The tails of animals can serve many important functions. They are mainly used in balance and locomotion. Many lizards have a fragile, detachable tail that will come off when they are attacked by predators, allowing them to escape.Why is the presence of a brightly colored, detachable tail an advantage for some lizards?
A. They are more likely to attract mates.
B. Predators more likely grab them by the tail:
C. It helps them blend into natural environtment
D. Predator likely to be frightened away by a brightly collored tail

Answers

Answer 1

The presence of a brightly colored, detachable tail is an advantage for some lizards because predators are likely to be frightened away by a brightly colored tail.                                                                                                                                The correct option is D.

What is a detachable tail?

A detachable tail is a tail that can be disconnected from the body when under pressure from a predator or other threats. This adaptation is primarily seen in lizards, which have the ability to shed their tails as a form of self-defense.

Why is the presence of a brightly colored, detachable tail an advantage for some lizards?

Bright coloration is an evolutionary adaptation that may indicate danger to potential predators. In some cases, it may help predators to avoid attacking. When a lizard's tail is brightly colored and detachable, it can be used as a defense mechanism.

The lizard can use its tail as a decoy to attract predators to the tail, which can then be shed, allowing the lizard to escape. Predators, seeing the brightly colored tail, may be frightened away by the apparent danger it represents to them.  

Another potential advantage of a brightly colored, detachable tail is that it may make it easier for the lizard to attract mates. This is because bright colors are often associated with sexual selection, which means that males with bright, attractive colors are more likely to be chosen by females during the mating process.

To know more about detachable tail refer here:

https://brainly.com/question/31180874#

#SPJ11


Related Questions

mendel's understanding of the inheritance of traits in peas mendel's understanding of the inheritance of traits in peas, expressed in modern language, included: check all that apply.

Answers

Mendel's understanding of the inheritance of traits in peas, expressed in modern language, include: The law of segregation, The law of independent assortment, The law of dominance

What is inheritance?

Inheritance refers to the passing of genetic material (traits) from one generation to the next. Inherited characteristics are determined by genes, and they can either be visible or not.

Mendel's discovery is the foundation of genetics as we know it today. This is because Mendel developed the first system for predicting inheritance, demonstrating that certain characteristics are transferred from one generation to the next.


The law of segregation,
which states that the two alleles of a gene separate into different gametes when a plant produces gametes (sex cells).
The law of independent assortment, which states that each pair of alleles segregates independently during gamete production.
The law of dominance, which states that a dominant allele will always be expressed in the phenotype of the organism.

To know more about inheritance of traits refer here:

https://brainly.com/question/22686199#

#SPJ11

How does microwave radiation affect the germination of radish seeds?

Answers

Microwave radiation can have both positive and negative effects on the germination of radish seeds, depending on the intensity and duration of exposure.

Positive effects:

Microwave radiation has been shown to increase the germination rate and speed of radish seeds in some studies.Short-term exposure to low-intensity microwave radiation may stimulate the enzymes and metabolic activity in the seeds, leading to faster and more uniform germination.Microwave radiation may also help to break down the seed coat and promote the uptake of water and nutrients, which can facilitate germination.

Negative effects:

Long-term or high-intensity exposure to microwave radiation can have negative effects on the germination of radish seeds.Prolonged exposure to high-intensity microwave radiation can damage the cellular structure of the seeds and inhibit germination.Excessive exposure to microwave radiation can also lead to the production of reactive oxygen species (ROS) and oxidative stress, which can cause cellular damage and impair germination.

Overall, the effect of microwave radiation on the germination of radish seeds is complex and depends on the intensity and duration of exposure. While low-intensity and short-term exposure may have positive effects, prolonged or high-intensity exposure can have negative effects and inhibit germination. Further research is needed to determine the optimal conditions for using microwave radiation to enhance the germination of radish seeds.

Learn more about radish seeds:

https://brainly.com/question/7131226

#SPJ11

6. which location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is not sufficient. explain.

Answers

The location might have large fish kills that is not associated with nutrient pollution if containment of the pollutant is an oil spill.

Oil spills can lead to fish kills because they block sunlight and oxygen exchange at the surface of the water and they also cause a reduction in oxygen levels because bacteria consume the oil and use up the oxygen in the process. These conditions can make it impossible for fish and other marine life to survive. Other possible factors that can lead to large fish kills include algae blooms occur when there is an excessive growth of algae in the water. The algae consume the oxygen in the water, leading to a decrease in oxygen levels that can be deadly for fish.

Wastewater that is high in organic matter can also lead to fish kills. Bacteria in the water consume the organic matter and use up the oxygen in the process, leading to a decrease in oxygen levels that can be deadly for fish. Extreme weather conditions such as drought, heatwaves, and cold snaps can also lead to fish kills. For example, when the water temperature is too high, fish may become stressed and die. Conversely, when the water temperature is too low, fish may become sluggish and vulnerable to predators.

Learn more about oil spill at:

https://brainly.com/question/1307422

#SPJ11

which atomic particles are in a unique cloud outside of the nucleus of the atom?

Answers

The nucleus of an atom is surrounded by a cloud of electrons. Remember, electrons are negatively-charged and are attracted to the positively-charged protons in the nucleus.

The fundamental unit of matter is thought to be the atom. Atoms are the building blocks of all objects with mass, or those that take up space. We now know that each atom is often made up of smaller particles, despite the fact that its original term referred to a particle that couldn't be further divided—the tiniest thing that was possible. They are frequently called subatomic particles because they are the building blocks of atoms. Three subatomic particles exist: protons, neutrons, and electrons.

Protons and electrons are the two subatomic particles with electrical charges. Protons have a positive charge, while electrons have a negative charge. In contrast, neutrons lack a charge. A basic tenet of physics is that charged particles repel one another while charged particles attract one another. Protons and electrons are therefore drawn to one another, much like the poles of a magnet. Protons are attracted to other protons and electrons are attracted to other electrons, much like when you try to push the same ends of two magnets together and encounter resistance.

To know more about electrons click here:

https://brainly.com/question/1255220

#SPJ4

How does the location structure of the endocrine organs in the fetal pig differ from that in humans?

Answers

The adrenal glands are found near the aorta towards the cephalic end of the kidneys unlike the humans where it is present at the top of the kidneys.

Adrenal glands are the small triangular shaped kidneys. They are responsible for producing the hormones that regulate the functions of metabolism, immune system, blood pressure, or response to stress. These hormones are aldosterone, cortisol, androgens and estrogen.

Kidneys are the organs present in a pair and are of the shape of beans. The function of kidneys is to filter the blood and remove all the impurities in the form of dissolved ions, proteins, and waste water. The kidney have a basic functional unit called the nephron.

To know more about adrenal glands, here

brainly.com/question/1406904

#SPJ4

telophase and cytokinesis is a step of mitosis. what key event happens during telophase and cytokinesis?

Answers

Telophase and cytokinesis are both steps in mitosis. The key events that happen during telophase and cytokinesis are formation of the nuclear envelope, formation of the contractile ring, division of the cytoplasm

The nuclear envelope starts to reform around each set of chromosomes, it does this by gathering membrane vesicles from the Golgi apparatus and other membranes within the cell. Formation of the contractile ring, this occurs only in animal cells, and is the beginning of the cytokinesis process. The contractile ring is made of actin and myosin, two proteins that contract like muscle tissue to "pinch" the cell membrane and divide the cell in two.

Division of the cytoplasm, once the nuclear envelope is fully formed and the contractile ring is in place, the cell begins to divide into two daughter cells. This is accomplished by the contraction of the contractile ring, which pulls the cell membrane inward to create a small "cleavage furrow."  The cleavage furrow deepens and ultimately divides the cell in two. The end result of telophase and cytokinesis is the creation of two identical daughter cells, each with a full complement of genetic material from the parent cell.

Learn more about  cytokinesis at:

https://brainly.com/question/29765124

#SPJ11

two proteins interact to form a multimeric complex. when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. this type of mutation is classified as .

Answers

When one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

What is a loss-of-function mutation?

A loss-of-function mutation is a type of genetic mutation in which a gene's normal function is impaired or eliminated. This type of mutation can lead to a decrease or complete loss of protein function in the body. It might result in the inability to produce a protein or the production of a defective protein, both of which can have consequences for normal biological function. The severity of loss-of-function mutations can differ, depending on the importance of the protein and the extent of the mutation.

To sum up, when one of the proteins is mutated, there is a substantial loss of functional activity in the multimeric protein. This type of mutation is classified as a loss-of-function mutation.

Learn more about mutation: https://brainly.com/question/14438201

#SPJ11

16. A farm has a bluish-gray color Andalusian fowl, but doesn't want anymore of that color of bird. Which color of bird
would be best for the farmer to breed the bluish-gray Andalusian fowl with in order to have the lowest chance of having offspring that are bluish-gray? Why?

Answers

Black (BB) and white (B'B') individuals are homozygous in Andalusian fowls. An homozygous white bird and a heterozygous black bird are crossed. All of the progeny are bluish grey.

What causes Blue Andalusian birds to exist?

The Blue Andalusian fowl's plumage phenotype is the consequence of heterozygosity again for expanded black (E) gene combined with the blue (Bl) mutant (for a review, see Smyth, 1990). Heterozygotes' feathers have such a slate blue colouring as a result of the Bl gene's alteration of the normal synthesis of black pigment.

What kind of hens are Blue Andalusian?

According to the Standard of Perfection, the Blue Andalusian should have white earlobes, smooth legs, or a single comb. Each feather should also be clearly interwoven with a dark blue or black. Male Section and click have an upright comb, whilst mature hens typically have a bigger comb which flops to one side.

To know more about heterozygous visit:

https://brainly.com/question/30622664

#SPJ1

TACAGGATCATTTCGCGAACGGAGCCGAACT
1. Convert this DNA to Pre mRNA, mRNA, and tRNA

Answers

AUG UCC UAG UAA AGC GCU UGC CUC GGC CUU GA(?) last letter there is gone

what are the two ways the video mentions that invasive species can be introduced into aquatic ecosystems? a) on ship hulls and in large aquariums b) on ship hulls and through hitchhikers c) in ballast water found in ships and through fish farm nets d) in ballast water found in ships and as bait in commercial fishing expeditions please select the best answer from the choices provided a b c d

Answers

Invasive species can be introduced into aquatic ecosystems through a variety of pathways, but the video mentions two specific ways.

The first way is through ballast water found in ships, which is water taken on board to stabilize the vessel during travel. When the ship reaches its destination, this ballast water is discharged along with any organisms it may contain, including potential invasive species. This is a common pathway for the introduction of aquatic invasive species.

The second way is through the use of live bait in commercial fishing expeditions. Live bait can contain non-native species that can be introduced into new environments if they are not properly disposed of. This pathway is often overlooked but can be an important source of invasive species in aquatic ecosystems.

Therefore, the correct answer is d) in ballast water found in ships and as bait in commercial fishing expeditions.

To learn more about aquatic ecosystems visit;

https://brainly.com/question/4967501

#SPJ4

Table 2. Philippine Volcanoes Worth Seeing

Province

Active Volcano

Interesting Facts

1

2

3

4.

5. ​

Answers

Here are some active volcanoes in the Philippines that are worth seeing and some interesting facts about them:

Province: Albay

Active Volcano: Mayon Volcano

Interesting Facts:

Mayon Volcano is an iconic landmark of the Bicol region and is renowned for its perfect cone shape.

It is the most active volcano in the Philippines, having erupted over 50 times in the last 500 years.

Mayon is known for its "Lava Fountaining," where it produces ash columns and lava flows that can be seen from miles away.

Province: Batangas

Active Volcano: Taal Volcano

Interesting Facts:

Taal Volcano is a complex volcano located on the island of Luzon in the province of Batangas.

It is one of the smallest active volcanoes in the world but has been very active throughout history.

Taal has erupted over 30 times since the 16th century, with the most recent eruption occurring in January 2020.

Taal Volcano has a crater lake which can be reached by boat, and tourists can enjoy scenic views of the volcano from Tagaytay City.

Province: Camiguin

Active Volcano: Mount Hibok-Hibok

Interesting Facts:

Mount Hibok-Hibok is the only active volcano on the island of Camiguin.

It has erupted at least 5 times in the past century, with the most recent one happening in 1951.

Mount Hibok-Hibok is a popular hiking destination among locals and tourists, offering stunning views of the island and the sea.

Province: Sorsogon

Active Volcano: Bulusan Volcano

Interesting Facts:

Bulusan Volcano is located in the province of Sorsogon in Bicol and is one of the most active volcanoes in the Philippines.

It has erupted over 15 times since the 19th century, with the most recent eruption occurring in 2020.

Bulusan is a popular hiking destination, with several trails leading to its crater and offering breathtaking views of the surrounding landscape.

Learn more about volcanoes here brainly.com/question/12945128

#SPJ4

the term for a specific molecule on which an enzyme acts is the

Answers

The term for a specific molecule on which an enzyme act is a substrate. Substrates are molecules that enzymes bind to and catalyze reactions on.

Enzymes are organic catalysts that are produced by living organisms. Enzymes are biocatalysts that speed up the rate of biochemical reactions within the cell, they are biologically active and necessary for the survival of the organism. A substrate is a particular molecule that binds to an enzyme's active site and is transformed by a reaction.  The enzyme-substrate interaction is determined by the precise shape of the active site, as well as the shape and charge distribution of the substrate.

Learn more about substrate: https://brainly.com/question/4047091

#SPJ11

Can someone help me with this question please

Explain why there is no set number of mutations that always result in cancer.

Answers

Answer:

There is no set number of mutations that always result in cancer because the development of cancer is a complex process influenced by many factors. Cancer can arise from mutations in many different genes that affect the regulation of cell growth and division, DNA repair mechanisms, and other important cellular processes. Additionally, the accumulation of mutations can be influenced by external factors such as exposure to carcinogens like tobacco smoke, radiation, or certain chemicals, as well as by lifestyle factors like diet and physical activity.

Some mutations may have little effect on the development of cancer, while others may be critical drivers of the disease. The number and type of mutations required for cancer to develop can vary depending on the type of cancer, the individual's genetic makeup, and other factors such as exposure to environmental factors or lifestyle choices. Therefore, there is no set number of mutations that always result in cancer, and the development of cancer is a complex and multifactorial process.

ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides. True or False?

Answers

The given statement "ddNTPs are labeled with fluorescent dyes in order to differentiate between the different nucleotides" true. because ddNTPs (dideoxynucleotides) are used in Sanger sequencing to terminate DNA synthesis, allowing for the determination of the nucleotide sequence of a DNA fragment.

To differentiate between the different nucleotides, ddNTPs are labeled with different fluorescent dyes, each of which emits a unique wavelength of light. The fluorescent signal emitted by the ddNTPs is detected by a laser during sequencing, allowing for the identification of the nucleotide sequence of the DNA fragment.

Therefore, labeling ddNTPs with fluorescent dyes is an important part of Sanger sequencing. SO, The given statement is true.

To learn more about nucleotides

https://brainly.com/question/13185536

#SPJ4

Which type of valve opens in response to increasing pressure in the ventricles?

Answers

The type of valve opens in response to increasing pressure is semilunar valves.

Semilunar valve, one of two pocket-like, half-moon-shaped organs that connect the heart's left and right ventricles to the aorta (aortic valve) and pulmonary artery, respectively. The semilunar valves allows blood to flow into the arteries from the ventricles and prohibit the backward flow of blood from the arteries into the ventricles.

The endocardium, a thin, smooth membrane, and connective tissue make up the semilunar valves. The atrioventricular valves, which are situated halfway between the atrium and the ventricle, cooperate with them in order to function. The audible pulse is connected to the closure of the heart valves. The atrioventricular valves close first, followed by the pulmonary and aortic semilunar valves, which produce the second sound.

Learn more about Semilunar valves:

https://brainly.com/question/14481540

#SPJ4

body cells contain a full set of chromosomes from each parent. these _____ chromosomes contain matching gene sequences.

Answers

Answer:

Explanation:

Human body cells (somatic cells) have 46 chromosomes. A somatic cell contains two matched sets of chromosomes, a configuration known as diploid. The letter n is used to represent a single set of chromosomes; therefore, a diploid organism is designated 2 n.

explain each step of the skeletal muscle contraction process in your own words using the sliding filament theory

Answers

The sliding filament theory has various steps including Nerve impulse, Acetylcholine release, Muscle fiber depolarization, Calcium release and Cross-bridge formation.

Skeletal muscle contraction is a complex process that involves the interaction of different proteins in the muscle fibers. Here are the steps of the skeletal muscle contraction process using the sliding filament theory:

Nerve impulse: Skeletal muscle contraction begins with a nerve impulse that travels down a motor neuron and reaches the neuromuscular junction, which is the point where the motor neuron meets the muscle fiber.Acetylcholine release: When the nerve impulse reaches the neuromuscular junction, it triggers the release of a neurotransmitter called acetylcholine into the synaptic cleft, which is the tiny gap between the motor neuron and the muscle fiber.Muscle fiber depolarization: The acetylcholine molecules bind to receptors on the muscle fiber membrane, which causes a depolarization of the muscle fiber. This depolarization spreads along the membrane and into the interior of the muscle fiber through a network of tubules called the T-tubules.Calcium release: The depolarization of the muscle fiber triggers the release of calcium ions from the sarcoplasmic reticulum, which is a specialized organelle that stores calcium ions in muscle fibers.Cross-bridge formation: The calcium ions bind to a protein called troponin, which causes a change in the shape of another protein called tropomyosin. This change in shape exposes binding sites on the protein actin, which forms the thin filaments of muscle fibers.

To know more about sliding filament theory

brainly.com/question/30404392

#SPJ4

Which of the parent cells can transmit the changed DNA to the offspring?

Answers

Through the process of cell division and reproduction, any parent cell that experiences a change in its DNA (genetic material) has the potential to pass the altered DNA to its offspring.

The egg cell (female gamete) and the sperm cell (male gamete) are the two parent cells in sexual reproduction, and they each provide the baby with half of its genetic makeup. An alteration in the DNA of either the egg or the sperm cell, such as a mutation, can be passed on to the progeny.

Asexual reproduction creates identical children by dividing the parent cell. Before dividing, if the parent cell goes through a DNA alteration, this DNA change will be present in both the parent cell and the child.

The type and magnitude of the DNA mutation, as well as other parameters including the progeny's viability and survival, all play a role in determining whether altered DNA is transmitted to offspring during sexual and asexual reproduction.

To know more about cell division,

https://brainly.com/question/29773280

#SPJ4

a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left.true or false

Answers

The statement "a decision tree is read from left to right, with the conditions along the various branches and the actions at the far left" is False.

A decision tree is read from left to right, but the conditions are usually represented as nodes or circles, and the actions or outcomes are represented as branches or lines. The conditions are evaluated at each node, and based on the outcome of that evaluation, the tree branches off to the next node, and so on until an action or outcome is reached.

The branches are typically labeled with probabilities or expected values, and the goal of the decision tree is to identify the optimal decision or course of action based on the available information and the desired outcome.

To learn more about decision tree refer to:

brainly.com/question/30673588

#SPJ4

mcat the association observed experimentally between the expression of mirnas and mrnas in ar kidney transplants indicates that mirnas regulate the expression of genes implicated in which type(s) of immune response(s)?

Answers

In the cell cytoplasm, messenger RNA (mRNA) and microRNA bind to control the majority of gene expression. The designated mRNA will either be destroyed or its components recycled, rather than being promptly translated into a protein.

How does the cytoplasm work?

The gel-like liquid that makes up a cell's cytoplasm. Chemical reactions take place in it as the medium. It gives other organelles in the cell a base from which to function. The cytoplasm of something like a cell performs every task necessary for cell division, growth, and replication.

The cytoplasm is what, exactly?

History. First used as a synonym to protoplasm when Rudolf von Kölliker first coined the phrase in 1863, the phrase has since come to refer to the cell's interior and extracellular organelles.

To know more about cytoplasm visit:

https://brainly.com/question/15417320

#SPJ1

What is transport in humans and plants and what is the difference?

Answers

Answer:

In humans the transport system occurs through vein, artery and capillaries. Whereas, in plants , it occurs through the xylem vessels, tracheids and phloem sieve tubes.

Explanation:

a bacterial species differs from a species of eukaryotic organisms in that a bacterial species group of answer choices does not breed with other species. breeds with its own species. can be distinguished from other bacterial species. is a population of cells with similar characteristics. has a limited geographical distribution.

Answers

"A bacterial species differs from a species of eukaryotic organisms in that a bacterial species does not breed with other species."

A bacterial species does not interbreed with other species, but will only breed with its own species. This is different from a species of eukaryotic organisms, which may be able to breed with other species. Additionally, bacterial species can be distinguished from other bacterial species based on characteristics such as morphology, genetic makeup, and metabolic characteristics. Bacterial species also typically have a limited geographical distribution.

Learn more about bacterial species: https://brainly.com/question/8695285

#SPJ11

a black haired true breeding guinea pig is crossed with a white haired true breeding guinea pig. all of the offspring have black hair.

a. which color is dominant?
b. what are the genotypes and phenotypes of the parents?
c. what are the genotypes and phenotypes of the offspring?

Answers

a. Their phenotypes are black-haired and white-haired, respectively.

b. The genotype and phenotype of all offspring are BB and black-haired, respectively.

c. All of the offspring have black hair, so they must all have the genotype BB.

What are the genotypes and phenotypes of the parents?

In this case, we can infer that black hair color is dominant over white hair color since all offspring have black hair.

Since they are both true breeding, their genotypes are homozygous dominant and homozygous recessive, respectively. Therefore, the genotypes of the parents are BB and bb. Their phenotypes are black-haired and white-haired, respectively.

Let's denote the black-haired true breeding guinea pig as BB and the white-haired true breeding guinea pig as bb.

Therefore, the genotype and phenotype of all offspring are BB and black-haired, respectively.

Learn more about genotype here: https://brainly.com/question/902712

#SPJ1

Different forms of the same element with different numbers of neutrons are called:
a. molecules
b. compounds
c. isotopes
d. lattices

Answers

Answer: c. isotopes

Explanation:

maybe sorry if wrong

which process is based on dna recombination? homologous recombination bacterial conjugation all of these dna repair crossover

Answers

Crossover is the process based on DNA recombination.

The process of recombining the genetic material of two parents to create a new combination of genes is known as recombination. DNA recombination is a technique that enables cells to exchange genetic material, allowing for the exchange of genetic information. Homologous recombination, bacterial conjugation, and crossover all involve DNA recombination.

Homologous recombination is a DNA repair process that occurs in cells that have experienced DNA damage. It's a procedure that entails the transfer of genetic material from one DNA molecule to another. The procedure is most common in cells that have stopped dividing or have stopped dividing altogether.

Homologous recombination is a very effective mechanism for repairing DNA damage, and it is commonly used by cells to repair double-strand breaks. Bacterial conjugation is a process that allows bacteria to transfer genetic material, such as plasmids, from one bacterial cell to another. Bacteria use this mechanism to transmit genetic material between cells, allowing them to pass on beneficial traits like antibiotic resistance.

Crossover is a DNA recombination mechanism that occurs during meiosis. The chromosomes' maternal and paternal copies swap genetic information during this process, resulting in new combinations of genes in the offspring's cells. Crossover is responsible for the genetic diversity of the offspring and is a critical component of evolution.

Learn more about DNA: https://brainly.com/question/16099437

#SPJ11

What is the significance of the crossing over that occurs between Nonsister chromatids during meiosis?

Answers

The significance of crossing over is the creation of new combinations of genetic material in offspring.

Crossing over occurs during meiosis when non-sister chromatids exchange segments of DNA. As a result, the offspring inherit a unique combination of genetic information from their parents. Crossing over promotes genetic diversity by creating new combinations of alleles that can contribute to the survival of populations under changing environments.

It also helps to explain why siblings may look different from each other, even when they have the same parents. Furthermore, crossing over can help to prevent the accumulation of harmful mutations by shuffling genetic material in a way that allows natural selection to act more effectively.

To learn more about Crossing over, here

https://brainly.com/question/19671756

#SPJ4

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True or False?

Answers

A component with a lower flavor threshold will make a bigger contribution to the character of the beer. True

A component with a lower flavor threshold means that it can be detected at lower concentrations, and therefore, can make a bigger contribution to the overall flavor profile of the beer.

For example, compounds like isoamyl acetate, which gives banana-like flavor, and diacetyl, which gives a buttery flavor, have low flavor thresholds and can be perceived even at low concentrations. Therefore, a small amount of these compounds can have a noticeable impact on the taste and aroma of the beer.

Learn more about lower flavor

https://brainly.com/question/17515899

#SPJ4

What happens after glycolysis but before citric acid cycle?

Answers

I think it’s oxidative phosphorylation when in presence of oxygen.

where are old world monkeys found? group of answer choices africa and northern europe mexico and south america sub saharan africa, southern asia, and northern japan india and southern asia only north america and mexico

Answers

Old-world monkeys are found in sub-Saharan Africa, southern Asia, and northern Japan.

Old-world monkeys have divided nostrils and, unlike the new-world monkeys, do not have a prehensile tail. These monkeys include baboons, mandrills, macaques, colobus, langurs, guenons, and many others. Old world monkeys (Cercopithecoidea) are a family of primates that belong to the order of primates.

They are classified into two different categories: the New World monkeys and the Old World monkeys. Old World monkeys are from Africa and southern Asia, including Japan. They have a wider range than New World monkeys, which are limited to Central and South America.

Old World monkeys differ from New World monkeys in a number of ways. They have longer, more developed noses, and they lack a prehensile tail, which means that they cannot hold onto things with their tail.

Old World monkeys are arboreal and can be found in almost all types of forests, including rainforests and deciduous forests. They can also be found in savannas and grasslands.

Learn more about old-world monkeys here:

brainly.com/question/28892484

#SPJ11

observe your frog heart after it has been removed. did it continue to beat? how? what else did you learn from your frog? anatomy? physiology? did you do any further tests? please elaborate. g

Answers

Yes, the frog heart continued to beat after it had been removed. This is due to the intrinsic excitability of the myocardium, or muscle tissue in the heart. This intrinsic excitability means that the heart can continue to beat without any external input from the nervous system.

From observing the frog heart, we can learn about anatomy and physiology. Anatomy refers to the structure and physical form of the heart. We can see the size and shape of the heart and the blood vessels entering and leaving it. Physiology is the function and processes of the heart. We can observe how the heart beats and pumps blood.

Further tests could include a detailed analysis of the heart rate. This could involve measuring the heart rate over time, looking for any changes in rate, or measuring the heart rate under various conditions. Additionally, one could measure the electrical activity of the heart by using an electrocardiogram. This would involve placing electrodes on the heart and measuring the electrical impulses.

In conclusion, by observing the frog heart we can learn about both anatomy and physiology and also explore other tests to gain a deeper understanding of the heart’s function.

For more such questions on Frog heart.

https://brainly.com/question/11126450#

#SPJ11

Other Questions
The motion of Earth's molten rock shows characteristic patterns which can be analyzed and explained scientifically. Such analysis and explanation is impossible without understanding the principles of which kind of energy? A chemical B electrical C thermal D radiant Read this selection from the story and answer the questions below.El ratn responde No s, pero tengo una cebolla. Puedes usarla?What is the direct object in the first sentence? What is the direct object pronoun in the second sentence? To program a digital turtle to go forward 50 pixels 3 times, what code should be used? A. forward 50 repeated 3 times B. repeat 3 [forward 50] C. 50 pixels x 3 times D. forward 50 [repeat 3] If m angle3 = 29, what is m angle4? Find the surface area of the figure. Round to the nearest hundredth when necessary (2 decimal places). SA = hp + 2B A study found that 2/3 of the students surveyed are in a school sport or club. What must be true about the number of students in a school sport or club? A It is equal to the number of students surveyed. B It is twice as large as the number of students surveyed. C It is less than the number of students surveyed.D It is three times the number of students surveyed. The best known of the Fauves who believed that color should play a role in conveyingmeaning. 1. Explain how Gustave Moreau's The Apparition fits the period style characteristics of Symbolism. Discuss both cultural context and visual characteristics in your response.2. Explain how Robert Henri helped shape the Ashcan School. What did he want to be the subject of Ashcan School art? How was the direction of this new style shaped by Henri's artistic experiences and education?3. Explain how George Bellow's Both Members of this Club fits the period style characteristics of the Ashcan School. Discuss both cultural context and visual characteristics in your response. A solid chloride sample weighing 0.3147 g required 43.75 mL of 0.05273 M AgNO, to reach the Ag,CrO, end point. a. How many moles Cl ion were present in the sample? (Use Eqs. 2 and 3.) b. How many grams Cl- ion were present? (Use Eq. 4.) c. What was the mass percent C ion in the sample? (Use Eq. 5.) moles Cr g Cr % Cr how can private citizens impact a president's role as legislative leader? Aggregate expenditure includes all of the following, except:O Consumption spendingO Net ExportsO Government spendingO Aggregate demand A randomly selected customer is asked if they like hot or iced coffee. Let H be the event that the customer likes hot coffee and let / be the event that the customer likes iced coffee. What is the probability that a randomly selected customer likes hot or iced coffee?0 0.220 0.30O 0.610 0.83 Factor completely. 4 12x + 9x^2 = 1.) According to the video, what does Flaubert consider a "GLOBAL CITIZEN" to be.2.) Flaubert once said, "Art is superior to everything." Explain what this means and how this idea applies to the Realist Literary period.3.) Consider "A Simple Heart" by Flaubert. How do the themes and events from the story fly in the face of traditional values and norms of the early 20th century? What did you think of the story? Is it still relevant today? Why or why not? Use examples, quoted and cited, from the text to support your assertions. Video if needed on YT called: LITERATURE - Gustave FlaubertBook Page: Flaubert & A Simple Heart (1877) p. 651-678 An energy transfer is shown below.What type of energy transfer is shown in this image?electrical to mechanicalchemical to mechanicalchemical to electricalelectrical to chemical while individuals on the autism spectrum have historically been underrepresented in the workforce, some programs mentioned in class have aimed to lever their enhanced abilities at _________________ to provide employment opportunities. For the last several weeks, Carol has been saving the coins from her waitressing tips so that she can buy her grandmother a music box for her birthday. If there are 70% more quarters than dimes in the money Carol has saved, and the combined value of her quarters and dimes is $31.50, how many dimes does she have A parking lot space is in shape of a rectangle. If the space has a length of 23 feet and a width of 12 feet, what is the area of the parking space?A.128ft2B.266ft2C.276ft2D.138ft2 What happened to Napoleon in St. Helena island? How many years passed between when Wilma first got the leg brace and ed temple discovered her talent A: fourB: eightC: tenD: twelve