what is human intercose
practical of human intercose
Answer:
Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)
help please n thx <3
Answer:
The answer is The cell that contains the nucleus.
This is the science of correct reasoning. The basic components are statements that can be true or false, but never both.
Answer:
The basic components are statements that can be true or false, but never both. Magnetic Resonance Imaging This is a non-invasive body imaging procedure that uses powerful magnets and radio waves to construct pictures of the internal structures of the body.
Explanation:
Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline
3- Scissors are an example of a complex machine.
Answer:
A :3
Explanation:
Just did acceleratted ed. Hope this helps!
which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true
how might toxicology be important to other biomedical professions outside of forensics?
Answer: See explanation
Explanation:
Toxicology is a field in science that has to do with the effects of poisons, toxics and how they can be treated. Through toxicology, one can understand how harms are caused by chemicals and the health of the public can be protected.
Toxicologists study chemicals, drugs and other substances, and looks at how safe they're and their impact on living organisms. Toxicologists help in the development of methods that'll be used to know the harmful effects and the the dosages which causes it.
Furthermore, toxicology gives vital information and knowledge which the decision makers or regulatory agencies
in other biomedical fields can use in order to put programs in place that can be used to limit the exposures of humans to the substances.
In conclusion, less exposure to these substances is vital so that diseases can be prevented.
Toxicology is also used in the field of environmental health.
Toxicology will be important to other biomedical professions outside of forensics. Toxicology can be used in environmental health field which provides critical information and knowledge about the toxic substances that can be used by regulatory agencies to limit our exposures to toxic substances so we can say that toxicology plays an important role for other biomedical professions.
Learn more: https://brainly.com/question/18122705
Which of the following events occurs the earliest during the process of photosynthesis?
Answer:
If you give me the choices to choose from I cna answer.
Explanation:
*MAY* give brainliest!
Please give answer and explain:
This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.
ATTTGCATACTACCGGGC
The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.
Group of answer choices
ATTTGCAATACTACCGGGC
ATGAATGCATACTACCGGGC
ATTTGCATACTGACCGGGC
ATTTGCAACTACCGGGC
ATTAGCATACTACGGGC
Highlighted letters are: ATACTACC
Answer:
1 and 5
Explanation:
https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question
Answer:
1.ATTAGC(ATACTAC)GGGC
5. ATGAATGC(ATACTACC)GGGC
What is the use of tail in human sperm?
It’s an adaptation that allows the sperm to travel to the egg more efficiently as the distance is long and most sperm do not make it to the egg so this increases the chance of fertilisation.
Explanation:
The process during which a preexisting cell splits to form two cells is called
Which accurately labels the cytoplasm?
w
Х
Y
Z
Answer:
Y is the answer
Explanation:
Can someone answer this please?
PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!
Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows
Explanation:
if a person has a dominant gene and a recessive gene for a certain trait which will be expressed
Answer:
The dominant gene will be expressed
Explanation:
Recessive genes are only expressed when you have two recessive genes and no dominant.
Help please!! (3 points)
Answer:
Its C
165.25cm
Explanation:
Which factor is different between the tundra biome and a tundra ecosystem?
A. Soil moisture
B. Climate
C. Size
D. Type of plants
Answer:
b it is the climate
Explanation:
B the climate
Answer C.Size
Explanation:
the reason why it is not climate is because the climate is the same. So as the soil moisture. The tundra biome is a bigger size than the ecosystem. The order from largest to smallest level of organism: biosphere,biome,ecosystem,community, population, and last organism.
Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell
Answer:
a controls what enters and leaves the cell
Explanation:
What does “denature” mean in terms of protein structure?
Explanation:
Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.
2. Describe a situation in which unbalanced forces are acting on an object. What is the net force
on the object, and how does the net force change the motion of the object?
Answer:
The force is by putting the two same objects on both sides and the motion is the scale
The force is by putting the two same objects on both sides and the motion is the scale.
What do you mean by force?In physics, a force is an influence that can change the motion of an object. A force can cause an object with mass to change its velocity, i.e., to accelerate. Force can also be described intuitively as a push or a pull.
The normal force acts in a direction normal to the surface interaction between objects. Friction is a force that opposes motion on surfaces. Other examples of non-fundamental forces include the elastic force, tension.
Force is the fundamental result of an interaction between two objects, while power is an expression of energy consumed over time (work), of which force is an element.
Learn more about force:
https://brainly.com/question/13191643
#SPJ2
Like nutrients and water, energy also recycles through an ecosystem,True Or False?
Answer:
Explanation:
True
How does agriculture contribute to species loss?
Answer:
The animal agriculture industry is killing our environment and putting every species on this planet at risk of extinction. The animal agriculture industry's pollution of our air, water and land, along with deforestation and soil degradation, all contribute to habitat loss and species extinction.
Explanation:
Select the factors described in the video that the body works to maintain homeostasis.
Group of answer choices
water concentration
temperature
pH level
skin color
eyesight
Answer:
water concentration, temperature and pH level.
EASY HELP ME Which of the following would be true of a Charophycean type plan
a. They had seeds.
b. They lived in water.
c. They were mosses
d. They were vascular
Answer:
C
Explanation:
They in fact were mosses and mosses by definition dont have seeds or vascular and Charophycean type plants dont live in water
The surface of rivers freeze when the temperatures falls below freezing. However, the water underneath this layer of ice continues to flow. This phenomenon allows fishermen to fish through holes drilled in the ice the entire winter. Which property of water is the reason the river doesn't freeze completely?
Answer: Water retains its temperature for long.
Explanation:
The ice floats on the water of river as it is less denser then the liquid water. This causes ice to float on water. It protects the water at the bottom from freezing. The decrease in the temperature level can cause the death of the marine life by catching organisms in the ice. The floating of the ice insulates the water present beneath. So, the fish and other aquatic animals can survive and the fishermen can catch the fishes alive.
Answer:B hydrogen bonds expand during the freezing process
Explanation:
2. What is the name of the process of gathering evidence called? *
1 point
the Experimental Process
the Scientific Proof
the Scientific Experiment
the Scientific Method
Answer:
the answer is d scientific method
Answer:d the scientific method
Explanation:
Where is the error in the diagram?
DNA is copied during the shortest stage.
The cytoplasm divides during the longest stage.
The nucleus divides in the stage before the cytoplasm divides.
Both the nucleus and the cytoplasm divide in the same stage.
Answer:
But where is your diagram
Answer:
C
Explanation:
What is a carbon producer
Answer:
There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet
HELP!!
What is the correct answer?
Answer:
the pink one
Explanation:
just had this question
what is carrying capacity? what type of population growth does it affect?
Carrying capacity is referred to a population size of species in a particular habitat. In an ecosystem, the population of a species will increase till it reaches its carrying capacity. Then the population size remains relatively equal.
What are the types of carrying capacity?Carrying capacity is the maximum limit till that the ecosystem can support the existence of the population.
There are four categories of carrying capacity, namely:
Physical.Ecological.Economic.Social.A specific environment's carrying capacity is the maximum population size that it can support.
The carrying capacity modifies the growth rate by slowing it when resources become scarce and stopping growth once it is reached.
Thus, it can be concluded that the carrying capacity is the average population size of species in a particular habitat which slows and stops the growth rate on reaching it.
For more details regarding carrying capacity, visit:
https://brainly.com/question/2375972
#SPJ1
Which element is able to combine in many ways with different elements and is therefore considered the basis of life?
Answer:
Carbon
Explanation: