacks at around 9 weeks. they also dont get to go outside and walk around bc that makes them lose weight. so most of the GMO chickens do not get to go outside and actually have clean air. let alone see the sun light and stand in grass.

Empathy means that you can communicate well with others.
A.
True
B.
False

Answers

Answer:

A. true

Explanation:

i mean if you have empathy then yeah it's true

Answer:

A

Explanation:

It means you have the ability to feel what someone is experiencing.

What is the after effect of increased temperature in the atmosphere?​

Answers

Answer:

global warming

Explanation:



Match each cloud type with its image.

Cirrus
Cumulus
Stratus
Cumulonimbus
Fog

Answers

The name of the clouds with respect to its image are given below:

A ----- Cumulonimbus.B ----- Stratus.C ----- Cirrus.D ----- Fog.E ----- Cumulus.

What do you mean by Clouds?

Clouds may be defined as an observable mass of particles of crystallized vapor suspended in the atmosphere of a planet or moon.

The major function of the clouds is to prevent yourself from the sun's intense heat during the day while to limiting the extremely cold at night.

Therefore, it is well described above.

To learn more about Clouds, refer to the link:

https://brainly.com/question/1783904

#SPJ2

Explain how the structure of DNA is important in the synthesis

Answers

Answer:

DNA is the primary genetic material contained within your cells and in nearly all organisms. It's used to create proteins during protein synthesis, which is a multi-step process that takes the coded message of DNA and converts it into a usable protein molecule.

Explanation:

Economic impact of aflatoxin on health and agriculture

Answers

Answer : contamination in crops results mainly from a reduction in marketable volume

Aflatoxin consumed contributes to the mutagenic , carcinogenic , teratogenic , and immunosuppressive health effects in humans.

The direct economic impact of aflatoxin contamination in crops results mainly from a reduction in marketable volume, loss in value in the national markets, inadmissibility or rejection of products by the international market, and losses incurred from livestock disease, consequential morbidity and mortality.

I don’t understand how to do this

Answers

Answer:

Translation: GAUGCUUCCAACGACCACTA

Transcription:

GTACGAAGGTTGCTGGTGAT

GATGCTTCCAACGACCACTA

Explanation:

Which of the following statements is true? The shape of DNA is a triple helix. DNA mutations never affect an entire chromosome. Mutations in egg and sperm cells are inherited by offspring. Reginald Punnett discovered patterns of inheritance during pea plant experiments.​

Answers

Answer:

Reginald Punnet discovered patterns of inheritance during pea plant experiments

Explanation:

is there more than one right answer

✧・゚: *✧・゚:*  Answer:  *:・゚✧*:・゚✧

✅ Reginald Punnett discovered the theory of incomplete dominance during flower experiments.   ~ ₕₒₚₑ ₜₕᵢₛ ₕₑₗₚₛ! :₎ ♡ ~

3. Scientists who study the cell cycle use fluorescent dyes and lasers that enable them to measure the DNA content of individual cells. They can count the number of cells with 2N and 4N DNA content, as well as in between 2N and 4N (greater than 2N, but not quite 4N yet). a. In what phase(s) of the cell cycle will cells have 2N DNA content

Answers

Answer:

G1 phase

Explanation:

The cell cycle is divided into 2 major phases

1. The interphase

2. The m phase

The interphase, in chronological order, is further subdivided into

G1 phaseS phaseG2 phase

Cells grow and develop at the G1 phase while the G2 phase is characterized by protein synthesis in addition to continued growth.

The DNA of a cell in interphase is doubled at the S phase. This means that if a cell has a 2N amount of DNA at the beginning of the S phase, the amount of DNA at the end would have become 4N. This amount of DNA is shared into 2 daughter cells in equal amounts during mitosis or the m phase, meaning that each daughter cell would have a 2N amount of DNA before entering the interphase.

Hence, cells will have 2N DNA content in a period that spans through the end of the m phase of the cell cycle to the beginning of the S phase of the same cycle. This means that cells at the G1 phase would be the ones with 2N DNA contents.

Cell grows and prepare itself for replication in the G1 phase cell cycle. In G1 phase of cell cycle, cell is in 2n state.

Cell Cycle:

Cell cycle is the life cycle of the cell in which cell grow and divide. This completes in 2 phases,

InterphaseM- phase

Interphase:

Cell grows in this phase and prepare to divide. This includes 3 phases,

G1 phase In this phase cell, grow and prepare for replication.S- phase : Cell synthesizes its DNA via replication. In S- phase cell is in 4n stage. G-2 phase: Cell prepares itself for division.

M- phase:

Cell condenses its chromosome and divide into 2 cell.Since, cell replicates its DNA in S-phase.

Therefore, in G1 phase of cell cycle, cell is in 2n state.

To know more about the cell cycle, refer to the link:

https://brainly.com/question/11009129

Someone please help me

Answers

Answer:

Your answer is D) Graduated Cylinder.

Answer:

Graduated cylinder

Explanation:

Liquid volume is typically measured using specific tool called graduated cylinder.

Which of the following is the major concern with utilizing forensic DNA testing?
O keeping Innocent people out of all
treating genetic diseases as early as possible
a violation of privacy
a violation of the law

Answers

Answer: a violation of privacy

Explanation:

A person's DNA cannot be changed as it is their genetic information. It is therefore their most private information and when it is utilized in forensic DNA testing, it runs the risk of invading a person's privacy.

Forensic DNA testing works by comparing the subject DNA with a DNA database. Using this database means going through the DNA of millions of people without their consent.

This is their most private information and it is being stored and accessed without permission. Critics say that this is a violation of privacy and many studies have showed that this is a major concern

Matter and energy always flow from the
in ecosystems.
A. consumers to the producers
B. heterotrophs to the autotrophs
C. autotrophs to the consumers

Answers

Answer: When organisms use organic matter for cellular respiration, ALL the goes back into carbon dioxide, water, and minerals, while ALL the energy leaves the ecosystem as heat. So matter cycles, energy flows through ecosystems. So It is C

Explanation: A. The producers generate food for themselves and others; consumers do not produce anything, instead eating producers, other consumers or both.

B. Autotrophs make food for their own use, but they make enough to support other life as well.Heterotrophs cannot make their own food, so they must eat or absorb it.

So C is correct

Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

What is ecosystem?

The energy flow in the ecosystem is one of the important factors that enables the survival of such a huge number of animals. An ecosystem is made up of a network of connections between living and non-living elements.

All of the energy needed by living things is provided by the sun. About 1% of all radiant energy is absorbed by green plants and distributed throughout the ecosystem.

According to the first law of thermodynamics, energy cannot be generated or destroyed. The energy source, in this case solar energy, cannot be created or destroyed. It can only be moved from one system to another, just like a form is moved from one form to another.

Therefore, Matter and energy always flow from the in ecosystems from autotrophs to the consumer.

To learn more about energy, refer to the link:

https://brainly.com/question/1932868

#SPJ2

Explain what happened to the spread of the infection as more individuals were vaccinated.

Answers

Answer: As a result of more people being vaccinated the spread of the infection slowed down.

Why is crossing over of the chromosomes during meiosis
important?

Answers

Because it increases the genetic variability, offering more combinations of genotypes.

Scientists find the fossilized remains of a fish in the middle rock layers of a research site. They find the fossil of an insect in the lowest rock layers.
What can be concluded from this evidence?

A. the insect lived before the fish

B. the insect lived on the bottom of the ocean that the fish lived in

Answers

It is A I think the insect lived first and so it is under because it is under a different layer so if they were around at the same time and the fish was just under water it would be in the same layer of rock but because it is different rock it was not around at the same time

A change in DNA could alter the amino acid order which will affect the folding of the protein, and therefore it's function.

Answers

Answer:

true

Explanation:

Which molecule in the equation represents food energy made by plants? A Carbon dioxide B Water C Glucose D Oxygen

Answers

Answer: Glucose

Explanation: Photosynthesis is a set of chemical reactions that uses energy from the sun and carbon dioxide to produce sugar and oxygen. The sugar provides plants with energy to grow.

How does the mitotic spindle ensure that each daughter cell receives a full complement of the genetic material in the cell nucleus

Answers

Answer:

The mitotic spindle attaches to the kinetochores at the centromeres of the chromosomes and then it moves toward the poles of the cell. Thus, sister chromatids are separated simultaneously at their centromeres so that each daughter cell will have the same genetic material as the parent cell (i.e., daughter cells will be genetically identical to the parent cell).

Explanation:  

The mitotic spindle is a structure composed of microtubule proteins whose function is to ensure the correct segregation of the chromosomes during mitosis. During metaphase, microtubules from the mitotic spindle bind to the kinetochore (a protein complex assembled on the centromeric region) in order to align sister chromatids on the metaphase plate. Subsequently, during anaphase, the mitotic spindle moves toward the poles of the cell, thereby sister chromatids are separated from each other. In consequence, each daughter cell will have the same amount of genetic material (i.e., the same number of chromosomes) as the parent cell.

At a warm front warm air meets and moves cold air

Answers

what? what u need?!!!!

Difference between second level consumer and third level consumer

Answers

Answer:

Second-level Consumers - consumers that get their energy from first-level consumers and/or producers. Carnivores - organisms that eat only other animals. Third-level Consumers - consumers that eat second-level consumers and/or first-level consumers.

What does light years measure

Answers

A light-year is how astronomers measure distance in space, hope this helps ^^

Answer:

Light year measures distance in space

Explanation:

it is mostly used to estimate very far distances and so it might take us about 24 million light years to travel to another galaxy and so on

When shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. What type of inheritance is this

Answers

Answer:

Co-dominance.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

In Genetics, co-dominance can be defined as a phenomenon in which two (2) alleles of the same gene are present in a living organism and both are equally expressed to a degree or simultaneously.

This ultimately implies that, co-dominance is a phenomenon that typically involves the relationship between alleles i.e the two (2) versions of a gene present in living organisms. Also, a single version of a gene expressed by a living organism is referred to as an allele.

In this scenario, when shorthorn red cattle are bred to shorthorn white cattle, they produce roan (red and white hairs interspersed) offspring. Therefore, this type of inheritance is known as co-dominance because the two (2) alleles (shorthorn red and shorthorn white) are expressed equally or simultaneously in their offspring i.e a roan.

Other Questions
ASAP PLA I WILL GIVE BRAINLIEST After the fall of the Western Roman Empire, what filled the void left by the disintegration of the political strusture0 dark ages0 enlightment0 golden age0 renaissance 3/5k - 5 = 7/10k HURRY What is the name of an an exact copy of a DNA segment? 5 points, brainliest, and a 5-star rating. Translate the sentence into an inequality.The sum of 2 and b is less than 18. 1. Which of the following is part of the plot of The Twelve Dancing Princesses?A magnificent ballroom, with lights, flowers and mirrors all around.Lina's sisters are snobby, stuck up and judgemental.Michael discovers how the princesses wear out their shoes every night.Love is worth fighting for.ILL GIVE 100 POINT PLZLZLZLZLZPZPZLZOZPLZPZLZ 950 J of energy is used to heat an unknown mass of copper from 20.0 C to 95.0 C. The specific heat of copper = 0.39 J/(gC).What is the mass of the copper? The line AB is shown on the grid.b)Find the equation of the lineperpendicular to AB and passingthrough the midpoint of AB. The equation c=0.09sc=0.09s gives the amount cc (in dollars) of commission a salesperson receives for making a sale of ss dollars.Whats the independent and Dependent variable A 12-foot ladder is leaning against a wall. The distance from the base of the wall to the base of the ladder is 6 StartRoot 2 EndRoot feet. Given this information, what can be determined about the triangle formed by the ground, wall, and ladder? Check all that apply. The triangle is isosceles. The leg-to-hypotenuse ratio is 1:StartRoot 2 EndRoot. The leg-to-hypotenuse ratio is 1:StartFraction StartRoot 2 EndRoot Over 2 EndRoot. The nonright angles are congruent. The ladder represents the longest length in the triangle. Find the exact length of the third side? Help Me fast please2[3(4+1)]-2 what is the slope of this graph? it has to be simplified. PLEASE ANSWER ASAP guys pls help me I need to know which one is composite!!!Which is a composite number?3343193 Liquid waste that exits the body is _____________ and solid waste is ___________.A. Feces, UrineB. Urine, FecesC. Lymph, FecesD. Blood, Lymph What is the answer I got it wrong someone pls help Would it be B? Let me know USE MY BINGO CLASH CODE TO EARN EXTRA DIGS!! WIN REAL MONEY WITH BINGO CLASH!! My code is: EWaC5tT Julie has three free hours on her Saturday afternoon and two things she wants to do. First, she wants tocomplete the math assignment that is due on Monday for school because she has no time to do it on Sunday.Secondly, she wants to go get coffee with her best friend, Carol. Julie decides to spend two hours completingher math assignment.If she decided to increase her current marginal benefit by one unit (one unit equals one hour), what would be themarginal cost of that decision?A. She would have no time to spend with Carol.B. She would be able to spend one hour with Carol.C. She would be able to spend two hours with Carol.D. She would be able to spend all three hours with Carol. How do you think the country would be different if Washington was struck by one of the four bullets during the French & Indian War? Explain.Tell me why you think that