What figure of speech is used in this line from Walt Whitman's poem,"I hear America Singing"?

What Figure Of Speech Is Used In This Line From Walt Whitman's Poem,"I Hear America Singing"?

Answers

Answer 1

Answer:

Personification

Explanation:

Answer 2

Answer:

See image (Plato)

Explanation:

What Figure Of Speech Is Used In This Line From Walt Whitman's Poem,"I Hear America Singing"?

Related Questions

When writing in formal English, which convention should you follow?

a Use popular expressions.

b Use contractions.

c Use correct grammar.

d Use slang.

Answers

Answer:

use of correct grammar

Explanation:

cause you cannot use bad English and formal English

excerpt adapted from
Heart of Darkness
by Joseph Conrad

Going up that river was like traveling back to the earliest beginnings of the world when vegetation rioted on the earth and the big trees were kings. An empty stream, a great silence, a dense forest. The air was warm, thick, heavy, sluggish. There was no joy in the brilliance of sunshine. The long stretches of the waterway ran on, deserted, into the gloom of overshadowed distances. On silvery sand-banks hippos and alligators sunned themselves side by side. The broadening waters flowed through a mob of wooded islands; you lost your way on that river as you would in a desert, and butted all day long against sand banks, trying to find the channel, till you thought yourself bewitched and cut off for ever from everything you had known once—somewhere—far away—in another existence perhaps.


Select the correct answer.

Read the excerpt from Heart of Darkness.

What is the most likely purpose of this part of the story?

A.
to describe the character’s conflict with the setting
B.
to create a subplot that introduces a minor detail
C.
to conclude the events that resulted in a turning point
D.
to introduce a new decision that will need to be made

Answers

Answer:

A.  to describe the character’s conflict with the setting

Explanation:

In this excerpt from Heart of Darkness, the narrator puts the accent on the surroundings, and how unpleasant it is. It gives the feeling of being lost in the prehuman era when nature and wilderness dominated, but in a negative sense. The feeling was even more intensive since the narrator traveled alone, and being alone in a, from a traveler`s point of view, hostile environment with wild animals like alligators, warm air that seems like it is unbreathable and awareness like you are in some enchanted trap where there is no way out, made the narrator feel a little bit anxious, though a man in greatness and infinity of nature is just a grain of sand, and that is even scarier.

how does marlowe introduce a central idea in lines 1-8 in his poem

Answers

Answer:

The central idea highlighted in the first 8 lines of Christopher Marlowe's poem - The Passionate Shepherd to His Love speaks to the union between a man and his environment.

Explanation:

So in the first line, he calls out to his love and then progresses from there to promise pleasure which they'd both share.

It is important to note that these pleasures are strongly related to nature. Inline 2 he promises to prove or show his love all the pleasures.

In lines 5 and 6 he references the view of watching shepherds feed their flock and in 7 and 8 he paints the picture of melodious birds singing to river falls.

So we see that as he tried to convince his love to join him in the great outdoors, there he depicts a strong connection between the beauty of nature in the rural environment and his passion towards the one he loves.

Cheers

To what does Frank compare his arrival in New York?
A a Shakespearean drama
B. a movie
C. a nightmare
D. an opera by Wagner
E. a dream

Answers

The Answer is —-A a Shakespearean drama

The answer is B. a movie

How does John Winthrop and Jonathan edwards writing differ in terms of purpose, audience, and the selection of details

Answers

He always requested the people to act their best and follow to the standards of God only by living a true generous Christian being is through terms.

How does John Winthrop and Jonathan Edwards writing differ in terms of purpose, audience, and the selection of details?

John Winthrop was an English Puritan lawyer and considered as the famous figures in establishing the Massachusetts Bay Colony.

An excerpt from John Winthrop’s A History of New England that shown Winthrop’s writing style and the structure of his journal is there joined with her.

John Winthrop who was born between January 12, 1587/88, and died on March 26, 1649, at the age of 61 was an English Puritan lawyer and one of the leading figures in founding the Massachusetts Bay Colony, that is the second major settlement in New England after Plymouth Colony.

Learn more about Jonathan Edwards, refer to the link:

https://brainly.com/question/4281954

#SPJ2

But as I sent them on toward Scylla, I

told them nothing, as they could do nothing.

They would have dropped their oars again, in panic,

to roll for cover under the decking. Circe's

bidding against arms had slipped my mind,

so I tied on my cuirass and took up

two heavy spears, then made my way along

to the foredeck – thinking to see her first from there,

the monster of the grey rock, harboring

torment for my friends.

–The Odyssey,
Homer

Which theme statement is supported by the passage?

Odysseus decides to keep secrets from his men.
Strong leaders communicate information to their followers.
Fear is a powerful motivator.
Leaders must make difficult choices.

Answers

Answer: D). Leaders must make difficult choices.

hey need to spend som money?
Look no further, We're here to offer you the ZQUBE
whats the zqube?

what? living under a rock?


The zqube is prefect for buying online, or in
S T O R E S
and for all those old folks out there zqubes are prefect buying over the
t e l e p h o n e
buy now
$9.99

Answers

Answer:

Why thank you UwU

Explanation:

                                                         

Answer:

I dont know what this is, is this an advertisment

Explanation:

Which question does the adverb modifier answer in the sentence below:
The cat swiftly darted in and out of traffic.
a. Where?
b. When?
c. In what way?
d. To what extent?

Answers

Answer:

In what way.

Explanation:

C- In what way. Hope it helped

eye
What is the main theme or lesson of the myth?
Wisdom is worth a great price.
The best things in life are free.
To appreciate something, you must suffer for it.

Answers

Answer: c

Explanation: because i got 100% on the test that had that answer and im looking at it rn

Which is an example of THEME?


A.
Greed


B.
Irony


C.
Flashback

Answers

B: Irony

Theme is something the author is trying to teach the reader.

Read the excerpt from The Diary of a Young Girl. After we arrived at 263 Prinsengracht, Miep quickly led us through the long hallway and up the wooden staircase to the next floor and into the Annex. She shut the door behind us, leaving us alone. Margot had arrived much earlier on her bike and was waiting for us. Which is one content difference between the diary and the play The Diary of Anne Frank?


the time period in which the families are in hiding
the reasons the families must hide in the annex
the number of children in each family who live in the annex
the order in which the families arrive at the annex

Answers

Answer:

d

Explanation:

bc its right:)

Answer:

D.The order in which the families arrive at the annex

Explanation:

got i right on edge 2021


Why did Osorio play stickball as a child, and why does he continue to play as
an adult?
Help me rn give me the correct answer

Answers

Answer:

DEAR FRIEND ,

HERE IS YOUR ANSWER

PLS ATTACH A COPY OF THE TEXT , I DONT KNOW ANYTHING ABOUT THIS LESSON

Explanation:

Should teens be allowed to trick or treat? Essay

Answers

Answer:

yes, why would they not, i mean unless the teen is disabled, then i get not letting them go for protection but do you really need to keep anyone else in instead of letting them trick or treat?

Explanation:

How do kids know when they should give up trick or treating? Do parents even know when? Going through life, children have to give up many things that they grow too old for. It’s just a part of life. The question is, are kids as willing to give up holidays? Young kids may not realize that one day they will have to give up this wonderful tradition.

Elementary schools let the kids wear their costumes to school and go to classrooms to collect candy. It seemed like a good idea then, but how about now? When kids can’t do it anymore it’s not fun to see the younger kids come in. Most children create a cushion that they will not have to stop trick or treating because it’s a holiday. When the thought comes to mind it almost seems unreal.

My moment was not fun at all. This had happened two years ago. My older cousin and I had been discussing going trick or treating together. We began to look at costume catalogs. When we narrowed down costumes we had made the plans final. A week before Halloween my cousin had called and said she wasn’t feeling well and would not be going trick or treating with me. At first it didn’t bother me that much because I figured I could find someone else. The night before Halloween I still hadn’t found someone to go with. I had started to cry because I knew I wouldn’t be going this year. Then my cousin called and said she had suddenly felt better and would go. I knew the whole thing was a lie so she didn’t have to go with me. I told her that I didn’t want her to come if she didn’t want to. Instead of trick or treating my parents bought me a bag of candy and a slushy. Now, on Halloween I have friends over instead of trick or treating. Some kids don’t have these realization moments and still go out at the age of sixteen.

What should parents do when a teenager shows up at their door dressed up waiting for candy? Should parents really give them candy? If they dress up and are in the spirit, they should just give them one. Parents shouldn’t encourage this behavior, but be sure to not be rude. If discouraging kids form trick or treating doesn’t happen naturally parents should offer alternative ideas. If it gets to them trick or treating in high school it’s time for drastic measures. Some alternative options to do are throw a party, have a few friends over, watch scary movies, buy candy, or go out and spend time with family. Remember to enjoy Halloween when you’re still young.

Stop Wasting Food and Save the Planet

"Wasted food" is food that is unspoiled, nutritious, and wholesome but is disposed or thrown away. This food may come from cafeterias, restaurants, factories, or grocery stores. By reducing the wastage of such food, we can help the environment in many ways.
When we throw away good food, resources such as labor, gasoline, water, fertilizers, land, and energy are wasted as well. This means that by throwing away consumable food, we are throwing away helpful resources as well. Also, when good food is dumped in landfills, the nutrients in the food are not absorbed by the soil, and instead, the food rots and produces a gas called methane. Methane is a greenhouse gas that heats up the atmosphere and is one of the major causes of global warming.
Some of the ways in which we can stop the wastage of consumable food and resources is by finding ways to stop disposing of food in the first place. By donating consumable food to non-profit government organizations (NGOs), we can feed the poor and hungry and keep them from starving. Composting, which is a method of decomposition of solid waste, helps to convert food into manure that is free of chemicals. This is another way which helps to convert good food into manure that can be used in place of harmful chemical fertilizers for crops. Understanding the importance of not wasting good food and using appropriate measures to avoid wastage of food is a step toward saving our planet.
20
Select the correct answer.
Which of these best summarizes this passage?
A.
"Wasted food" is food which is usually thrown away from cafeterias, restaurants, grocery stores, and food factories. People need to ensure that they are more cautious about wasting food.
B.
Wastage of good food is an environmental hazard that needs to be stopped. By using proper measures to stop wastage of good food, we can help save resources and the environment.
C.
Wastage of food causes large-scale damage to the environment and also to precious resources. This includes labor, gasoline, water, fertilizers, land, and energy.
D.
Stopping the wastage of food helps in more ways than one. For example, people can donate leftovers to various organizations that help to feed the poor and hungry.

Answers

Answer:D

Explanation:

You shouldn't throw away food because you don't like it or don't want to eat it.you should give it to the poor to help them.

Answer:

The correct answer was B) "Wastage of good food is an environmental hazard that needs to be stopped. By using proper measures to stop wastage of good food, we can help save resources and the environment."

Explanation:

I took the test, mine was C though

describe how llanos portrayed adults who remember 9-11 in comparison to students who know little to nothing about the day. why might she use the points of view both older and younger people

Answers

Answer:

I do not have enough time to answer the question but here are some ways You can  solve it.

Explanation:

Reread the passage and highlight things that can lean the the answer to the question or things you can add in your answer then reread the question even if you remember it when your done go back to highlighted areas One by one and make sure it fits. This should help you get your answer(s)

   hope this helped have a good day//Night

essay on a current problem and solution

Answers

       Imagine walking outside and discovering your pristine neighborhood being ripped to shreds. Tree branches scattered in the roads, shingles hanging loosely from your roof, and your car's paint melted off. Would you ever guess that this destruction could be caused by a small group of birds? Vultures have been proven to be important to our ecosystem, but when they are found in neighborhoods they can cause massive problems that can only be solved by removing them.

     In recent years, vultures have been detected roosting where they should not be. People have reported sightings of vultures nesting in neighborhoods. Previously, vultures had been known to roost on the side of a cliff, or in large trees. According to Compton’s by Britannica, "Old World vultures build large stick platform nests in trees or on cliffs, sometimes in large colonies.” So as you can see, when people found vultures roosting in neighborhoods, it was quite a shock. “At first, they were just a disturbing sight, but as the days passed, they became aware of the damage the birds were inflicting,” writes the author M.E. White in his article Vultures Make Life Difficult. And now a similar scenario has happened in a town in Northwest Roanoke. Vultures have created nests and roosting sites and have begun causing many dilemmas in this small town. Vultures may be important to our ecosystem, but they are not a natural part of the environment in these neighborhoods!

     This vulture predicament has affected all of the people in these neighborhoods. Surprisingly, the biggest problem that these vultures are creating is NOT eating the dead animals but instead eating caulk on houses, rubber tires, and practically anything soft. On several occasions, the birds have been seen to leave feces on cars. Since the droppings are so acidic they have been known to melt the paint! “...the feces they leave behind have been a nuisance to homeowners for years,” states the Roanoke Times. In fact, the melted paint on cars is probably the least of their worries. Now that vultures have been roosting in smaller trees that aren’t adapted to hold such weight, trees branches have broken. Since such large pieces of the tree are being ripped off, some of the trees have even died. The pests have also been seen eating the shingles right off the house! Carol Bannerman admits that “vultures will start to pick at anything that's rubber or soft.” So it’s not surprising that other things such as rubber tires, weatherstripping, and caulk have been eaten by the birds. All things considered, these pests have created big problems that have influenced all of the people living in these communities.

    In the long run, it would troublesome to have the vultures continue to live in these neighborhoods, so the town must scare away the vultures and take precautions so they cannot return. In Roanoke, officers made a last-ditch effort to remove the vultures from the town. Roanoke Times writes, “Bedford Police Chief Milton Graham said animal control officers have killed a handful of vultures in recent years to try to get them to disperse.” But usually, to remove the birds they must shoot cannons that make a lot of sounds. According to Vultures Make Life Difficult, “They shot the pyrotechnic bullets in the air and the noise and lights made the vultures fly away and stay away. It is the best way to get rid of vultures once they've settled in the trees.“ Once the vultures are gone, officers must set up precautionary measures so that the birds cannot return. In the past, they have placed wires on top of roofs so that the birds can’t land on the roofs and inflict further damage. People also have protected the trees. “One thing residents can do is to spray water up into the trees. Keeping the area constantly wet will keep the vultures from roosting,” states M.E. White. Although vultures are necessary, officers must scare the vultures away from the neighborhoods so that the town stays safe.

     As you can see, these vultures have created numerous problems that will be hard but not impossible to solve. These vultures must be removed, or many neighborhoods in Northwest Roanoke will be damaged beyond repair. Towns may be permanently ruined, and homes will be destroyed. Although this task may seem insurmountable, the United States will be able to fend off these birds so that neighborhoods will be vulture-free once more.

In what ways does Hansberry's knowledge of summer stay the same from childhood to adulthood?

Answers

Answer: idk sorry

Explanation:

Can someone please define a direct quotation?

Answers

DEFINTION Direct Quotation

A direct quotation is one in which you copy an author's words directly from the text and use that exact wording in your essay. Try to use direct quotations sparingly: only use them when they are focused precisely on the point you want to make and are both brief and telling, or where the substance/ wording of the quote is what you wish to address.

Explanation:

When directly quoting, remember the following points:

bullet for a short quotation, use quotation marks " " to indicate that these are someone elses words.

For example:

In fact, Rumelhart suggests that schemata "truly are the building blocks of cognition" (1981: 33).

bullet for quotations longer than three lines, take a new line and indent the quote to separate it from the main text (in this case you do not require quotation marks)

For example:

In fact, Rumelhart suggests that schemata

truly are the building blocks of cognition. They are the fundamental elements upon which all information processing depends. Schemata are employed in the process of interpreting sensory data (both linguistic and non linguistic), in retrieving information from memory, in organising actions, in determining goals and subgoals, in allocating resources, and generally, in guiding the flow of processing in the system (1981: 33-34).

Rumelhart (1981) attempts to unravel the functions of schemas, explaining them through a series of analogies.

bullet when referencing the quote include the page number from which it was taken

For example:

In fact, Rumelhart (1981: 33) suggests that schemata "truly are the building blocks of cognition".

HOPE THIS HELPS!

PLEASE MARK ME AS brilliant!

From the play: The Crucible



What happened the last time Hale thought he had found a witch?



The woman was merely a pest and the child she supposedly bewitched recovered.




The woman was put in prison and left to die.




The woman was exonerated, but the child she afflicted died.





The child was proven to be a mischievous liar and was punished.

Answers

Answer:

the women was exonerated, but the child she afflicted died

Which would not be included in the index

Answers

Answer: you don’t have options on here

Explanation:

Make sure to add everything instead of one little thing this question can’t be answered

Compound subjects are always considered plural.

Please select the best answer from the choices provided
ОТrue
OFalse

Answers

Answer:

False

Explanation:

Answer:

false I believe

Explanation:

Is “played nonstop all day“a metaphor?

Answers

Answer:

No

Explanation:

It has no in-depth/secondary meaning. It’s just highly informal and would probably be marked wrong if you wrote it for your teacher.

I would suggest something simple and actually accurate, like “Beth played all day.” and just leave it at that.

9) The only language used in personal narratives is sensory language.
True
False

Answers

False I’m pretty sure
The answer is false.

Drawing is a prewriting technique consisting of writing ideas down on a sheet of paper around a central idea within a circle, with the related ideas radially joined to
the circle using rays.
True
False

Answers

The answer is:
True

What is the best synonym for "injunction"

Answers

Answer:

order ruling direction directive command instruction

Explanation:

an of those i hope this helps your welcome :)

why do you think people resent newcomers or people who are different from themselves? what do you think they are afraid of?​

Answers

Answer:

They do not want to face change. They are worried that people will not want to be with them if everyone is different.

Explanation:

facts about puritan narratives?
also if you could site your sources that would be great! this is for an english project it’s due tomorrow send help lol.

Answers

-The Puritans were a group of people who grew discontent in the Church of England and worked towards religious, moral and societal reforms. (Www3.nd.edu)
-They believed the Church of England was too similar to the Roman Catholic Church and should eliminate ceremonies and practices not rooted in the Bible. (History.com)
-The name “Puritans” (they were sometimes called “precisionists”) was a term of contempt assigned to the movement by its enemies.(history.com)

Identifying Cause-and-Effect Relationships
We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?

—Immigrant Kids,
Russell Freedman

What effect happened as a result of the cause you found?

The family was anxious about failing the physical examination.
The family stayed at Ellis Island for three days.
The mother and children had to take eye examinations.
The family had to return to their home country.

Answers

Answer:

its A

Explanation:

i got it right

Answer:

A. the family was anxious failing the physical examination.

I need help with completing these 5 sentences they have to combine!!

Answers

Answer:Powerlifter84 ,

Explanation:

Arrange the following words and statements below following the format in American Psychological Association (APA).

Child and Adolescent Development :Looking at Learners at Different Life Stages
Metro Manila, Philippines
Brenda C. Corpuz
2010
Lorimar Publishing Inc.

HarperCollins Publishers
Choice Therapy: A New Psychology of Personal Freedom
New York, USA
William Glasser
1998

2004
New York, USA
Free Press New York
First things First, 1st Edition
Stephen R. Covey, Roger Merill, and Rebecca R. Merill

Boston, Massachusetts
Harvard Business School Press
Why Should Anyone Be Led By You?: What It Takes To Be An Authentic Leader​

Rob Goffee, Custodiosa A. Sanchez.,
2006

Answers

Answer:

whaaaaattt arranged but its too hard

Corpus, Brenda C. (2010) Child and blablabla. Metro manila, Philippines. Lorimar Publishing Inc.
the order is: Author (last name first), year, title, place, and finally publisher. Apply the same rule to the rest.
Other Questions
By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4)