There are 870 people attending a conference.if 8.9% were canda how many people is this

Answers

Answer 1

Answer:

77.43

Step-by-step explanation:

Answer 2

Answer:

77.43 people were canda

Step-by-step explanation:

To find 8.9% of 870, we first turn 8.9% into a decimal. We can do this by shifting the decimal point two places to the left. This gives us 0.089. Now, we multiply this decimal by 870. Our product, 77.43, is our final answer.


Related Questions

can anyone help me with this?

Answers

Answer:

First Blank (4) Second Blank (3)

Step-by-step explanation:

The square in the middle is the base and if you count the side units you will have 4 on each side. From the square the triangle points up 3 units on the graph.

Hope this helps : ) Mark Brainliest

Free brainlest! Just answer this....... WHAT IS BETTER PS4 OR Xbox if you get it right you can have it!

Answers

Answer:

Depends

Step-by-step explanation:

PS4 has a better gaming system and better games (Spiderman example)

But Xbox has the better controller. I think Xbox is better I prefer it but it doesn't really matter.

Please help this is Geometry

Answers

Answer:

solution given:

volume of lower one[V1]=l×b×h=1.5×0.5×0.5=0.378m³

volume of upper one [V2]=l×b×h=1×0.5×(0.75-0.5)=

0.125m³

total volume=V1+V2=0.378m³+0.125m³=0.503m³

0.503m³ is your answer

Find the circumference and area of a circle with diameter of 18 inches. Use 3.14 for pi. Write your answer as decimals rounded to the nearest hundredth.
a. C = 56.52 in, A = 1017.36 in2
b. C = 56.52 in, A = 254.34 in2
c. C = 113.04 in, A = 254.34 in2
d. C = 113.04 in, A = 1017.36 in2
e. None of the above are correct.

Answers

Answer: b

Step-by-step explanation:

Radius = 9 inches, Pi= 3.14

Circumference = 2 x pi x radius = 2 x (3.14) x 9 = 56.52

Area = pi x radius x radius = (3.14) x 9 x 9 = 254.34

Answer:

Answer attached

Step-by-step explanation:

Help me please its due in 20 minutes!!!!

Answers

your mom is dead bro just give it up man

What is the length from Alaska to Chicago times 5 divided by 3?

Answers

Answer:

14302 miles

Step-by-step explanation:

from alaska to chicago it is 2861 mi.

2861 times 5

that divdied by three is 14302

what’s the domain of this relation?

Answers

Answer:

there is nothing here but thanks for the points

Step-by-step explanation:

Have a great rest of your day/night!

how can you use the multiplicative inverse to solve division problems?
(best answer gets brainliest)

Answers

Answer:

Hello, the multiplicative inverse is just another name for reciprocal. You can use this type of method when dividing fractions like:

1/2/3/5

You use the method known as kfc, keep, flip, change like this:

1/2 x 5/3

Notice how 1/2 is kept the same, the division sign is now a multiplying sign, and 3/5 is flipped.

And then you just answer it from there and you get 5/6

Step-by-step explanation:

I hope this helped you!

Determine the average percent of change from 1960–2000
1960 1970 1980 1990 2000
$0.25 $0.36 $1.19 $1.35 $1.26

show your work

Answers

Answer:

1970 +46%

1980 +232%

1990 +14%

2000 -8%

Step-by-step explanation:

Using the Pythagorean theorem: a right triangle has a side that is 24 in and one that is 25in (25 is the diagonal side) what is the length of the third side

Answers

Answer:

Third Side (Perpendicular side) = 7 inch

Step-by-step explanation:

Given:

First side (Base) = 24 inch

Second side (Diagonal/Hypotenuse side) = 25 inch

Find:

Third Side (Perpendicular side)

Computation:

Using Pythagorean theorem;

Perpendicular side = √Hypotenuse side² - Base²

Perpendicular side = √25² - 24²

Perpendicular side = √625 - 576

Perpendicular side = √49

Perpendicular side = 7 inch

Third Side (Perpendicular side) = 7 inch

Need help guys givin brainliest
fyi its tall not fall

Answers

Answer:

5 feet tall.

Step-by-step explanation:

So, it gives us the ratio of the Statue of Liberty

1 inch wide for each 61 feet tall.

Then it gives us the tallness of the actual thing:

305 feet tall.

To find out how wide it is, we should be able to divide 305 by 61.

305/61 is 5.

On the number line, plot and label all numbers with an absolute value of 32. Where did you place the points?

Answers

Answer:

on 32 and -32

Step-by-step explanation:

Help me quickly!!! I'll try to give Brainlyest

Answers

Answer:

number 12 is A for sure

1 is c hope that helps

I WILL GUVE BRAINERLEST AND A LIKE


Jack needs to replace some flooring in
his house.

Answers

Answer:

B

Step-by-step explanation:

i think

9 cm
4 cm
1
14 cm
5 cm

Answers

Answer:

this is D

Step-by-step explanation:

A store stocked 150 cans of popcorn for a weekend sale. That Weekend, 99 of the cans sold. What percentage of cans of popcorn stocked were unsold that weekend?

Answers

Answer:

34%

Step-by-step explanation:

99/150 = 0.66

1.00 - 0.66  = 0.34

34%

Answer:There is 48% of cans

How many quarters are there in 4
22?
2
134
Answer.​

Answers

i believe it is 320

the function f(x) = -x^2 + 44x -384 models the daily profit in dollars that a shop makes

Answers

the function f(x) = -x^2 + 44x -384 models the daily profit in dollars that a shop makes
The answer is b I believe.

Researchers investigated whether providing a fancy, foil-wrapped piece of chocolate with the dinner bill would lead to higher tips than not providing such a treat. Sixty-four dinner parties at a restaurant in Ithaca, NY were randomly assigned to receive such a piece of chocolate or not with their dinner bill. Of the 32 parties who received the chocolate, the average tip (as a percentage of the bill) was 17.84%, with a standard deviation of 3.06%. Of the 32 parties who did not receive the chocolate, the average tip (as a percentage of the bill) was 15.06%, with a standard deviation of 1.89%. Determine a 96% confidence interval for the size of the difference in average tips between the two groups

Answers

Answer:

The 96% confidence interval for the size of the difference in average tips between the two groups is (1.47%, 4.09%).

Step-by-step explanation:

Before building the confidence interval, we need to understand the central limit theorem and subtraction of normal variables.

Central Limit Theorem

The Central Limit Theorem estabilishes that, for a normally distributed random variable X, with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the sampling distribution of the sample means with size n can be approximated to a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]s = \frac{\sigma}{\sqrt{n}}[/tex].

For a skewed variable, the Central Limit Theorem can also be applied, as long as n is at least 30.

Subtraction of normal variables:

When we subtract normal variables, the mean is the subtraction of the means while the standard deciation is the square root of the sum of the variances.

Of the 32 parties who received the chocolate, the average tip (as a percentage of the bill) was 17.84%, with a standard deviation of 3.06%.

This means that:

[tex]\mu_{C} = 17.84, s_{C} = \frac{3.06}{\sqrt{32}} = 0.541[/tex]

Of the 32 parties who did not receive the chocolate, the average tip (as a percentage of the bill) was 15.06%, with a standard deviation of 1.89%.

This means that:

[tex]\mu_{NC} = 15.06, s_{NC} = \frac{1.89}{\sqrt{32}} = 0.3341[/tex]

Difference in average tips

The distribution has mean:

[tex]\mu = \mu_{C} - \mu_{NC} = 17.84 - 15.06 = 2.78[/tex]

Standard deviation:

[tex]s = \sqrt{s_{C}^2 + s_{NC}^2} = \sqrt{0.541^2 + 0.3341^2} = 0.6358[/tex]

96% confidence interval

We have that to find our [tex]\alpha[/tex] level, that is the subtraction of 1 by the confidence interval divided by 2. So:

[tex]\alpha = \frac{1 - 0.96}{2} = 0.02[/tex]

Now, we have to find z in the Ztable as such z has a pvalue of [tex]1 - \alpha[/tex].

That is z with a pvalue of [tex]1 - 0.02 = 0.98[/tex], so Z = 2.054.

Now, find the margin of error M as such

[tex]M = zs[/tex]

[tex]M = 2.054*0.6358 = 1.31[/tex]

The lower end of the interval is the sample mean subtracted by M. So it is 2.78% - 1.31% = 1.47%

The upper end of the interval is the sample mean added to M. So it is 2.78% + 1.31% = 4.09%

The 96% confidence interval for the size of the difference in average tips between the two groups is (1.47%, 4.09%).

Sean and Hope are going bowling. For each person, a game costs $4.25. Shoe rentals are $3.00. Sean gives the clerk $20 for their admission and shoe rental. How much change should he receive? *
1 point
$12.75
$5.50
$9.75
$14.50
PLZ HELPPP ME NEED IT BY TODAYYYYYYYYYY!!!!!!!!!!!!!

Answers

It’s 12.75 u egg head

Answer:

The answer is 5.50.

Step-by-step explanation:

First, you do 4.25+3.00=7.25

Second, 20-7.25=12.75

but read the beggining again it says sean AND hope so repeat the step again.

First, you do 4.25+3.00=7.25

Second, 20-14.50=5.50

HELP ME PLEASE!!! No links

Answers

Answer:

H 60

Step-by-step explanation:

You would need to find out what you would multiply times 0.5 to get 30. Then to get that answer just divide 30 by 0.5. which is 60

The radius of each semicircle in the composite figure is x units. The width of the rectangular part of the figure is equal to the radius.

Which expression represents the distance around the composite figure

A. 6x+2πx
B. 6x +4πx
C. 10x +2πx
D. 10x +4πx​

Answers

Answer:

A)  6x + 2πx

Step-by-step explanation:

left side of figure = 4x

top and bottom flat portion of figure = 2x

2 semi-circles with radius of x is equal to 1 full circle with diameter = 2xπ

distance around = 4x + 2x + 2xπ or 6x + 2πx

Find the value of x in the triangle shown below x 42 106

Answers

Answer:

Step-by-step explanation:

where is the picture?

Answer:

you need a picture lol

Step-by-step explanation:

5x +60/x -15x +15/x-20​

Answers

Answer:

5x-60=x - solution,..........

Answer:

Answer:

5x +60/x -15x +15/x-20

60/x+15/x-15x+5x-20

75/x-10x-20

is your answer

combined liked terms by adding and subtracting.

How much money is 5 dollars, 10 dimes, and 10 pennies?

Answers

Answer:

6 dollars and 10 cents

Step-by-step explanation:

I'm sorry this isn't the answer, but I just want you to know that you are incredible and that I love you for you! You are special to everyone you meet, and should not change who you are. I know your life may be tough, but you are strong and can get through it!

The table represents equivalent ratios of x to y. Find the missing numbers in the table.
Х
y
15
20
16
25
o
30
24

Answers

The answers are 12 and 18 very simple

Mark had 3 times as many quarters as nickels. He had $1.60 in all. How many nickels and how many quarters did Mark have? x represents . 3x represents .

Answers

Answer:

x represents nickels = 2

3x represents number of quarters = 6

Step-by-step explanation:

x represents nickels

3x represents number of quarters

We'll multiply each of those times the value of the coin they represent, and make that equal to the total amount of money Mark has to get the value of x

x(0.05) + 3x(0.25) = 1.60

0.05x + 0.75x = 1.60

0.80x = 1.60

x = 2 = number of nickels

So 3x = 6 = number of quarters

Checking the math:

2(0.05) + 6(0.25)= 0.10 + 1.50 = 1.60

The area of a SQUARE is 22 ft2. Which of the following is the closest to
the length of each SIDE of the square?

Answers

Answer:

4.7ft

Step-by-step explanation:

Hello, the answer would be 4.7ft because 4.7^2 is closest to 22ft^2 with it being 22.09ft^2.

Please help me.. I don't undersand this

Answers

Answer:

45 degrees.

Step-by-step explanation:

When two angles are next to each other along a straight line, their sum = 180 degrees.

180 - 135 = 45

Answer:

I know i may be unwanted here but I just want you to know that you are incredible and that I love you for you! You are special to everyone you meet, and should not change who you are. I know your life may be tough, but you are strong and can get through it!

Step-by-step explanation:

An event that is guaranteed to happen has a probability of exactly

Answers

Answer:

100%

Step-by-step explanation:

It is confirmed to happen, or [tex]\frac{100}{100}[/tex]

Answer:

An event that is guaranteed to happen has a probability of exactly 1

Other Questions
Micheal home is 12 feet below and his mother's home is 12 above sea levelMicheal says their homes are elevations because they are in opposite directions Is he correct? Explain. When did the agency say something would be stolenBy evening In the afternoonIn the eveningAt 5:30pmThe answer is by evening Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain.