Which choice best revises the sentence so that it offers
text evidence from The Boy Who Harnessed the Wind?
Read this sentence from a student essay and then
answer the question,
In The Boy Who Harnessed the Wind, William faces the
villagers, who think he is foolish.
O In The Boy Who Harnessed the Wind, William climbs
the windmill and faces the villagers, who think he is
foolish,
O In The Boy Who Harnessed the Wind, William faces
the villagers, who think he is foolish, which is why I
call William "the bravest boy ever."
O In The Boy Who Harnessed the Wind, William bravely
and calmly faces the villagers, who think he is foolish.
O In The Boy Who Harnessed the Wind, William faces
the villagers, who think he is foolish and utter such
things as, "Let's see how crazy this boy really is."
Mark this and retum
Save and Exit
Next
Submit
US

Answers

Answer 1

Answer:

The answer is b

Explanation:

The answer is b because use text evidence and I use text evidence

Answer 2

Answer:

I think it is C sorry if I am wrong!

Explanation:

To me It makes the most sense!


Related Questions

Which word in the passage is used in a primarily connotative way?
A large part of getting in shape is staying focused on your day-to-day
goals. In other words, concentrate on the few feet of pavement in front
of you, not the miles of road ahead.
A. miles
B. large
C. words
D. front

Answers

Answer: Miles

Explanation: APEX

Which statement is false?

A. The space program capitalized on live media to cover its launches and maintain public interest in the program.
B. The media interest in the space program and the success of the space program fueled the economy by marketing products that were linked to space exploration.
C. The astronauts for the Apollo 11 mission were carefully chosen by NASA for their experience, knowledge, character, and values.
D. John F. Kennedy’s lack of likability in the media made his goal to walk on the Moon a national joke.

Answers

Answer:

I think it is d.

Explanation:

Answer:

D

Explanation:

who does a poem of life can be in a life experiences​

Answers

OCTAVIO PAZ “THE STREET”

It’s a long and silent street.
I walk in the dark and trip and fall
and get up and step blindly
on the mute stones and dry leaves
and someone behind me is also walking:
if I stop, he stops;
if I run, he runs. I turn around: no one.
Everything is black, there is no exit,
and I turn and turn corners
that always lead to the street
where no one waits for me, no one follows,
where I follow a man who trips
and gets up and says when he sees me: no one.

As the senior prefect of your school,write a letter to the headteacher, discussing two reason why the school instil moral values into the students ​

Answers

Answer:

See explanation

Explanation:

Universal Model School,

90 Aba Oweri Road,

Aba.

October 12, 2020.

The Principal,

Universal Model School,

Aba.

Sir,

NEED FOR MORAL AND ETHICAL REORIENTATION OF STUDENTS

It is with utmost expediency that I write this letter to you in my capacity as the senior prefect of Universal Model School Aba in the 2020/2021 school year.

Sir, our school has been known in Aba, Abia State and Nigeria in general as the epitome of discipline, East of the Niger. However, all of these gains appear to be speedily eroded in recent times. Lately, the school has witnessed disturbing acts of rascality by certain unscrupulous elements among the students and commensurate disciplinary action is yet to be meted out on these erring students. It is against this backdrop that I write this letter.

Sir, the necessity of inculcating sound moral values in students can not be over emphasized. This institution can be regarded as a microcosm of the larger society. It is a place of formation, the values learnt here determine the moral destiny of the larger society in the coming years. For this reason, school activities must not only be tailored towards achieving excellence in academic subjects, but achieving excellence in character and morals.

Similarly, the legacy of Universal Model School Aba as an epitome of discipline appears to be in ruins due to the level of moral decadence exhibited by some students. If these trends continue to go unchecked, annual enrolment in our school will begin to decline because parents may begin to loose confidence in the potential of Universal Model School Aba as a place of moral formation.

Sir, I urge you to use your good office to expedite action on this matter of restoration of moral values in our school.

Thanks in anticipation of your positive response.

Yours Faithfully,

ЮЯЮЭ

Jude Chinonso Njoku

Senior Prefect

The way into the woods through with trees was narrow

Answers

Answer:

Can't see the forest for the trees

Answer:

tight or slim

Explanation:

the way was tight

Plz need help ASAP Will mark BRAINLIEST and give 5 stars.

Please respond to the following in a brief paragraph of at least 150 words. Use examples from the discussion to explain your ideas Consider the different connotations that you examined benveen yourself and your peers in this section What similarities did you notice amongst your responses? How is it possible that you share similar understandings of these connotations? What conditions cause an understanding to be shared across time and cultures​

Answers

Answer:

Explanation:

What conditions cause an understanding to be shared across time and cultures? Is a lack of consistent communication a common barrier to shared understanding? How might self-presentation affect communication? How might the competitive self-promotion of a social group affect communication? How might external models of mathematics change the way that we understand our own mathematical capabilities and the mathematical activities we have chosen? How might language and folk ideas shape mathematics communication? How might the cultural value systems of mathematical societies facilitate communication? In so doing, this volume will discuss issues in mathematics education, as well as mathematical theories and mathematical practice

If rain falls on a mountain, it is likely to flow ___________

Answers

Answer:

if rain falls on a mountain it is likely to flow DOWN.

Explanation:

Read the excerpt from "The Gift of the Magi." This excerpt is an example of which kind of characterization? Had the queen of Sheba lived in the flat across the airshaft, Della would have let her hair hang out the window some day to dry just to depreciate Her Majesty's jewels and gifts. O indirect characterization, because it is showing Della's pride in her long hair O direct characterization, because it is describing Della's skill for decorating O indirect characterization, because it is revealing Della's cultural heritage O direct characterization, because it is describing Della's prized possessions​

Answers

Answer:

O Indirect characterization, because it is showing Della's pride in her long hair.

Explanation:

O. Henry's short story "The Gift of the Magi," tells the story of a young impoverished couple who sacrificed their most prized possessions and needs to make the other's Christmas special. And in the process of making the other happy, their acts of kindness and humility for each other is what made them similar to the Magi who visited Jesus Christ when he was born.

The given excerpt from the story is an example of indirect characterization. Indirect characterization is when the personality and other features of the characters are revealed through the description of their appearance, speech, and actions. In the given excerpt, the indirect characterization shows Della's pride in her long hair. Through the mentioning of how Della "would have let her hair hang out the window" in a move to depreciate the "Queen of Sheba[ and her] jewels and gifts".

Thus, the correct answer is the first option.  

Answer:

The first answer is correct

Explanation:

Which options are written correctly and are examples of contested usage? Select all that apply. Hearing the commotion across the room, the audience gravitated toward the noise to see what the fuss was about. Hearing the commotion across the room, the audience gravitated toward the noise to see what the fuss was about. Maria knew the child was frightened, so she tried to gently remove the bandage from the panicked toddler's finger. Maria knew the child was frightened, so she tried to gently remove the bandage from the panicked toddler's finger. It was a sunny, clear day. There was scarcely no breeze, so naturally, we decided to drive to the beach. It was a sunny, clear day. There was scarcely no breeze, so naturally, we decided to drive to the beach. The meal was served in six courses, each more complex and colorful than the last. And each one was delicious too. The meal was served in six courses, each more complex and colorful than the last. And each one was delicious too.

Answers

Answer:

"When they heard the commotion across the room, the audience gravitated toward the noise to see what the fuss was about."

"Maria knew the child was frightened, so she tried to gently remove the bandage from the panicked young toddler's finger."

"It was a sunny, clear day. There was scarcely no breeze, so naturally, we decided to drive to the beach."

"The meal was served in six courses, each more complex and colorful than the last. And delicious too."

Explanation:

When something is said to have contested usage, it means that there are still disagreements among scholars about it.

From the options given, some scholars disagree about the usage of a split infinitive which uses "to gently remove" in the first option.

From the second option, a sentence begins with a coordinating conjunction which is considered wrong by some scholars of grammar.

The third option contains a double negative which is also has contested usage.

Based on the information in this passage, which of these best describes Henry Ford?

Answers

Answer:

The words that describe Henry Ford the best are activity, prosperous and progress.

Explanation:

Henry Ford was a very active man, who founded one of the most successful companies of all time: the car manufacturer Ford.

Henry Ford was naturally a very prosperous man because he was the owner of a successful company.

Finally, Henry Ford promoted progress through his ideas and applications. He was one of the most important developers of the assembly line model of production, which would be copied by practically every other manufacturing company in the world.

The words that portray Henry Ford the best are movement, prosperous and progress.

Henry Ford was an extremely dynamic man, who established one of the best organizations ever the vehicle producer Ford.

Henry Ford was normally an exceptionally prosperous man since he was the proprietor of an effective company.

Finally, Henry Ford advanced advancement through his thoughts and applications. He was one of the main designers of the sequential construction system model of creation, which would be duplicated by basically every other assembling organization on the planet.

For more information, refer the following link:

https://brainly.com/question/18980712

What are some good anime + manga recommendations? nsfw is welcome.​

Answers

Answer:

Erased, bleach, jojo bizzare adventure, psycho pas, one peice, my hero acedima are all good animes

Explanation:

anime sucks tbh

my opinion-

15.2

__________________________ 30. True or False? Even when soil is not saturated with water, water is still available in small spaces.
__________________________ 31. True or False? Scientists estimate that one thimble of soil could hold more than 20,000 microorganisms.

Answers

Answer:

Both are true.

Explanation:

Question 1 is true because the air itself has water molecules. As well as plants around the soil.

Question 2 is True because there could be 100 microorganisms in one grain of dirt if the soil has the right conditions.

I’m guessing it is true? I’m not sure hope it helps

This is the series of events that happens in a story.

Answers

you want us to put the series of events that happened in a story because to do that we need the story-

what is the theme of the self unseeing

Answers

Answer:

“The Self-Unseeing” shows how the poet remembers his childhood with his parents in the house and how it has become just a damaged memory, by giving the poem a low pitch tone with strong descriptions and a rhyme scheme that exalts emotion and importance

Explanation:

ok there :)

Write an essay of at least 150 words describing one of the main themes of "A Wedding Gift." Guy de Maupassant details from the
to support your answer.

Answers

Answer:

The theme is the baby

Explanation:

The wedding gift, the baby, is one of the main themes of the story. Where the baby is presented to Jacque by his former lover who is dying. To which he accepts the child because it is his own, also it was part of the promise he made to it's dying mother. Then also to be presented, later, to Jacque's wife. To which she accepts the child and says "Well, we will bring up the little one.". It is quite unclear to me of whether or not the new born baby was representation of a wedding gift from Jacque's former lover to him, or from Jacque to his wife on their wedding night. Maybe it could simply of been a representation of Jacque's marriage to Berthe being the death of his love for the other woman. To die giving birth to a new love for the life he is going to have with Berthe. Where the new love is represented by the child, and Jacque presents to Berthe his complete and utter devotion to his love with her.

What does the quote “To be nobody but yourself in a world which is doing its best, night and day, to make you everybody else - means to fight the hardest battle which any human being can fight; and never stop fighting” mean to you? Pls help

Answers

Answer:

Explanation:

The quote mentions that this world is doing its best to change us and make us basic like everyone else, but by being nobody else BUT yourself is resisting the most powerful battle that you can fight.

i like to play soccer , write a sentence that uses a different meaning of play​

Answers

Answer:

The children were at play, pretending to be knights with their tin foil lances.

Explanation:

The word play's definitions include:

1. verb. engage in activity for enjoyment and recreation rather than a serious or practical purpose.

2. verb. take part in (a sport).

3. noun. activity engaged in for enjoyment and recreation, especially by children.

4. noun. the conducting of an athletic match or contest.

'I like to play soccer with my friends.'

In this sentence, 'play' is being used as taking part of a sport, which is definition 2. Now, all you need to do is take another definition and write a sentence with it used in a different context.

'The children were at play, pretending to be knights with their tin foil lances.'

The second part is to include context clues to help the reader determine which definition of 'play' is being used. I'm using the third definition in this sentence, but you can use a different one. I could just leave the sentence without the dependent clause, 'The children were at play.', but it leaves much unclear about what the children were doing. 'pretending to be knights with their tin foil lances.' is just clarification.

This helps the reader determine the correct definition. First, you can determine that play is being used as a noun because of the 'at' in front of it. 'The children were at play'. The dependent clause tells you what exactly the children are doing, pretending to be knights. Pretending is not a sport, so by the process of elimination, you can establish that the third definition is the correct one.

Best of luck

Answer i like to kick soccer balls. or i like to frolicly soccer not sure about that one tho

Explanation:

We have come to a place where success cannot be measured by the old standard. Just to make money is no gauge anymore of success. A man may not be able to make as much as his wife, may not be able to make enough to support his family, and yet he may be a success. He may have learned to be happy and to give happiness, too, in striving for things which are not material.
Which sentence best summarizes this selection?
Success is measured by our openness to new ideas.
Success is measured by the pleasure we create.
Success is measured by our families’ happiness.
Success is measured by the wealth we build.

Answers

Answer:

C

Explanation:

Answer:

c

Explanation:

Which statement is NOT an example of plagiarism?
A. Allow another student to copy your work.

B. Explain a concept to a student.

C. Use a quote from a famous person without proper citation.

D. Copy a paper from the internet and submit it as your own.

Answers

Answer: B

Explanation: Explaining something is not the same as giving them the answer

Answer:

The answer is B.

Explanation:

A is just copying another student's work, which is plagiarism.

C is copying another person's work without giving them credit.

And D is copying and pasting, and that is plagiarism.

B is the only one that isn't plagiarism.

How does the author effectively describe the
experience of watching an Elizabethan play?
The author uses a serious tone and a third-person
point of view to effectively describe the experience
The author uses descriptive details and a first-
person point of view to effectively describe the
experience
The author uses a critical tone and a third-person
point of view to effectively describe the experience
The author uses descriptive details and a second-
person point of view to effectively describe the
experience

Answers

Answer:

The author uses descriptive details and a second-person point of view to effectively describe the experience

Explanation:

took the quiz!!

Answer: D-The author uses descriptive details and a second-person point of view to effectively describe the experience.

Explanation:

what is a counterclaim and rebuttal of a question Should teens be alowed to play dangerous sports? And i need evidence/support and a reliable source

Answers

in my opinion i think it should be up to the athlete

Explanation:

if they get hurt they can quit at any time

I fell in love with the minister's son the winter I turned fourteen. He was not Chinese, but as white as Mary in the manger. For Christmas I prayed for this blond-haired boy, Robert, and a slim new American nose.

When I found out that my parents had invited the minister's family over for Christmas Eve dinner, I cried. What would Robert think of our shabby Chinese Christmas? What would he think of our noisy Chinese relatives who lacked proper American manners? What terrible disappointment would he feel upon seeing not a roasted turkey and sweet potatoes but Chinese food?

—“Fish Cheeks,”
Amy Tan

Which details could illustrate a paragraph on conflict? Select all that apply.

Tan’s describing the blond-haired boy
Tan’s saying she cried
Tan’s wondering what Robert will think
Tan’s worrying Robert will be disappointed
Tan’s mentioning turkey and sweet potatoes

Answers

Answer:

My best guess is the following;

Tan’s worrying Robert will be disappointed

Tan’s saying she cried

Tan’s wondering what Robert will think

Explanation:

I hope this helps!

After reading the passage from "Fish Cheeks," we can choose the following options as the details that could illustrate a paragraph on conflict:

B. Tan's saying she cried.

C. Tan's wondering what Robert will think.

D. Tan's worrying Robert will be disappointed.

What is conflict?In literature, conflict can be described as the struggle between two opposing forces. We can have external and internal conflicts. Examples of conflict are: Character vs. characterCharacter vs. selfCharacter vs. nature

What is the conflict in the passage?Amy Tan's conflict originates from the fact that she feels embarrassed because of the Chinese dinner Robert will have to eat at her house, as well as because of her relatives.With that in mind, we can eliminate options A and E, since they do not provide details concerning her conflict. Options B, C, and D, on the other hand, show how Amy feels and what she thinks. Thus, they are the best options.

Learn more about "Fish Cheeks" here:

https://brainly.com/question/11393264

Read the excerpt from "Save the Coral Reefs.”

A study completed in 2004 found that seventy percent of our coral reefs are already destroyed or currently under threat of destruction. It also concluded that much of the wreckage to reefs has been caused by humans. The resiliency of the reefs is on our side, though. More can be done now to help the coral reefs bounce back—even flourish.

What is meaning of the word "resiliency” in this context?

the way an ecosystem supports plant and animal life
the manner in which an ecosystem decomposes
the ability of an ecosystem to recover from damage
the capability of one ecosystem to ruin another ecosystem

Answers

Answer: The answer is C. the ability of an ecosystem to recover from damage

Explanation: make me brainlist :)

"The ability of an ecosystem to recover from damage" is the meaning of the word "resiliency” in this context. Thus, option 'C' is the correct option.

What is resiliency?

Most people characterize resilience as the capacity to bounce back from setbacks, adapt effectively to change and persevere in the face of difficulty. The capacity to deal with and bounce back from adversity is resilience. Resilient people maintain their composure in the face of tragedy. Individuals with psychological resilience are able to respond to life's obstacles, which might include those connected to the Loss of a loved one, using their abilities and strengths. Divorce.

It's crucial because this is what we must do in response to life's ineluctable challenges. Elastic, flexible, springy, and supple are some typical alternatives of the word robust. All of these terms refer to the capacity to withstand stress without suffering long-term damage.

Learn more about resiliency here:

https://brainly.com/question/1615958

#SPJ6

Does a fair government have principles of justice interwoven into it? Explain.

Answers

Answer:

yes. fair government is always fair. it  has pinciples too keep fair.

Explanation:

How does this quotation add credibility to Freedman's statement that the immigrants never forgot seeing the Statue of Liberty for the first time? It adds credibility because it comes from a worker on the ship who sailed past the Statue of Liberty. It adds credibility because it comes from an immigrant who actually shares his memories of seeing the Statue of Liberty. It adds credibility because it comes from a historian who studied immigrants and the Statue of Liberty. It adds credibility because it comes from a journalist who researched the Statue of Liberty.

Answers

Based on the information given, the correct option is B. It adds credibility because it comes from an immigrant who actually shares his memories of seeing the Statue of Liberty.

It should be noted that when writing, authors use credible information in order to be able to present fact in the literary work.

Based on the text, the quotation add credibility to Freedman's statement that the immigrants never forgot seeing the Statue of Liberty for the first time as it comes from an immigrant who actually shares his memories of seeing the Statue of Liberty.

In conclusion, the correct option is B.

Learn more about quotes on:

https://brainly.com/question/2762082

Which strategy is the best way to prepare for a presentation?
Abc
Rely on improvisation to keep the presentation fresh.
Include big words to appear more intelligent and researched.
Stay up very late the night before to practice the presentation many times.
Anticipate questions the audience might ask and formulate responses.

Answers

Anticipate questions the audience might ask and formulate responses.

Which should a writer plan to include in the end of narrative essay?

Answers

Answer:

The answer is

Explanation:

A narration should be included at the end of a narrative essay.

Hope this helps....

Have a nice day!!!!

Answer:

narrative

Explanation:

Which of the options would be considered evidence?( A )main ideas (B) examples (C)authors perspective and (D) questions

Answers

Answer:

B) Examples

Explanation:

It is introduced to convince perusers, and utilized with ground-breaking contentions in the writings or papers. It is verifiable data that enables the peruser to arrive at a resolution and structure a feeling about something. Proof is given in research work, or is cited in articles and proposal explanations, yet is summarized by the author.

Answer:

a and b

Explanation:

Can someone tell me a good book that I can read online? I really like adventure and fantasy, so anything in those categories. -w-

Answers

My favorite adventure and fantasy books are from Cassandra Clare.

Book series:

The Mortal Instruments

The Inferno Devices

The Dark Artifacts

The Last Hours

Answer:

Bridge to Terabithia

Explanation:

A preteen's life turns upside down when he befriends the new girl in school and they imagine a whole new fantasy world to escape reality.

How many principles of new criticism are there? (Please write a numerical response.)

Answers

Answer:

i believe its 2 :)

Other Questions
Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets