The temperature in your bedroom is 65 F with a few point temperature of 45 F. You open your bedroom window to let some outside air in. The outside temperature is 50 F and dew point temperature is 45 F.


Will the amount of water vapor in the room change?
Does dew point temperature increase, decrease, or remain the same?
Does relative humidity increase, decrease, or remain the same?

Answers

Answer 1

Answer: the amount of water vapor and the temperature will stay the same

Explanation:


Related Questions

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

Answers

Answer:

losing weight after childbirth

Explanation:

This contributes to the disease being the second leading cause of death of Americans. Losing weight after childbirth.

What can high blood pressure cause?

Factors that can lead to high blood pressure have: A diet high in salt, fat, and/or cholesterol.

Chronic diseases such as kidney and hormone problems, diabetes, and high cholesterol.

Family background, quite if your parents or other close relatives have high blood pressure.

Thus, option "A" is correct,  Losing weight after childbirth.

To learn more about childbirth click here:

https://brainly.com/question/16013075

#SPJ2

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Answers

Answer:

1. heat is collected from the earth

2. heat is used to change water into steam

3. steams turns a turbine

4. generators produce electricity

Explanation:

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

Answers

Answer:

Well I need more information to answer that question.

Explanation:

Explanation:

can I have a picture of the question please

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Answers

Cutting chicken and tomato on the same cutting board

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

1. Place the letters in the correct order for DNA replication (a, b, c): ___
a. Daughter strands are formed using complementary base pairing.

b. DNA unwinds

c. The DNA of the daughter strands winds together with its parent strand.
2.Why is DNA replication called “semi-conservative”? ___
3.What enzyme unwinds or unzips the parent strand? ___
4.What enzyme connects the new bases to the old bases in the DNA template? ___
5.___DNA replication results in two DNA molecules,

a. each with two new strands

b. one with two new strands and one with 2 original strands

c. each with two original strands
d. each with one new strand and one original strand

6.___DNA replication is said to be semiconservative because:

a. both RNA and DNA synthesis are involved in the process.

b. part of the telomere is lost during each round of replication.

c. a new double helix contains one old and one new strand.

d. each new strand is complementary, not identical, to its template

Answers

Explanation:

1. b-a-c

2. Because in each of the new pair of double stranded DNA formed after replication, a parent strand is present in each.

3. Helicase

4. DNA Polymerase

5. Option D

6. Option C

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

What does "reliability" mean in these sentences?

Answers

Answer:

The first one is correct

Answer: The first one, the quality of being able to be trusted.

Don't really know how to explain but being reliable is being trustworthy and responsible.

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea


5. Explain the process through which natural selection can lead to a new species of organism.

Answers

Answer:

Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to specistion, where one species gives rise to a new and distincly different species.

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

Answers

Answer:

A and C would least be affected

Explanation:

because a doesn't live off of insects and see if insects do disappear it still has seed stuff all back on

Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

What is the survival of the fittest?

This theory suggests that the fittest organisms survive in the environment and reproduce.

The fittest organisms have most of the required traits to survive. Bird A eats the seeds, Bird -B eats the insects, and bird C eats both seeds and insects,

Therefore, Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

Learn more about survival of the fittest:

https://brainly.com/question/1226176

Other Questions
g The famous detective Percule Hoirot was called in to solve a baffling murder mystery. He determined the following facts: (a) Lord Hazelton, the murdered man, was killed by a blow on the head with a brass candlestick. (b) Either Lady Hazelton or a maid, Sara, was in the dining room at the time of the murder. (c) If the cook was in the kitchen at the time of the murder, then the butler killed Lord Hazelton with a fatal dose of strychnine. (d) If Lady Hazelton was in the dining room at the time of the murder, then the chauffeur killed Lord Hazelton. (e) If the cook was not in the kitchen at the time of the murder, then Sara was not in the dining room when the murder was committed. (f) If Sara was in the dining room at the time the murder was committed, then the wine steward killed Lord Hazelton. Please help me with this homework In order to make green paint, a 2:3 ratio of blue paint to yellow paint is used. If there are 30 ounced of green paint how many ounces of blue panit was used? 13) Store A and Store B both sell apples by the pound. Store A uses the function y = 0.38x,where y represents the total cost in dollars and x represents the number of pounds. Therelationship between weight and cost at Store B is shown in the table. At which storeare apples more expensive?50 Points NEED HELP ASAP PLS AND THANK YOU Please helpI will mark brainliest Answer the questions in the picture Thank you :) 50 Points For All these Answers John is 5 feet 10 inches tall. There are 2.54 centimeters in 1 inch.What is Johns height in centimeters?25.4 cm17.78 cm177.8 cm152.40 cm Determine the age of the rocks and fossils by moving the samples to the mass-spectrometer. Record the data in the StudentGuide How much time is between 9:25am then return home at 7 :10pm Caroline wears a suit to work everyday. Caroline has 6 suits, 3 overcoats, and 4 pairs of shoes. How many different outfits can Caroline create? * 10. When she saw me waiting, she ran________me. a. Around b. Towards c. Through d. Forward I need help with this please Please help me I need to pass 1. how many members participate in h&ms loyalty program worldwide? what occurs when experiences influence our interpretation of data? $26 is what percent of $40?$26 is ___% of $40. tell whether the following sequence is geometric or not. If geometric find rhi can someone please answer my question i really need the complete step-by-step solution. thank you helpWhat is a value of y that makes the relation 35259ya function which country is an example of a capitalist country? Un hamster fait tourner sa cage de 27cm de diamtre a raison de 14tours par minute .quel est le module de l acclration centripte d un morceau de nourriture coll sur la paroi extrieure de la cage ?