The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.
In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.
It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.
Learn more about Short Tandem Repeat at:
brainly.com/question/29661522
#SPJ4
what are the two hemispheres of law? if you do not remember, lippman gives a description of them on page 252 of the kindle edition. how are the two hemispheres portrayed in the film? what hemisphere would you put jan schlichtmann law firm into, the lawyers representing beatrice foods and w. r. grace and company? do you see prejudicial behaviors?
The two hemispheres of law northern and southern hemispheres of Earth are separated into two regions.
Schlichtmann defaulted on some loans and ran off to Hawaii. Despite having families to support, Conway and Crowley were just as disillusioned with the legal system. Scurrying to salvage the company they had almost lost, they hunkered down. They have yet to overcome all of Woburn's financial difficulties twelve years later.
Schlichtmann was awarded approximately $8 million by Grace for the families of the injured, but after his share of the settlement was reduced by the costs of the trial and investigation, he was left with so little that he declared bankruptcy. His regulation practice imploded, and his vehicle was repossessed.
A preconceived judgment, opinion, or attitude directed toward particular individuals based on their membership in a particular group is known as prejudice. It is a collection of mentalities that encourages, causes or justifies discrimination.
To learn more about hemispheres of law here
https://brainly.com/question/4215508
#SPJ4
For this project, you will create your own scenario and show your knowledge of what you learned in this lesson. Create a crime and make sure you identify the necessary elements of the crime (intent, threat, maliciousness, and so on). Create a scene leading to the suspect's arrest (including probable cause, evidence, warrant, search, and so on). Create a post-arrest scenario (such as the reading of Miranda Rights, interrogation with or without an attorney, a line-up, arraignment, plea, and so on). Decide if your suspect will be sentenced. Decide on an appropriate sentence and mention why you arrived at such a sentence. Discuss whether or not the case will proceed to trial and whether or not the defendant will file an appeal. Decide if the plaintiff will also file a lawsuit against the defendant and describe the outcome of the lawsuit, including the verdict and possible appeal
For this project, let's create a scenario where the crime committed is burglary. The necessary elements of this crime include intent, the act of breaking and entering, and the maliciousness of stealing someone else's property.
The scene leading to the suspect's arrest:
A homeowner reported to the police that their home was burglarized. The police arrived at the scene and noticed that the front door was forced open. The police searched the home and found fingerprints on the window sill and footprints leading to the suspect's house. The police obtained a warrant to search the suspect's home and found stolen items matching the description of the stolen items from the victim's home.
Post-arrest scenario:
The suspect was read their Miranda rights and questioned without an attorney present. The suspect admitted to the burglary. The police conducted a line-up and the victim positively identified the suspect as the person who burglarized their home. The suspect was arraigned and pleaded guilty to the crime of burglary.
Sentence:
The suspect was sentenced to six months in jail and ordered to pay restitution to the victim. This sentence was arrived at because the suspect had a previous criminal record and showed no remorse for their actions.
Trial and appeal:
The case did not proceed to trial as the suspect pleaded guilty to the crime. The defendant did not file an appeal.
Lawsuit:
The victim did file a lawsuit against the defendant and was awarded the cost of the stolen items plus damages. The verdict was upheld on appeal.
Learn more about burglary:
https://brainly.com/question/7943264.
#SPJ11
2.Milki,a 17-years old boy bought a bike from Abel at the price of 2500 birr on the making of the contract, Milki stated that he is over 18. After a while, Milki's tutor, Melat, brought action forthe invalidation of the contract on the ground of incapacity. Abel argued the contract couldn't be invalidated since at the time the contract was concluded Milki stated he is over 18 years and he concluded the contract with the belief that Milki is over 18. Do you think the contract would be invalidated?
Answer:
Based on the information provided, it appears that Milki made a misrepresentation by stating that he was over 18 at the time of the contract.
Explanation:
Misrepresentation occurs when one party to a contract makes a false statement that induces the other party to enter into the contract. In this case, Abel may have been induced to enter into the contract with Milki based on the false statement that Milki was over 18.
In general, contracts entered into by minors (those under 18 years old) are considered voidable at the option of the minor, meaning that the minor can choose to either enforce the contract or invalidate it. However, in this case, it is Melat, Milki's tutor, who is seeking to invalidate the contract on the grounds of incapacity, which refers to Milki's lack of legal capacity to enter into a contract due to his age.
If the court finds that Milki's misrepresentation was material to the contract and that Abel relied on that misrepresentation when entering into the contract, then the contract could be invalidated. However, if the court finds that Abel did not rely on the misrepresentation or that it was not material to the contract, then the contract may be upheld. Ultimately, the specific facts and circumstances of the case will determine whether or not the contract can be invalidated.
Since 1900, the has grown from less than 100,000 to over 2 million in 2008. However, the grew from about one million to over four million over the same timeframe.
Question 9 options:
annual federal court caseload, annual state court caseload
annual number of violent crimes known to the police, annual number of property crimes known to the police,
incarcerated population, number of people supervised under probation
number of annual felony convictions, number of misdemeanor convictions
The correct answer is:
incarcerated population, number of people supervised under probation
What benefit does active monitoring have over passive monitoring?
The offender is responsible for checking in with their probation officer.
The probation officer can locate the offender at any time using GPS.
There is less need for expensive electronic devices than there is in passive monitoring.
The offender must spend the nights and weekend in a real prison.
NO LINKS OMG
The benefit that active monitoring has over passive monitoring is that the probation officer can locate the offender at any time using GPS. So option B is correct.
The active analysis is proactive and enables you to spot issues before they happen. Passive monitoring, on the other hand, is reactive and takes time to identify problems.
Active monitoring refers to monitoring health and safety practices in the workplace prior to incidents, accidents, or ill health. Reactive monitoring refers to monitoring incidents, accidents, and ill health as performance indicators to identify areas of improvement.
To learn more about GPS, refer to the link:
https://brainly.com/question/28100366
#SPJ12
criminal justice is a system of procedures and processes to protect people, bulldings and property, and
information?
Yes, criminal justice is a system of procedures and processes that are designed to protect people, buildings, property, and information from criminal activity.
The criminal justice system includes law enforcement agencies, the courts, and correctional facilities. The primary goal of the criminal justice system is to prevent crime by deterring potential offenders and by punishing those who do commit crimes.
To achieve this goal, the criminal justice system relies on a range of tactics, including investigation and surveillance, prosecution and trial, sentencing, and incarceration. The system also aims to provide support and services to victims of crime and to promote rehabilitation and reintegration for offenders.
The criminal justice system is complex and constantly evolving, and it plays a critical role in maintaining the safety and security of communities.
To know more about criminal justice visit:
https://brainly.com/question/30629034
#SPJ11
When the U.S. Constitution is not clear, how do we interpret the meaning?
Answer:
make me brainalist and keep smiling dude
Explanation:
There are seven widely accepted methods of interpretation that shed light on the meaning of the Constitution.
Text.Text.History.Text.History.Tradition.Text.History.Tradition.Precedent.Text.History.Tradition.Precedent.Structure.Text.History.Tradition.Precedent.Structure.Prudence/ Consequences.Text.History.Tradition.Precedent.Structure.Prudence/ Consequences.Natural Law/ MoralityAnswer:
Public Interpretation of Constitutional AmbiguityThe Justices of the Supreme Court are responsible for interpreting the meanings of all the. laws within the Constitution and for applying those interpretations to cases in which.
Explain the role of Interpol in combatting transnational crime and international police cooperation.
Answer:
INTERPOL, the organization enables police in 192 member countries to work together to fight international crime. INTERPOL provides a range of policing expertise and capabilities, supporting three main crime programmes:
The evidence in this chapter has strongly suggested that America is putting too many individuals in prison and that the costs of "mass incarceration " are very high If the United States was to reduce its prison population , however , alternative approaches to punishment will need to be expanded. What kinds of alternatives to prison do you think would be most effective , and why ? (A quick Internet search can suggest some possibilities for you to consider )
There are several alternatives to prison that can be used to reduce the prison population. Some of these alternatives include community service, probation, electronic monitoring, house arrest, drug treatment programs, mental health treatment programs and restorative justice programs.
Community service involves performing unpaid work for the community. Probation is a court-ordered period of supervision in the community. Electronic monitoring involves wearing an electronic device that tracks the offender’s movements. House arrest involves being confined to one’s home except for certain approved activities.
Drug treatment programs and mental health treatment programs are designed to help offenders overcome addiction or mental health issues that may have contributed to their criminal behavior. Restorative justice programs involve bringing together the offender and the victim to repair the harm caused by the crime.
The most effective alternative to prison depends on the individual offender and their circumstances. For example, drug treatment programs may be more effective for offenders with drug addiction problems while restorative justice programs may be more effective for offenders who committed crimes against individuals.
Learn more about Restorative justice: https://brainly.com/question/28913925.
#SPJ11
ge text: Managerial FOCUS 1. An officer of Westway Corporation recently commented that when he receives the firm's financial statements, he looks at just the bottom line of the income statement-the line that shows the net income or net loss for the period. He said that he does not bother with the rest of the income statement because it's only the bottom line that counts." He also does not read the balance sheet. Do you think this manager is correct in the way he uses the financial statements? Why or why not?
Answer:
Explanation:
While the bottom line of the income statement is certainly important, it is not the only important aspect of the financial statements. The other components of the income statement, such as revenue and expenses, can provide valuable insights into a company's operations and financial health. Additionally, the balance sheet provides important information about a company's assets, liabilities, and equity, which can be crucial for assessing the overall financial position of the company.
Therefore, it is not advisable for a manager to solely rely on the bottom line of the income statement and ignore the other components of the financial statements. It is important for managers to have a comprehensive understanding of a company's financial situation in order to make informed decisions and take appropriate actions.
In your own words, describe a consumer law complaint brought against the company
or individual(s) you are researching for Shams, Flimflams, and Giant Scams. How can
you use this example to teach the listeners of the podcast about consumer law?
What is one of the hashtags you created to help people locate your episode of the
podcast?
A/
Help fast
Answer:
Here is a possible consumer law complaint in my own words against the company Shams, Flimflams, and Giant Scams:
Shams, Flimflams, and Giant Scams consistently misrepresents and overcharges consumers for low-quality products that are worthless or substantially underperform as advertised. They routinely make exaggerated marketing claims about the benefits of their various "miracle pills", "fat-burning teas", and "male enhancers" that have no basis in fact.
Many consumers have purchased these products at high prices, only to discover that they do not work as promised. Yet Shams, Flimflams, and Giant Scams refuses refunds and continues to peddle these falsehoods, preying on vulnerable customers looking for quick fixes and miracles. Their conduct constitutes deceptive business practices, false advertising, and consumer fraud.
They show a pattern of misleading the public and violating consumer trust for profit. Stronger enforcement of laws against false advertising, unfair business practices, and demand for refunds are necessary to hold them accountable, deter similar companies, and protect the public.
Lessons for the podcast:
• Businesses have a legal obligation to be truthful in their marketing and not make false promises about product benefits.
• Even if a product is technically legal to sell, targeting customers with deceptive claims can be sued under consumer protection laws.
• Collective action, social media spotlight, and demand for refunds/accountability can counter predatory companies that bet on obscurity.
Hashtag suggestions for the podcast:
#FightFraud
#ConsumerRights
#DontGetScammed
#AccountableCompanies
#TruthInAdvertising
Explanation:
Show an example of case you have experienced that the law can contribute to a harmonious and peaceful society
Answer:
Explanation:
I can provide an example of how the law can contribute to a harmonious and peaceful society.
One example is the landmark Supreme Court case Brown v. Board of Education (1954), which ruled that segregation in public schools was unconstitutional. This case was instrumental in the Civil Rights Movement, helping to desegregate schools and promote equal opportunities for all races. By enforcing the law and promoting equality, the Brown v. Board of Education case helped to create a more harmonious and peaceful society by reducing racial tensions and creating a more inclusive environment.
Overall, this example demonstrates how the law can be used as a tool to promote equality, reduce tensions, and foster a more harmonious and peaceful society.
PLS MARK ME BRAINLIEST
An example of how the law can contribute to a harmonious and peaceful society is that a city implements noise control ordinances to regulate the volume of noise in residential areas during specific hours.
1. The local government recognizes the need to balance the well-being of residents and the activities of businesses and individuals in the city.
2. Noise control ordinances are enacted to establish clear guidelines on acceptable noise levels during specific hours (e.g., no loud music or construction after 10 PM).
3. Residents who have concerns about excessive noise can report violations to the authorities, who will then investigate and take appropriate action.
4. People and businesses are more mindful of their noise levels and adjust their activities accordingly, promoting a more peaceful environment for everyone.
5. As a result, the community experiences less conflict and tension over noise issues, contributing to a more harmonious and peaceful society.
In this example, the law effectively addresses a common issue, establishes guidelines for behaviour, and provides a means of resolution, all of which contribute to a harmonious and peaceful society.
Learn more about how law can contribute to a harmonious and peaceful society: https://brainly.com/question/26927932.
#SPJ11
John buys a speedboat in the name of the partnership without the knowledge of his partner
Explain whether the contract concluded by John and William respectively would be binding
In a partnership, all partners have the authority to bind the partnership in contracts as long as their actions are within the scope of the partnership's business. However, if a partner, such as John, buys a speedboat in the name of the partnership without the knowledge of his partner William, the contract may not be binding.
Firstly, if the purchase of the speedboat is not related to the partnership's business, it would likely be considered an unauthorized act, and the contract would not be binding. William would need to show that John's actions were not within the scope of the partnership.
Secondly, if the partnership agreement explicitly requires mutual consent for such purchases, then John's actions would be a breach of the partnership agreement, and the contract would not be binding on the partnership.
In summary, the contract concluded by John and William for the purchase of a speedboat may not be binding if it is an unauthorized act or if it breaches the terms of the partnership agreement. To determine the contract's enforceability, one must evaluate the scope of the partnership's business and the specific terms of the partnership agreement.
To learn more about partnership business, visit: https://brainly.com/question/15913927
#SPJ11
Collaboration between government and public entities in south africa
Collaboration between the government and public entities in South Africa is essential for the effective and efficient delivery of services to citizens. This collaboration also promotes transparency, accountability, and good governance.
One of the key benefits of collaboration is the pooling of resources and expertise, which can lead to better service delivery outcomes. This can include infrastructure development, healthcare, education, and other essential services.
The government and public entities also work together to address social and economic challenges, such as poverty, unemployment, and inequality.
Effective collaboration requires strong partnerships and communication between the government and public entities. It is important to establish clear roles and responsibilities, set shared goals and objectives, and measure progress and impact.
By working together, the government and public entities can achieve their common goals and deliver better outcomes for citizens.
To know more about government visit:
https://brainly.com/question/15077883
#SPJ11
If executive orders should be
permitted, would there be
limitations placed on when and
why they are issued?
Answer:
Yes, limitations would be placed on when and why executive orders are issued if they are permitted. These limitations would likely be established by law or by the constitution and would aim to ensure that the president does not abuse their power and that the orders are only used when necessary to carry out the duties of the executive branch.
Explanation:
Frank wanted to have a shed to store all of his pool equipment in. He knew if he built a shed the size he wanted, part of it would be on his neighbor’s property. He built it anyway, and didn’t ask his neighbor for permission. What crime has he committed and why?
Answer:
Frank has committed the crime of trespassing, which involves entering or using someone else's property without their permission. By building a shed on his neighbor's property without their consent, Frank has violated their property rights and committed a civil offense. The neighbor could potentially take legal action against Frank to have the shed removed and seek damages for any harm caused to their property. Additionally, Frank could face fines or other penalties for his actions. It is important to respect the property rights of others and seek permission before using or building on their land.
Explanation:
Mount Lemmon Fire District v. Guido (October 11, 2018)
decision and reasoning
The celebrated Mount Lemmon Fire District v. Guido was a momentous United States Supreme Court case which was determined on October 11th, 2018 regarding the comprehension of the venerable Age Discrimination in Employment Act (ADEA).
Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.Two firefighters, John Guido and Dennis Rankin, who were both more than 40-years old, formalized an action against this particular governmental division of the state of Arizona asserting that they had been dismissed due to their age unlawfully in negation of the established ADEA.
However, the District ardently contended that it ought not be subject to the ADEA's edicts since it employed fewer than 20 personnel.
Read more on Mount Lemmon Fire District v. Guido here https://brainly.com/question/26174453
#SPJ1
complete question
Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.
A plan in which an employer pays insurance benefits from a fund derived from the employers current revenues is called ?
The plan in which an employer pays insurance benefits from a fund derived from the employer's current revenues is called a "self-funded" or "self-insured" plan.
What is self-funded plan?In a self-funded plan, the employer assumes the financial risk for providing healthcare benefits to their employees instead of purchasing a traditional insurance policy from a third-party insurer.
The employer sets up a fund to pay for claims made by employees and their dependents, and may contract with a third-party administrator to handle claims processing and other administrative tasks. By self-funding their healthcare benefits, employers can have greater control over plan design, cost management, and claims data.
Learn more about self-funded plan here:https://brainly.com/question/14315397
#SPJ1
I would like you to explain which Institution(s) of Social Control has influenced you the most in becoming the person that you are.
I have been significantly influenced by the institution of social control called education. The education system has played a pivotal role in shaping my values, beliefs, and behavior.
Through my educational experiences, I have learned valuable life skills, critical thinking, and problem-solving techniques that have helped me navigate different situations and make informed decisions. Furthermore, education has provided me with exposure to diverse cultures, ideas, and perspectives, which has broadened my worldview and enabled me to appreciate and understand people from different backgrounds.
In conclusion, the institution of education has had a significant impact on shaping my values, beliefs, and behavior. It has equipped me with the necessary knowledge, skills, and tools to navigate the world around me and has played a crucial role in helping me become the person that I am today.
To know more about social control , click here.
https://brainly.com/question/30626029
#SPJ4
Iowa supreme court attorney disciplinary board v. peter cannon questions: [a] why should judges care if attorneys submit plagiarized legal briefs or motions? please explain your answer. [b] the iowa supreme court referred to another case involving attorney plagiarism (iowa supreme court board of professional ethics &
Conduct v. lane, 589 N.W.2d 879 (Iowa 1999)) to support its decision in this case. Why do you think the court relied on this previous case?
a) Judges should care if attorneys submit plagiarized legal briefs or motions because it undermines the integrity of the legal profession and the judicial system. Legal briefs and motions are critical to the legal process, and they are expected to be original works that accurately represent the attorney's legal arguments. If an attorney submits a plagiarized brief or motion, they are not only misrepresenting their own work, but they are also misleading the court and potentially influencing the outcome of the case based on false information. Furthermore, plagiarism is a form of dishonesty, which is incompatible with the ethical standards of the legal profession. Judges have a responsibility to uphold the integrity of the legal system, and allowing attorneys to submit plagiarized work undermines this responsibility.
b) The Iowa Supreme Court referred to the previous case of Iowa Supreme Court Board of Professional Ethics & Conduct v. Lane, 589 N.W.2d 879 (Iowa 1999) to support its decision in this case because it established precedent for how the court should handle cases of attorney plagiarism. In the Lane case, the court had disciplined an attorney for submitting a plagiarized brief, and the court had emphasized the importance of maintaining the integrity of the legal profession and the judicial system. By referring to the Lane case, the court in this case was able to build on that precedent and reinforce the importance of original legal work and ethical conduct by attorneys. Additionally, relying on previous cases helps to ensure consistency in the court's decisions and demonstrates a respect for legal precedent.
To learn more about supreme court here
https://brainly.com/question/18228641
#SPJ4
What law prohibits the giving or accepting of payment for referrals of federally funded business?
The law that prohibits the giving or accepting of payment for referrals of federally funded business is the Anti-Kickback Statute (AKS).
The AKS is a federal law that makes it a criminal offense to knowingly and willfully offer, pay, solicit, or receive any remuneration to induce or reward referrals of items or services reimbursable by a federal health care program, such as Medicare or Medicaid.
The purpose of the AKS is to prevent fraud and abuse in federal health care programs by ensuring that referrals are based on the best interests of patients and not on financial incentives. The AKS applies to a wide range of healthcare providers, suppliers, and vendors who do business with the federal government.
To learn more about business here
https://brainly.com/question/24553900
#SPJ4
FULL STORY
Questions: Whats gonna happen?
My 13 year old friend decided to put in a fake credit card number on a scam website and the website also required him to put an address and a phone number, he put in a fake address and a random credit card number that he typed, (he just smashed his keyboard numbers) and accidentally put in his own phone number and he received 2 text messages after that, "His credit card is limited " and "his credit card was locked due to suspicious activity" now what’s gonna happen to him?
Since your friend used a fake credit card number and address, it is unlikely that any charges will be made to the card. The text messages he received are most likely part of the scam to trick people into giving their real credit card information or personal details.
However, it is possible that scammers could use the phone number your friend provided to try and obtain more information from him or attempt to scam him in other ways. It is important for your friend to be cautious and not engage with any suspicious messages or phone calls.
Additionally, it is important to educate your friend on the dangers of entering personal information on scam websites and the importance of protecting his personal and financial information. He should also inform his parents or a trusted adult about the situation so they can help monitor his credit and ensure that his personal information is not compromised.
To know more about scam here
https://brainly.com/question/2930131
#SPJ4
What was the supreme court’s ruling in new york times co. V. Sullivan?.
The Supreme Court's ruling in New York Times Co. v. Sullivan was that public figures must prove actual malice in order to establish a claim for defamation.
In other words, the Supreme Court decided that for a public figure to win a defamation case against a news organization, they must demonstrate that the news organization acted with actual malice, meaning they knew the information was false or acted with reckless disregard for the truth.
This decision established a higher standard of proof for public figures in defamation cases, in order to protect the First Amendment rights of the press. New York Times Co. v. Sullivan was a landmark case in the field of American defamation law. It arose out of an advertisement that the New York Times published in 1960, which solicited funds for the civil rights movement in the southern United States.
To know more about Supreme Court, click here.
https://brainly.com/question/12848156
#SPJ4
What are the top two (2) skills or strategies you learned during this course, and how could they benefit you and your career aspirations?
What do you know now that you wish you knew on the first day of class?
If you could offer advice to the next students to take this class, what would it be?
Demonstrating proficiency in critical thinking and communication skills is paramount to achieving satisfactory grades in research-intensive classes. These are some of the skills I have picked up during the course.
Why is this so?Assessing data sets with a keen eye and constructing well-reasoned arguments backed by astute observations are vital components of successful cognitive development.
This skill set partnered with contextualizing complex information within comprehensible patterns helps to project confidence while communicating findings.
Learn more about career at:
https://brainly.com/question/30040900
#SPJ1
Online contracts: carlos sees offer for 2 free tickets to basketball game online. he quickly hits the 'i accept' button. after reading the fine print, he realizes that by accepting the offer, he signed up for a 1 year subscription, which he must pay for upon receipt. is carlos bound by the agreement?
(yes) or (no)
Yes, Carlos is bound by the agreement by hitting the 'I accept' button he entered in a legally binding contract.
A legally binding agreement is a pact between two or more parties in which they make a commitment to do or refrain from doing something. It may be expressed verbally, in writing or inferred from the actions of the parties. A valid agreement must contain a number of essential components, including an offer, acceptance, consideration, the parties legal capacity, and a legitimate purpose.
Even if he did not read the fine print by clicking the "I accept" button he entered into a legally binding contract with the company selling the tickets. Before accepting an online offer, it is typically taken for granted that the person has read and comprehended the terms and conditions.
It is crucial to thoroughly read and comprehend any agreement before agreeing to its terms whether online or in person.
Learn more about binding contract at:
brainly.com/question/30750666
#SPJ4
1 . a group of african american students believes a college admissions test that is used by a public university discriminates against them. what legal standard would the courts use in deciding their case
The legal standard that the courts would use in deciding the case of African American students who believe a college admissions test used by a public university discriminates against them would be the "disparate impact" standard.
This standard examines whether a policy or practice, while seemingly neutral on its face, has a disproportionate impact on a particular protected group, such as African Americans.
The plaintiffs in this case would need to provide statistical evidence to demonstrate that the admissions test has a disparate impact on African American students. If the court determines that the test does have a disparate impact, the burden would then shift to the university to prove that the test is necessary for achieving a legitimate educational goal and that there are no alternative policies or practices that could serve the same purpose without creating a disparate impact.
To know more about African American here
https://brainly.com/question/891152
#SPJ4
does chase freedom unlimited have foreign transaction fees?
Answer:
Explanation:
No, Chase Freedom Unlimited does not have foreign transaction fees. This means that you can use your card for purchases outside the United States without incurring any additional fees. However, keep in mind that foreign merchants may charge a fee for using a credit card, which is separate from any fees charged by the card issuer. It is always a good idea to check with the merchant and your credit card issuer about any fees before making a purchase.
PLS MARK ME BRAINLIEST
A suspect leaves a written document as evidence, what are two ways forensics may match the document to the suspect?
There are several ways that forensics experts may match a written document to a suspect, but here are two common methods:
1. Handwriting analysis: Forensic handwriting analysis involves examining the handwriting on the document and comparing it to the handwriting of the suspect. The expert looks for similarities and differences in the size, shape, slant, spacing, and other characteristics of the writing. They may also examine the pressure, speed, and rhythm of the writing. The expert may use a microscope or other magnifying tool to examine the details of the writing. By comparing the handwriting on the document to the known handwriting of the suspect, the expert may be able to determine whether the suspect wrote the document.
2. Linguistic analysis: Forensic linguistic analysis involves examining the language and style of the writing on the document and comparing it to the language and style of the suspect's known writing. The expert looks for patterns in the vocabulary, syntax, grammar, punctuation, and other features of the writing. They may also examine the content and context of the writing to look for clues about the author's identity. By comparing the writing on the document to the known writing of the suspect, the expert may be able to determine whether the suspect wrote the document.
Which two of these founding documents were inspired by Enlightenment philosopher John Locke's ideas of "life, liberty, and property?
Α. The Declaration of Independence
B. The Articles of Confederation
C. The Virginia Statute of Religious Freedom
D. The U. S. Constitution
Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?
The actions would MOST support self-advocacy is You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.
What is self advocacySelf-advocacy stands for the act of supporting oneself and defending one's own interests, necessities, and entitlements. To this end, individuals proactively express themselves verbally, make determinations and take actions solely on their behalf so as to enhance the quality of their existence and accomplish objectives they have set out to achieve.
For those persons confronted with disabilities, such personal representation acquires even more significance, because they run up against considerable challenges in securing services, support networks or exercising their individual rights when compared to other members within a community.
Read more on self advocacy here:https://brainly.com/question/10346595
#SPJ1
complete question
Susan works at the local grocery store stocking shelves. She wants to learn how to operate the cash register and work as a cashier, but she does not know how to talk to her boss about it. You are not sure if this is a good idea because you know that the cashier shifts are longer and less flexible. You do not think the schedule change would work well for Susan. Which of the following actions would MOST support self-advocacy?
a) You arrange a meeting with Susan and her employer so you can talk about the accommodations Susan would need to fill the cashier role.
b) You help Susan plan out the steps of asking her boss for a meeting. You also help her type notes about what she wants to say in the meeting.
c) You tell Susan you are excited to hear that she is pursuing her goals, and ask her to let you know the outcome of her discussion with her boss.
d) You explain to Susan that the cashier schedule would be too hard for her. You ask her not to talk to her boss about a change.