When the full Continental Congress first voted on the Declaration of Independence, it
passed unanimously.
received 9 of 12 possible votes.
was rejected so Congress could make changes.
received six votes in favor and six votes against.

Answers

Answer 1

Answer:

the answer would be b, or "received 9 of 12 possible votes." 0:>

Answer 2

Answer:

received 9 of 12 possible votes


Related Questions

The extended family was extremely important to the ancient Chinese. Most families lived in small communities of cottages, where each family unit within the extended family had their own cottage and piece of land.

A. True
B. False

Answers

Answer:

B false

Explanation:

Answer:

B false

Explanation:

Took the test on Edge

Which of the following problems was not a challenge faced by cowboys on large cattle drives?
A.
braving hot and dry summers
B.
crossing dangerous rivers
C.
tending to cattle infected with Texas fever
D.
traveling alone, without partners or a crew

Answers

Answer:

D

Explanation:

stampedes, river crossings, weather, injuries were the four challenges they had to face

Answer:

D

Explanation:

I NEED HELP RN DOES ANYONE HAVE ANSWERS TO CONNEXUS ACADEMY UNIT 2 LESSON 11 TEST 7TH GRADE???????

Answers

Answer:A= Base angle

B= Leg

C= Vertex angle

D= Leg

E= Base angle

F= Base

Explanation:

I hope this is what your looking for! ;))

Which is one factor that contributed to the development of manorial is during the European Middle Ages

Answers

Answer:

Explanation:

The manorial system was the most convenient device for organizing the estates of the aristocracy and the clergy in the Middle Ages in Europe, and it made feudalism possible. ...

Why was tension brewing in Boston in 1768?

Answers

Answer:

Townshend Act?

Explanation:

Boston massacre?? Maybe

Where did the Homestead Act encourage freed African Americans to settle?
A. Plantations in the South
B. Reservations in the Tennessee River Valley
C. Big cities in the North
D. Farms on the Great Plains

Answers

Answer: D. Farms on the Great Plains

Explanation:

In the view of many colonists, British rule did not allow the colonies to express all of the following freedoms except:

A. Personal freedom
B. Political freedom
C. Economic freedom
D. Religious freedom​

Answers

Answer:

D. Religious freedom

Explanation:

A p e x

British rule didn't allowed the colonies to exercise all freedoms except the religious freedom.

Option D is correct.

What is meant by freedom?

Freedom is the state where an individual feels free to do anything whatever he/she wants to do with no interference.

The religious freedom is referring to the state where an individuals has full right to follow any religion on on their own. This freedom was hampered due to the involvement of British rules.

Therefore, all the freedoms are allowed to colonies apart from religious freedom from the British rule.

Learn more about the freedom in the related link:

https://brainly.com/question/13273450

#SPJ2

The Majority Of The Five Tribes, Upon Arrival To Oklahoma, Created Democratic Governments With ___ Branches?

A. 1
B. 2
C. 3
D. 4

Answers

Answer:

Its C.3

Explanation:

Answer: It's C.3.

Explanation: i got it right on edg2020

Which of the following was not a reason La Harpe was interested in the Oklahoma territory?
A Ithad many new American Indian trading partners.
B. It was full of natural resources like soil and coal.
C. It had an abundance of fur-bearing animals.
D. It was a natural strategic bulwark for defense.
Please select the best answer from the choices provided
0
A
О С
D

Answers

Answer:

D

Explanation:

Just took it

Answer:

D

Explanation:

The Supreme Court is hearing a case that deals with racial discrimination in police processes. What amendment to the Constitution, which contains the Equal Protection
Clause, will this decision be based upon?
A 9th Amendment
OB 14th Amendment
OC 13th Amendment
D. Ist Amendment
yes

Answers

Answer:

14 Amendment.

Explanation:

Which of the following contributed most directly to Great Britain's decision to
agree to the terms outlined in the Treaty of Paris (1783)?
o
A. Patriot colonists' harsh treatment of Loyalists throughout the
second half of the 18th century
B. Improved U.S.-British relations resulting from common fears about
the French Revolution
C. American and French forces defeating the British army at the
Battle of Yorktown
D. British outrage toward American colonial policies that limited
trade with Great Britain

Answers

Answer:

c

Explanation: took the test

Answer:

C. American and French forces defeating the British army at the Battle of Yorktown.

Explanation:

Took the test.

what is socialism in your own words?

Answers

Answer:

The term socialism refers to any system in which the production and distribution of goods and services is a shared responsibility of a group of people

Explanation:

hope this helped,brainliest?

What would be the BEST title for this map?
A)
The Freedom Rides
B)
The Trail of Tears
The Great Migration
D)
The March on Washington

Answers

uhhhhj i need the map A

Answer:

A) The Freedom Rides

Explanation:

What groups did the third estate include?

Answers

Answer:

The Third Estate was the lowest estate in the Old Regime. It is made up of three groups: Bourgeoisie, Artisans, and Peasants.

Explanation:

:-)

During the American Revolution, which colonial officer plotted to surrender the colonial fort at West Point to the British?
General George Washington
Captain John Paul Jones
Marquis de Lafayette
General Benedict Arnold

Answers

Answer:

its D. General Benedict Arnold

Explanation:

i just took the unit review ;)

Answer:

A.) General George Washington

Explanation:

I got 100%

John Peter Zenger’s libel trial: resulted from his publication of news stories questioning the intelligence of the king. probably would not have ended in his acquittal if he had attacked someone other than the colonial governor. set back freedom of the press when it ended in his conviction and imprisonment for printing the truth. showed that the public was not yet ready to accept the idea of freedom of speech. led to the overturning of the Licentiousness Act of 1694.

Answers

Answer:

B. probably would not have ended in his acquittal if he had attacked someone other than the colonial governor.

Explanation:

John Peter Zenger was born on the 26th of October, 1697 in Impflingen, Germany. Peter helped to establish freedom of the press in colonial America. He was known as a German printer and a journalist who printed the New York Weekly Journal in New York city, United States of America. Peter Zenger’s publication centers around highlighting and harshly pointing out highly corrupt actions such as election rigging and the exploration of the New York Harbor by the French enemies. These allegations were made against William Cosby, who was the royal governor of New York city.

Consequently, on the 17th of November 1734, Peter was arrested for a libelous suit made against him by the royal governor of New York, William Cosby.

However, he was subsequently discharged and acquitted by the jury, these resulted in a victory for the freedom of press in the English Colony of North America controlled by English kings.

Hence, John Peter Zenger’s libel trial probably would not have ended in his acquittal if he had attacked someone other than the colonial governor. Peter Zenger was acquitted by the jury because the assortment of crimes he published against Cosby were based on facts.

How were people on the lowest rank of the social hierarchy treated?

Answers

Answer: people on the lowest rank were treated like slaves and most of them died

Explanation:

Jefferson’s Declaration of Independence and Stanton’s Declaration of Sentiments both include: _____. Select all that apply.

Answers

Answer:

a discussion of natural rights

demands for equal representation

Explanation:

Explain what the quipu was and how it was used. What was its drawback?

Answers

Answer:

Quipu is the Spanish form of the Inca (Quechua language) word khipu (also spelled quipo), a unique form of ancient communication and information storage used by the Inca Empire, their competition and their predecessors in South America. Scholars believe that quipus record information in the same way as a cuneiform tablet or a painted symbol on papyrus do

Explanation:

i just did it *slurp*

The Incas and other historic Andean societies used a quipu (khipu) as a record-keeping and information transmission tool. This straightforward and extremely portable instrument managed to attain a surprising degree of precision and flexibility in the lack of an alphabetic writing system.

Why is the quipu useful?

A quipu normally consisted of cotton or camelid fiber strings. The Inca people used them for collecting data and keeping records, monitoring tax obligations, gathering census records, and calender information, and for military organization.

These documents are believed to have been used to keep track of a variety of administrative tasks, such as tax collection and military organization. The drawback of this system is that it had a 1500 unit capacity when there was a requirement to display more information and units over time. In some Peruvian villages, quipu is still used today, although only for ceremonial purposes.

Therefore, quipu is a data logging system used before the arrival of Europeans.

Learn more about quipu, here;

https://brainly.com/question/20411736

#SPJ3

This engraving shows people removing artwork, sculpture, and other decorations from a church.

This practice is called
.

The church shown was most likely built by
.

The artwork is being removed because the people thought it was
.

Answers

Answer:

c, a, a

Explanation:

This engraving shows people removing artwork, sculpture, and other decorations from a church. This practice is called iconoclasm.

What is iconoclasm?

Iconoclasm, which is most usually practiced for political or religious motives, is the social conviction that it is important to destroy icons and other symbols or monuments.

Iconoclasts are those who advocate or participate in iconoclasm; the term has come to be used metaphorically to describe anyone who questions "cherished ideas or respected institutions on the grounds that they are false or destructive.

The addition of a full-face depiction of Christ to the obverse of imperial gold coins by Justinian II's administration in 695 was one major alteration within the Byzantine Empire.

The Caliph Abd al-Malik was forced to halt his earlier adoption of Byzantine currency types as a result of the alteration. He began a letter-only, entirely Islamic coinage.

There is not much written documentation of the discussion, while the Patriarch Germanus claims in a letter to two iconoclast bishops written before 726 that "today whole towns and multitudes of people are in significant excitement over this topic."

Learn more iconoclasm, here

https://brainly.com/question/12200737

#SPJ2

Which American Indian group lived in the Great Plains region?

Answers

Answer:

In the mid-1700s, Plains tribes started riding horses that had been brought over from Europe. Groups such as the Blackfeet, Sioux (pronounced SOO), and Comanche (pronounced kuh-MAN-chee) became master riders and warriors, and they controlled huge hunting grounds that supported thousands of members.

Explanation:

Answer:

In the mid-1700s, Plains tribes started riding horses that had been brought over from Europe. Groups such as the Blackfeet, Sioux (pronounced SOO), and Comanche (pronounced kuh-MAN-chee) became master riders and warriors, and they controlled huge hunting grounds that supported thousands of members.

Explanation:

Name something in the 1950s 1960's and 1970's ,Then tell me who invented it and how it is still famous today.

Answers

Answer:

Richard Knerr & Aruthur Spud Invented the Hula Hoop it it famous for how you can spin it on your waist and become a pro at it also in the 1960s "911' was made keeping us safe from scary people,murders,slaugthers and more

Explanation:

I WILL GIVE YOU BRAINLIEST!!!

Which sentence uses fortified correctly?

Xi was fortified by the overwhelming number of emails in his inbox.

Xi fortified his car with chrome wheels, a leather steering wheel, and fur seat covers.

Although he was fortified in advance, Xi chose to ignore the warnings.

Fortified by a good night's rest and a full stomach, Xi was ready for his long journey

QUESTION NUMBER 2

Look at the thesaurus entry for the word degradation.

degradation \ ˌde-grə-ˈdā-shən \ deterioration, decline

Based on this entry, what is the best definition of degrade in this sentence?

Be careful; exposure to sunlight will degrade the film beyond repair.


scale down, decrease in size

lower in dignity or character

reduce in rank or status

break down or decompose

Answers

Answer: decompose

Explanation:

Hope this helps

Thank

The appropriate response is-  Having slept well and eaten well, Xi was prepared for his lengthy journey. As a result, choice (D) is the right solution.

What is a sentence?

An English sentence like "The swift brown fox jumps over the slow hound" is an example of a linguistic expression in linguistics and grammar. In conventional grammar, it is often described as a group of words that conveys an entire notion or as a unit made up of a subject and predicate.

A maximum unit of syntactic structure, such as a constituent, is often what is meant by this term in non-functional linguistics. It is described as a group of written texts in functional linguistics that are separated by markers like periods, question marks, and exclamation points as well as graphological traits like upper-case letters.

Hence, option (D) is accurate.

Learn more about sentences, from:

brainly.com/question/18728726

#SPJ2

How is rebellion related to the American spirit?

Answers

Each state would be equally represented in the Senate, with two delegates, while representation in the House of Representatives would be based upon population.

2) ¿Qué pasó con los colonos que vivían al oeste de los Apalaches? What happened to the colonists who lived west of the Appalachians?​

Answers

Answer

After Britain won the Seven Years' War and gained land in North America, it issued the Royal Proclamation of 1763, which prohibited American colonists from settling west of Appalachia. The Treaty of Paris, which marked the end of the French and Indian War, granted Britain a great deal of valuable North American land.

Explanation:

Después de que Gran Bretaña ganó la Guerra de los Siete Años y ganó tierras en América del Norte, emitió la Proclamación Real de 1763, que prohibía a los colonos estadounidenses establecerse al oeste de los Apalaches. El Tratado de París, que marcó el final de la guerra francesa e india, otorgó a Gran Bretaña una gran cantidad de valiosas tierras norteamericanas.

Why did European nations want to expand into China?

Answers

Answer:

Western imperialism in Asia involves the influence of people from Western Europe and associated states (such as Russia, Japan and the United States) in Asian territories and waters. Much of this process stemmed from the 15th-century search for trade routes to China that led directly to the Age of Discovery, and the introduction of early modern warfare into what Europeans first called the East Indies and later the Far East. By the early 16th century, the Age of Sail greatly expanded Western European influence and development of the spice trade under colonialism. European-style colonial empires and imperialism operated in Asia throughout six centuries of colonialism, formally ending with the independence of the Portuguese Empire's last colony East Timor in 2002. The empires introduced Western concepts of nation and the multinational state. This article attempts to outline the consequent development of the Western concept of the nation state.

The thrust of European political power, commerce, and culture in Asia gave rise to growing trade in commodities—a key development in the rise of today's modern world free market economy. In the 16th century, the Portuguese broke the (overland) monopoly of the Arabs and Italians in trade between Asia and Europe by the discovery of the sea route to India around the Cape of Good Hope.[1] The ensuing rise of the rival Dutch East India Company gradually eclipsed Portuguese influence in Asia.[nb 1] Dutch forces first established independent bases in the East (most significantly Batavia, the heavily fortified headquarters of the Dutch East India Company) and then between 1640 and 1660 wrested Malacca, Ceylon, some southern Indian ports, and the lucrative Japan trade from the Portuguese. Later, the English and the French established settlements in India and established trade with China and their acquisitions would gradually surpass those of the Dutch. Following the end of the Seven Years' War in 1763, the British eliminated French influence in India and established the British East India Company (founded in 1600) as the most important political force on the Indian Subcontinent.

Before the Industrial Revolution in the mid-to-late 19th century, demand for oriental goods such as (porcelain, silk, spices and tea) remained the driving force behind European imperialism, and (with the important exception of British East India Company rule in India) the Western European stake in Asia remained confined largely to trading stations and strategic outposts necessary to protect trade. Industrialization, however, dramatically increased European demand for Asian raw materials; and the severe Long Depression of the 1870s provoked a scramble for new markets for European industrial products and financial services in Africa, the Americas, Eastern Europe, and especially in Asia. This scramble coincided with a new era in global colonial expansion known as "the New Imperialism", which saw a shift in focus from trade and indirect rule to formal colonial control of vast overseas territories ruled as political extensions of their mother countries. Between the 1870s and the beginning of World War I in 1914, the United Kingdom, France, and the Netherlands—the established colonial powers in Asia—added to their empires vast expanses of territory in the Middle East, the Indian Subcontinent, and South East Asia. In the same period, the Empire of Japan, following the Meiji Restoration; the German Empire, following the end of the Franco-Prussian War in 1871; Tsarist Russia; and the United States, following the Spanish–American War in 1898, quickly emerged as new imperial powers in East Asia and in the Pacific Ocean area.

In Asia, World War I and World War II were played out as struggles among several key imperial powers—conflicts involving the European powers along with Russia and the rising American and Japanese powers. None of the colonial powers, however, possessed the resources to withstand the strains of both world wars and maintain their direct rule in Asia. Although nationalist movements throughout the colonial world led to the political independence of nearly all of Asia's remaining colonies, decolonization was intercepted by the Cold War; and South East Asia, South Asia, the Middle East, and East Asia remained embedded in a world economic, financial, and military system in which the great powers compete to extend their influence. However, the rapid post-war economic development and rise of the industrialized developed countries of Taiwan, Singapore, South Korea, Japan and the developing countries of India, the People's Republic of China and its autonomous territory of Hong Kong, along with the collapse of the Soviet Union, have greatly diminished Western European influence in Asia. The United States remains influential with trade and military bases in Asia.

Answer:

to increase their influence in the world

Explanation:

just took the test on edge:)

Why was the Ottoman Empire known as the “Sick Man of Europe?”

Answers

Answer:

hope it helps

Explanation:

The caricature refers to the Ottoman Empire, because it was increasingly falling under the financial control of the European powers and had lost territory.

Unit 1 Test
Question 4
Which civilization developed first?
Your answer:
Egypt
Mesopotamia
China
O Indus
Clear answer
Back
Next
O Type here to search

Answers

I think it's Indus. I looked it up and it said that it 'developed in the 3rd millennium BCE, making it one of the earliest of the world's civilizations.'

HELP PLEASEEEE IM DYING OVER HERE

1. Explain the structure of the triangular trade.
2. Discuss the reasons why Cortes and his soldiers were able to conquer the Aztecs.
3. Explain how Puritan congregations helped establish self-government in the colonies.
4. Why did the growing number of English settlers in New England lead to war between the colonists and a Wampanoag-led alliance?
5. Describe the defining characteristics of the Great Awakening and its lasting effects.
6. Explain how the Pilgrims' government came about and why its existence was important.


PLEASE ANSWER ANY OF THESE IT WOULD MEAN THE WORLD TO ME

Answers

Answer:

The triangular trade was a system of transatlantic trade in the 16th century between Europe, Africa, and the Americas. The first leg of the trip was sending European products from Europe to Africa, where they were traded for slaves. Then, the slaves were transported to the Americas and sold.

Hernan Cortes was able to conquer the Aztec Empire by scaring the natives with the 16 horses, gaining alliances with the other enemies of the Aztec, having superior and better weapons than the natives (like guns), having armor, and having steel.

Each congregation chose its minister and set up its own town. ... The meetinghouse was also used for town meetings, a form of self- government. Puritan values helped the colonists organize their society and overcome the hardships of colonial life.

King phillps wanted to prevent more land instead talen by his tribe ,which led to fighting.

The Great Awakening was a religious revival that impacted the English colonies in America during the 1730s and 1740s. The movement came at a time when the idea of secular rationalism was being emphasized, and passion for religion had grown stale. Christian leaders often traveled from town to town, preaching about the gospel, emphasizing salvation from sins and promoting enthusiasm for Christianity. The result was a renewed dedication toward religion. Many historians believe the Great Awakening had a lasting impact on various Christian denominations and American culture at large.

The Mayflower Compact was important because it was the first document to establish self-government in the New World. It remained active until 1691 when Plymouth Colony became part of Massachusetts Bay Colony.

(NEED HELP URGENTLY WILL MARK BRAINLIEST)
Studying the Apostle Paul's writings to prepare to teach a university class 1 point
A. Increased Luther's faith in the Catholic concept of salvation
O B. Increased Luther's commitment to the idea that charity was necessary for salvation
C. Caused Luther to question Catholic teachings about salvation
D. Caused Luther to better understand the need for a pope to resolve doctrinal
questions

Explain your answer

Answers

Answer: C. Luther saw what was wrong with the catholic church and called them out on it. He saw Paul's teaching and obviously agreed with him and was inspired and saw the flaws of his church and called them out

Explanation:

Other Questions
What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression?