Using your knowledge of the particle model, explain how substances dissolve.

PLS Answer this question I will make you as Brainliest

Answers

Answer 1

Answer:

A solute dissolves because its particles interact with the particles of a solvent. Anything that allows more solvent to touch more solute will cause a solute to dissolve more quickly. Small pieces of a substance dissolve faster than large pieces.

Explanation:

A solute dissolves because its particles interact with the particles of a solvent. Anything that allows more solvent to touch more solute will cause a solute to dissolve more quickly. Small pieces of a substance dissolve faster than large pieces.

Answer 2

Answer:

They dissolve becuz of the thing does the other thing i thinlk

Explanation:


Related Questions

are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it

Answers

Answer:

C. Steroids

Explanation:

Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.

Answer:

steroids

Explanation:

so c

which I true of the rock layers shown below​

Answers

Answer:

C

Explanation:

The fossil can get lifted due to water and other components

Joe Mama!!! Jk it’s C

Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy

Answers

Answer:

A. Advanced Decision analysis

Explanation:

Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.

Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.

Answer:

Advanced decision analysis

Explanation:

I took the quiz on edge

Search the NIH gene database for the term colorblindness. Use the results of the database search to explain how a father and mother who are not colorblind could have a son who is colorblind. Your model can be a pedigree chart, a Punnett square, or a diagram of chromosomes.

Answers

Answer/Explanation:

Red/green colorblindness is a recessive, X-linked condition. That means that the affected gene is on the X chromosome, and that the phenotype will only be present if there is no "healthy" gene, which is dominant to the mutated gene.

For two unaffected people to have an affected son, the mother must be a carrier. Remember, females have two X chromosomes and males have one. So if a female is a carrier of the colorblindness mutation, she will have one copy of the mutation and one normal copy of the gene, and will therefore be unaffected.

The punnet square (attached) shows that all their female children would be unaffected (have the B gene), but 1:2 male children would be colorblind, as their only copy of the gene is mutated (b).

Answer:

The person on top is awesome appreciate!!

Explanation:

got it right on edmmentum

describes natural selection?

Answers

Simply, natural selection is that the genetically strongest organisms will be the ones that are able to survive and reproduce, which eliminates weak characteristics, and keeps the strong ones. Survival of the fittest.

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

which organelle in the cell maintains homeostasis

Answers

Biology- Cells ( probably not) but worth a try ;)

Why do you think the size of a white dwarft affects its visual luminosity?

Answers

The bigger the size the more easier to see from a distance and the smaller the harder to see from a distance

Answer:

White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.

Explanation:

What is the molecule depicted in the figure above and in which organelle would it most likely be created?



A. ATP, the mitochondria


B. ATP, the nucleus


C.ADP, the chloroplast


D. ADP, the ribosome

Answers

Answer:

The answer is A.

Explanation:

ATP, the mitochondria

The molecule depicted in the figure above is ATP and the cell organelle in which it would most likely be created is: the mitochondria.

Cell organelles can be defined as the internal organs that are typically responsible for the performance of various functions (tasks) within the body of a living organism such as an animal, plant, and humans, especially for the survival of the organism.  

Some examples of cell organelles found in the body of living organisms include the following:

Nucleus. Cytoplasm. Cell membrane. Chromosome.Endoplasmic reticulum (ER). Golgi apparatus (bodies).Vesicles.Mitochondria.

Mitochondria is commonly referred to as the "power house" of a cell because it is saddled with the responsibility of providing and transforming all of the energy required by living organisms in the form of adenosine triphosphate (ATP).

In conclusion, it is very important that energy (ATP) is provided by mitochondria for the survival and optimum performance of a living organism.

Read more: https://brainly.com/question/19559847

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?

Answers

Answer:

Are you against or with?

Explanation:

,.;1q23wt4y5eu6ri7ertyur

plz help I will mark you brainlist plz ​

Answers

Answer:

1. Acid

2.  Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)  

10. acid

*Anybody correct me if I'm wrong*

Explanation:

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as...  Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

29. If lens A is labeled with 10x and the lens in use on B is labeled with 4x, What would
the total magnification be for the fruit fly you are looking at under the microscope?
a. 4000x
C. 400x
b. 40x
d. 4x

Answers

Answer:

B is the correct answer

Explanation:

4x10=40

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

The Big Bang Theory is an example of which kind of theory of creation of the
universe?
Expansion
Steady State
Unchanging
Moving

Answers

Expansion is the correct answer
The answer is expansion

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

What properties of carbon explain carbon’s ability to form different large and complex structures?

Answers

Carbon is four valence electrons they bond to the other carbon atoms

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

When and how were the first trans fats made with vegetable oil?

Answers

Answer:

Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

why are index fossils useful to geologist

a.they tell the relative age of the rock in which they occur

b. they tell the ages of many different rock layers

c.they tell the age of the rock at one location only

d. they tell the absolute age of the rock in which they occur

Answers

Answer:

Explanation:

Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.

Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.

Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?

Answers

Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.

In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.

Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.

The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

Learn more here: https://brainly.com/question/2088739

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?​

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water

Other Questions
Cindy and Victoria completed 8/9 of their job in a day. Cindy has done 1/9 of the work. How much of the work was done by Victoria? the scale factor for the triangles below is 3 2.54 mL of ethanol to mol ethanol (Hint: the density of ethanol is 0.789g/mL.) To what extent do we as humans have control over nature? Do you feel obligated to do your part to protect the environment, or at least refrain from causing damage? "choosing warning label for DNA" Which graph best describes the following situation?Matt was standing 3 feet from the edge of the pool. He walked away from the pool for 4 seconds. Then he was12 feet away from the edge of the pool. Could someone help me with number 17. Contact forces & friction. Please help!!! (20 points & brainliest!) Read the paragraph from "The Workers of Ellis Island."Ellis Island doctors were particularly watching for signs of contagious diseases. Incurable diseases included trachoma and tuberculosis and guaranteed a return trip to where the immigrant came from. Others, like diphtheria, measles and scarlet fever, for example, relegated the immigrant to the contagious disease wards where they were generally treated, cured and released. Sometimes the entire family was held on the Island while a child or responsible adult was being treated.Which sentence best represents the paragraph's central idea?Ellis Island doctors were particularly watching for signs of contagious diseases.Incurable diseases included trachoma and tuberculosis and guaranteed a return trip to where the immigrant came from. Others, like diphtheria, measles and scarlet fever, for example, relegated immigrants to the contagious disease wards where they were generally treated, cured and released. Sometimes the entire family was held on the Island while a child or responsible adult was being treated. Where did the Hyksos come from? Look at Figure 5. Which beaker contains a HYPOTONIC solution? * Beaker A Beaker B Beaker C Both beakers A and C Does anyone know if these are bad. The internet said its blood clot. Its on my elbow. Theres one on my sisters elbow too. What is the quotient for 6 and 1/2 divided by 3/4 Question 2 / 5Which of the following is a drug?a.)alcoholb.)waterc.)tead.)coffee What happens to Arsat's brother? If the variance of the data values in a population is 225, what is the standarddeviation of the data values?a.15b.17c.11d.13(apex) What activity had flourished so much in the Tang and Sung dynasties that it was required during civil service exams? What serves as much of the dividing line between the British colonies and the French colonies? Coach Brown made 50 pints of Gatorade for his team. How many gallons did he make? The sum of 6 consecutive odd numbers is 204. What is the fourth number in this sequence? Write the function in standard form.f(x) = - 3(x - 7)2 + 15