What is the length of a 0.2-mm object expressed in je m?

O 200 pm

O 0.02 pm

O 200.000 jem

Answers

Answer 1

Answer:

200.000 in je m

Explanation:

1 je m is equal to 1000 mm.

Therefore 0.2 mmm will be equal to 1000 × 0.2 mmm

This will give us 200 je m.


Related Questions

can somebody do 4 and 5 for me

Answers

Answer:

4. According to what is observed in the diagram, the maltose (substrate) binds to the maltase (enzyme) to obtain glucose molecules (product), in a process of hydrolysis of the maltose.

5. Three factors that can affect intestinal maltose activity - slowing it down or stopping it - are temperature, pH and substrate depletion.

Explanation:

4. Enzymes, such as maltase, have the function of making a reaction faster and decreasing the activation energy. Maltase is responsible for breaking down a maltose molecule, a dimer, into two glucose monomers, which is a hydrolysis reaction of the bonds that hold glucose molecules together.

5. There are several factors that can cause the decrease or cessation of the activity of an enzyme. Enzymes are activated when substrate is available and work best under ideal temperature and pH conditions. When there are alterations of these factors, the enzyme will reduce or stop the reaction in which it intervenes.

pH: when the pH increases or decreases it produces a decrease in the speed of reaction that catalyzes an enzyme. Very high or low pH levels can denature the enzyme and make the expected reaction not occur. Temperature: like pH, changes in temperature can slow or stop maltase activity. Substrate availability: It is a fact that when the specific substrate of an enzyme becomes depleted, the rate of reaction slows down, stopping when no substrate is available.

Which of these will weigh the same after it has undergone a change?

A.) Paper being burned.

B.) Sugar water being evaporated.

C.) Two chemicals reacted to form gas.

D.) Ammonia added to steel wool to create heat.

Answers

i think the answer is D
A is the more formatted answer

What are de clinical sings in equine sinovitis

Answers

Answer

Clinical signs include fetlock joint effusion, firm swelling over the dorsoproximal aspect of the fetlock joint, lameness, and decreased range of motion and a positive response to firm flexion of the fetlock. Diagnosis can be suspected by palpation

Multicellular organisms (like us) increase the number of their cells through cell division. One cell divides (parent cell) and becomes two new cells (daughter cells).
Question 20 options:
True
False

Answers

Answer: The answer is false

Explanation:

Which types of mutations in the lac operon stop Escherichia coli from utilizing lactose as a carbon source? a) promoter deletion b) lactose-binding site mutation c) repressor DNA-binding site mutation d) operator deletion

Answers

Answer:

D.) repressor DNA-binding site mutation

Explanation:

lacl prevents the repressor polypeptide is a mutant that prevent operon from binding lactose, and thus will bind to the operator and be non-inducible.. This mutant will represses the lac operon whether lactose is present or not and the lac operon will not be expressed. It is also called“super-supperesor".

The lacI locus – One type of mutant allele of lacI (callled I-) prevents the production of a repressor polypeptide or produces a polypeptide that will not allow to bind to the operator sequence.

This is also a constitutive expresser of the lac operon because absence of repressor binding permits transcription.

4. When an offspring grows off from the body of a parent organism it is called __________________. *

a.fission
b.budding
c.fragmentation
d.sporulatioin

Answers

Answer:

Budding

Explanation:

It is asexual reproduction in which offspring grows out of the parents organisms.

In the process of budding, an offspring grows off from the body of a parent organism and buds off when fully matured. Thus, the correct option is B.

What is Asexual Reproduction?

Asexual reproduction is the type of reproduction only a single parent is involved. In this process, offspring are developed from a single parent called mother cell and these offspring are genetically identical to the parent hence are also called as clones.

During the process of budding which is a types of asexual reproduction, a new organism develops from an outgrowth or bud which is formed on the parent plant due to the cell division at a particular site on the parent plant. For example, the small bulb-like projections coming out from the yeast cell are the buds which give rise to new yeast organism.

 

Therefore, the correct option is B.

Learn more about Asexual Reproduction here:

https://brainly.com/question/4100787

#SPJ6

The process of desalination removes salt from seawater using condensation methods or filtration. Which of the following is least likely to be a problem for widespread use of desalination?
A. To be economical, desalination plants must be build on coastlines
B. Desalination uses large amounts of energy
C. There is a shortage of seawater to use for desalination
D. Desalination is relatively slow

Answers


There is a shortage of seawater to use for desalination.what's the answer

1. Compare and contrast mitosis and meiosis. 2. What major event occurs during interphase?

Answers

Answer:

1.

contrast between mitosis and meiosis

Mitosis

- it takes place in somatic cells in multi cellular organisms in order to provide growth, however, in unicellular organisms it is reproductive division as well. is the means of reproduction in single-celled organisms. Other organisms use it for the growth of tissues (somatic cells)

- exact number of chromosome in offspring

- no recombination or crossing over

- no pairing found

- major phase: prophase, metaphase, anaphase, telophase

Meiosis

- takes place in sex cells to form gamete formation during sexual reproduction

- half of the chromosome number found in gametes of the parents thus, known as reduction division

- due to crossing over takes place recombination  found.

The pairing of chromosomes takes place

- major steps:

Meiosis 1 – prophase, Metaphase, anaphase, Telophase, and

Meiosis 2: Prophase, Metaphase, Anaphase, and Telophase

2. Interphase takes place prior to both mitosis and meiosis which is divided into 3 sub phases-G1, S and G2 phases.

The major events are as follows:

G1- RNA and protein synthesis takes place and cell grows in size

S- DNA replication takes place, Centriole duplication occurs and synthesis of histone proteins.

G2-  RNA and Protein synthesis continues.

Explain how exercise and an active lifestyle can improve bone health
and bone density.

Include discussions of osteoblasts vs.
osteoclasts, osteoids, osteocytes, collagen, bone modeling, impact
and increased workload, glucocorticoid effects, mineral intake, or
underloaded bone.

Answers

Explanation:

explain how exercise and an active Lifestyle can improve bone health and bone density include discussions of

Which categories of amino acid would you expect to find on the surface of a soluble protein, and which would you expect to find in the interior? What distribution of amino acids would you expect to find in a protein embedded in a lipid bilayer?

Answers

Answer:

Polar and charged amino acid residues (the remainder after peptide bond formation) are more likely to be found on the surface of soluble proteins where they can interact with water, and nonpolar (e.g., amino acid side chains) are more likely to be found in the interior where they are sequestered from water.

Explanation:

The amino acids with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC side chains are expected to be found inside the lipid bilayer.

The lipidic bilayer is mainly composed of phospholipids.

Phospholipids have hydrophilic, polar phosphate heads facing out on each surface to interact with water and hydrophobic fatty acid tails facing each other inside the lipid bilayer.

The polar and charged side chains of amino acids are expected to be observed on the surface of membrane proteins because they can interact with water (H2O) molecules.

On the other hand, nonpolar side chains of specific amino acids are expected to be observed inside the lipid bilayer to interact with the hydrophobic fatty acid tails of phospholipids.

The polar amino acids include glutamine, glutamic acid, arginine, asparagine, aspartic acid, histidine, lysine, serine, and threonine.

Moreover, amino acids with hydrophobic side chains include leucine, isoleucine, glycine, alanine, valine and proline.

In conclusion, amino acid residues with POLAR and CHARGED side chains are expected to be observed on the membrane surface, whereas amino acids with NON-POLAR and HYDROPHOBIC chains are expected to be found inside the lipid bilayer.

Learn more in:

https://brainly.com/question/4535258?referrer=searchResults

name one human hormone that is produced by genetically modified bacteria​

Answers

Answer:

Insulin

Explanation:

I knew the answer, but I'm not really good at explaining these so I got a little help from google. -------- Bacterial cells can be genetically modified so that they have the gene for producing human insulin. As these modified bacteria grow, they produce human insulin.

What affect do glass panels have on temperature google doc

Answers

Answer:

wdym

Explanation:

A colleague has used computer modeling to design an improved enzyme. To produce this enzyme, the next step is to:___________.
A) look for a bacterium that makes the improved enzyme.
B) mutate bacteria until one makes the improved enzyme.
C) determine the nucleotide sequence for the improved enzyme.
D) synthesize the gene for the improved enzyme.
E) use siRNA to produce the enzyme.

Answers

Answer:

C) determine the nucleotide sequence for the improved enzyme.

Explanation:

Computational enzyme design (CED) can be defined as a bioinformatic in silico approach used to model, construct, and enhance enzyme catalysis. CED uses complex optimization algorithms that enable to direct evolution by using computational systems. As a further step, after the modelization of optimal enzymatic activity, bioinformaticians require to determine the nucleotide sequences which will be subsequently used to synthesize the corresponding enzymes.

Orms of obvious, overt prejudice, which are considered inappropriate by most social standards today, are sometimes called:________.

Answers

Answer:

Discrimination        

Explanation:

Discrimination of prejudice refers to the act of treating a person or people in a way that is wrong, unlawful, and inconsistent with the generally accepted moral standards just because they are different especially with respect to age, nationality, gender, etc

There are two categories of discrimination:

Overt and Covert.

Discrimination or prejudice is over when those who practice it are unafraid to make their thoughts and actions public. Many times this is so because the society in which they live condones such behavior and because there are no repercussions, they bold to make their unjust acts public. For example, name-calling, intentional rejection of job applications, etc.

Covert refers to using the system or giving logical reasons for discriminatory behavior. This is more subtle. For example, an employer may say they are not taking females due to the prerequisites of the job. Refusing "nicely" to be treated by a person of color in a hospital is another example.

Covert aggression of prejudice is often masked and occurs where the laws are relatively stiff on those who practice them. Also, a society that is evolving from largely prejudicial to less discriminatory will see more covert forms that overt forms of discrimination because those who practice overt prejudice are bold because they know that there are many more who think like them.

Cheers!

Which type of neurons keep us informed about what is happening both inside and outside of our bodies?

Answers

Answer:

Sensory neurons keep us informed of is happening both inside and outside our bodies.

Explanation:

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Answers

Answer:

what I don't understand what is the Ctcagt

Write a food chain from this food web with six trophic levels..

Answers

What food web? Do you have a pic?

Explain how photosynthesis and cellular respiration work together.

Answers

Answer:

photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

Which correctly describes crossing over?
a.)the process whereby nonsister chromatids exchange genetic material
b.)the process whereby homologous chromosomes are pulled to opposite poles of the cell
c.)the process whereby sister chromatids are pulled to opposite poles of the cell
d.)the process whereby homologous chromosome pairs align randomly along the metaphase plate

Answers

i would say A or D sorry if this doesn’t help

Please hurry I’m being TIMED

The smaller the load a river has the more sediment it can carry.
Please select the best answer from the choices provided
T
F

Answers

Answer:

true

The smaller the load a river has the more sediment it can carry. TRUE.

Answer:

this is true

Explanation:

i just took the test

Why dont solar eclipses happen every time the moon is in between the sun and the Earth?​

Answers

Answer:

because the moon doesn't line up exactly between the sun and the earth every time it passes.

Explanation:

A solar eclipse can only occur when the Moon is close enough to the ecliptic plane during a new moon. ... Total solar eclipses are rare at any particular location because totality exists only along a narrow path on the Earth's surface traced by the Moon's full shadow or umbra. An eclipse is a natural phenomenon.

Hope this helped! Can you mark me brainliest please? :)

SOMEONE PLZ HELP!!!!!!!!!!!!!

Answers

Answer:

Eukaryotic cells probably evolved about 2 billion years ago. Their evolution is explained by endosymbiotic theory. Mitochondria and chloroplasts evolved from prokaryotic organisms. Eukaryotic cells would go on to evolve into the diversity of eukaryotes we know today.

Hope this helps.

Explanation:

Answer:

Eukaryotic cells :)

Explanation:

A repressor prevents
a. translation from occurring.

b. ribosomes from binding to mRNA

c. transcription factors from binding to DNA

Answers

I think it’s b ......

SOMEONE PLZ HELP ME, PLZ I WILL MARK BRAINLIEST

Answers

Answer:

All living things are composed of cells.

Cells are the basic units of structure and function for living things.

All cells come from pre-existing cells. Also, organisms grow by “adding on more cells” NOT by increasing the size of their cells.

Explanation:

What structure would not be found in a cell from human skin

Answers

Answer:

chloroplast i think , i may b wrong

what are the hetrotypes

Answers

Answer: Hetrotypes are organisms (anything that lives) that can make it's own energy without absorbing it from other organisms. Example: Flowers, they get there energy from the sun, not from eating and absorbing other organisms.

Explanation:

Identify the three types of neurons, and explain the function of each type

Answers

Answer:

Sensory neurons help you:

taste

smell

hear

see

feel things around you

Explanation:

Motor neurons

Motor neurons play a role in movement, including voluntary and involuntary movements. These neurons allow the brain and spinal cord to communicate with muscles, organs, and glands all over the body.

Interneurons

Interneurons are neural intermediaries found in your brain and spinal cord. They’re the most common type of neuron. They pass signals from sensory neurons and other interneurons to motor neurons and other interneurons. Often, they form complex circuits that help you to react to external stimuli.

A baseball is tossed into the air, forming an arc. Mark the following points:
1. Kinetic energy is the highest
2. Potential energy is the highest
3. Kinetic energy is converted in potential energy
4. Potential energy is converted into kinetic energy

Answers

Answer:

it is number 3 .............

Answer:

Kinetic energy is the highest when the baseball is in the air.Potential energy is the highest when the ball is about to be thrown.Kinetic energy gets converted to potential energy when the ball stops flying in the air and falls on the ground.Potential energy is converted into kinetic energy when the ball is thrown.

T/F Osmosis and diffusion are both examples of passive transport.
A.True
B.False

Answers

Both osmosis and diffusion are passive transport processes, meaning that no additional energy is needed for them to take place. In both diffusion and osmosis, particles move from an area of higher concentration to one of lower concentration.

The given statement "Osmosis and diffusion are both examples of passive transport" is True.

Passive membrane transfer methods are the most direct. Passive transport is a phenomena that happens spontaneously and doesn't require the cell to use energy to move. Diffusion is the process by which chemicals travel passively from a region of higher concentration to a region of lower concentration. A concentration gradient is a difference in the concentration of one substance throughout a physical region.Transport that is done passively is called diffusion. Until the concentration is the same across the space, a single substance has a tendency to travel from an area of high concentration to an area of low concentration.Based on the gradient of water concentration across the membrane, osmosis is the mechanism by which water diffuses through a semipermeable membrane. Osmosis moves just water across a membrane, and the barrier restricts the diffusion of solutes in the water, whereas diffusion distributes material across membranes and into cells.

Learn more about the passive transport with the help of the given link:

https://brainly.com/question/1619908

#SPJ1

What is the purpose of the Terra satellite? O A. To monitor conditions on Earth B. To identify near-Earth objects C. To search for planets in other solar systems D. To observe the movement of the moon


n e w a. p. e. x. 2020​

Answers

Answer:

to monitor conditions on earth

Explanation:

To monitor conditions on Earth is the purpose of the Terra satellite. Therefore, the correct option is option A.

An artificial object that is purposefully placed into orbit around a celestial body, most frequently the Earth, is referred to as a satellite. It can be either manned or unmanned, and depending on how it is made and how it works, its purpose can be very different. Satellites have revolutionised many elements of our daily lives and have become essential parts of modern technology. Satellites come in a variety of varieties, each with a special function. Long-distance communication is made possible, for instance, by communication satellites that transfer signals between ground stations. To monitor conditions on Earth is the purpose of the Terra satellite.

Therefore, the correct option is option A.

To know more about satellite, here:

https://brainly.com/question/28766254

#SPJ6

Other Questions
Help me solve this problem please Excerpts from Dowling Company's December 31, 2021 and 2020, financial statements and key ratios are presented below (all numbers are in millions): 2021 2020Accounts receivable (net) $22 $33 Net sales $132 $117 Cost of goods sold $77 $72 Net income $22 $34 Inventory turnover 6.05 Return on assets 12.3 % Equity multiplier 2.53 Dowling's return on equity for 2021 is: (Round your answer to 1 decimal places.)Multiple Choicea) 7.7%.b) 16.7%.c) 31.1%.d) 24.1%. What is the benefit of participating in e-democracy?Any person of any age can participate.Only those with computers can participate.Government officials can use social media to communicate with voters.People can place ads in newspapers.It requires going door-to-door, but people can meet new neighbors. Which is true of world climate regions?Tropical wet climate regions are near the Equator on several continents.Climate regions near the oceans are cooler year round than other areas.Regions where wind blows off the ocean have drier climates than regions farther inland.Arid and semiarid climate regions, such as deserts, are closer to the Equator. A car travels 19 km in 30 minutes. What was its speed in km/hour?HURRY WILL MARK BRAINLIST pls help me I don't know how to do this Energy balance: energy intake equals energy output (calories in versus calories burned) is a guideline and not an exact equation due to metabolism, hormones, etc. Ask the user to enter a name. If there is an a in the name, print the message saying The name contains at least one a. If there is no a then print The name does not contain the letter a. why is blood pressure an example of negative feedback? PLEASE HELP! What is a direct democracy? 6th grade pre teacher ED i mark as brainliest According to the selection from The Future of the Mind, what was the most significant discovery the scientists made about Einsteins brain?a. His brain was quite normal.b. His brain was larger than average.c. His brain had features never seen before.d. His brain had more neurons than were expected Hey, can someone help me with my math homework? pls help with this one -4 divided by - 2/3 1. What is the electron configuration for zirconium?1s 2s 2p 3s 3p 3d 10 452 4p 532 44?132 232 2p 3s 3p 432 3410 4p6 552 44O 132 232 2p 3s 3p 3040 4p 58% 42%O 1:2 232 2p 3s 3p 452 300 dp" 4d? What is the value of a? Given a 12-bit A/D converter operating over a voltage range from ????5 V to 5 V, how much does the input voltage have to change, in general, in order to be detectable HELPPP!!! Its due tomorrow what do i do What is the quickest way to remove all filters that have been applied to a worksheet? Click each filter and select Clear Filter.Click the Filter button in the Sort & Filter group.Select the worksheet and click Clear Filter.Select the worksheet and click Delete All Filters. can u pls help me with this question