“[T]he poster was an ideal agent for making war aims the personal mission of every citizen.”
What evidence from the text supports this statement?
a. World War II posters were inexpensive, accessible, and ever-present.
b. World War II posters encouraged women to participate fully in production.
c. World War II posters turned toward idealized images of the comforts and .dconveniences of life far from the factory scene.

Answers

Answer 1

Explanation:

“[T]he poster was an ideal agent for making war aims the personal mission of every citizen.”

What evidence from the text supports this statement?

a. World War II posters were inexpensive, accessible, and ever-present.

b. World War II posters encouraged women to participate fully in production.

c. World War II posters turned toward idealized images of the comforts and .dconveniences of life far from the factory scene.

Answer 2

Answer:

The imagery on World War II posters celebrated the middle-class home, the traditional nuclear family, consumerism, and free enterprise.


Related Questions

What is tone in writing?

A an authors choice
B inverted syntax in poetry
C the authors attitude
D deliberate grammatical errors

Answers

C - the authors attitude

Answer:

c the authors attitude

Explanation:

Good day everyone!

Fad diets are weight-loss programs that enjoy short-term popularity and are sold based on a marketing gimmick that appeals to the public’s desire and fears. How can you tell if a program is a fad diet

Answers

Answer:

Promises a quick fix.

Promotes 'magic' foods or combinations of foods.

Implies that food can change body chemistry.

Excludes or severely restricts food groups or nutrients, such as carbohydrates.

Has rigid rules that focus on weight loss.

(20 POINTS) Please give an example or two of dramatic irony in the book Hatchet. (Include the chapter where it was found too)

Answers

Answer:

1: During his first few days in the forest, Brian repeatedly notices fish jump in the lake. 10-12

2: Brian finally finds the survival kit even though he has learned on his own how to survive. Ch.19

3: Brian unwittingly turns on the Emergency Transmitter which brings the plane to rescue him. also ch.19

4: He finds a rifle which makes him unsettled, because its power and mastery seem to separate him from the wilderness that has become his home and he doesn’t like the feeling. ch.19

Explanation:

These are some examples of dramatic irony in the hatchet.

During his first few days in the forest, Brian repeatedly notices fish jump in the lake. Brian finally finds the survival kit even though he has learned on his own how to survive.

What are Irony?

In its broadest definition, irony (from the Ancient Greek "v" eirnea, "dissimulation, feigned ignorance" , which is a crucial rhetorical device and literary technique, is the juxtaposition of what on the surface appears to be the situation and what is actually the case or to be expected.

There are several different varieties of irony, including situational, dramatic, and linguistic irony. When stating a truth, verbal, dramatic, and situational irony are frequently utilized to emphasize the point.

By purposefully using language that says the opposite of the truth, rejects the contrary of the truth, or dramatically and blatantly understates a factual link, the ironic form of simile, employed in sarcasm, and some kinds of litotes can stress one's meaning.

Therefore, During his first few days in the forest, Brian repeatedly notices fish jump in the lake. Brian finally finds the survival kit even though he has learned on his own how to survive.

To learn more about irony, refer to the link:

https://brainly.com/question/1695719

#SPJ2

what is the first step in summarizing a passage ​

Answers

Answer:

The first step in summarizing a passage is to identify the main points of the text.

Explanation:

Helped by none other than the #QUEEN herself

Once you have an idea for a research topic, what is your next step?
Determine the order of details in your report.
Generate a list of research questions.
Create your opening statement.
Create a list of possible sources.

Answers

Answer:

generate a list of research questions

Explanation:

you need to know specifically what to search/what to answer before you start researching

Once you have an idea for a research topic, Generate a list of research questions.

What is the meaning of research paper?

A research paper is an article in which you describe what you have learned after examining your topic in depth. In the research paper, you include information from sources such as books, articles, interviews, and online sites

What are the types of research paper?

The types of research paper are:

AnalyticalDefinitionInterpretativeSurvey

Hence, the correct answer is Option B.

Learn more about research paper on https://brainly.com/question/968894

#SPJ2

What upsetting news do they get about Mr. Kraler?

Answers

Answer:

Kraler? Miep tells the group that the suppliers were arrested and that they could not get any ration books anymore, so the food would have to be rationed.

Explanation:

Answer:

He says that the thief had caught up to the others

How do you think the daytime and nighttime skies would look if there were no Sun in
our solar system? Describe at least two things that would be different.

Answers


The first thing that would be different without the sun in the daytime sky would be that there would only be blue and clouds there would be no rays or brightness

Second thing is that if there’s no sun a lot of things will not be able to grow because of photosynthesis. we wouldn’t be able to practically use a lot of things because the sun is solar and has solar energy to power stuff we use so we will not be able to use a lot of stuff

Correct the punctuation and capitalization.
please take some berries with you mrs. Barry.

Answers

Answer:

Please take some berries with you, Mrs. Barry.

Answer:

Please take some berries with you, Mrs. Barry.

Explanation:

FREE BRAINLIST! Help answer my question.
-
Write a figurative language sentence for each picture.

Answers

Ugh what kind of figurative language?

Answer:

Can i get brainly?

Explanation:

Which detail from the Newsela article "Dream Jobs: Investigative Reporter" supports the central idea that investigative reporters can bring about real, substantive change in the world?

Answers

Answer:

In some parts of the world, investigative journalists are a constant target for violence.

Explanation:

I WILL MARK BRAINLEST
Explain one way that you could lower the amount of trash that your family produces. Be specific in your example. Explain how it will actually lead to a lower amount of trash.

Answers

Answer: by reusing things. For example we could all reuse the plastic water bottles we drink out of. We could start re-filling them instead of throwing them away and getting a new plastic water bottle.

Explanation:

i dk if this is good but here bestie

Answer: You can start reusing things. Therefore if you reuse less things will go in the trash. So the plastic wont in up in the oceans.  An example would be to wash and reuse plastic containers rather than using plastic baggies and throwing them in the trash.

Explanation:

1. Matthew Henson was an explorer who didn't get credit during his lifetime for his ___________________. 2. Over and over, Henson traveled through the icy ___________________ of the Arctic. accomplishments, determined, expedition, frigid, wilderness

Answers

Answer:

The first blank is accomplishments, and the other one is wilderness.

Explanation:

Hope it helped!! :)

Vera Claythorne is also on the train. She is described as young and attractive. She has been
invited to Indian Island by Una Nancy Owen, apparently to take a job as a teacher/caregiver.
Why does she believe that she is lucky to obtain such a position?

Answers

caca de bebé

caca de bebé

caca de bebé

caca de bebé

caca de bebé

caca de bebé

caca de bebé

caca de bebé

DO NOT SEND ME LINKS OR PDFS IF YOU GIVE ME A COMPLETE PARAGRAPH I WILL GIVE YOU 100 POINTS AND BRAINLIEST

Describe the potential traits and their probabilities for an offspring of two heterozygous parents with a trait for brown hair, B, or blonde hair, b.

Answers

Answer: Some potential traits of an offspring of two heterozygous parents with traits for brown hair, B, and blonde hair, b, include brown and blond. Since both parents are heterozygous, the genetic traits would be Bb and Bb. Also since the B (brown) is the dominant trait, the likelihood of a brown-haired offspring is three-fourths more likely than a blonde offspring. All the genetic possibilities are BB (brown), Bb (brown because of the dominant trait), Bb (brown), and bb (blonde).

Reread lines 1-10. What does the author reveal about himself

Answers

Answer:

wheres the text

Explanation:

In the penultimate (next to last) paragraph, the
author claims that an omniscient point of view is
sometimes referred to as "playing God." Based on
information in the passage, it can be inferred that
this is because the

Answers

Answer:c

Explanation: it looks good

Why does the author include the following sentence in the passage?
“A bird’s wing is a wonderful flying-machine, which men have been trying to
imitate these many years.” (paragraph 2)
A to describe how birds are different from humans
B to explain how strong birds’ wing feathers can be
C to introduce how different birds fly in different ways
D to illustrate how exciting the study of birds’ wings can be

Answers

Answer:

B. to explain how strong birds' wing feathers can be

Explanation:

I WILL GIVE BRAINLIST
Match each excerpt to the correct type of poetry.

Answers

I went over them all a few times. I would say that 1-2 would be lyric and 3-4 Narrative. Based on the wording it can be tricky because lyric and narrative can sometimes cross paths. I hope this helps!

Answer: That is the correct answer

Explanation:

The reading passage name is VILLAGE SCHOOLS AND TRAVELING SOLDIERS on commonlit.
PART A: Which TWO of the following best identify the central ideas of this text?
A. Traditional Chinese education requires constant study.
B. Education in China is superior to education elsewhere.
C. Without traditional Chinese education, children will become arrogant.
D. The goal of education is to master many skills, both practical and intellectual.
E. Education is only for some—others become “wild” laborers.
F. With a good education, a “wild” child can become more useful to his family.

3. PART B: Which TWO phrases from the text best support the answers to Part A?
A. “The object of Chinese education is to pump up the wisdom of the ancients into the minds of the moderns” (Paragraph 1)
B. “According to Chinese theory, or practice, a school which should only be in session for six months of the year, would be a gross absurdity” (Paragraph 1)
C. “The same saying is current in regard to the second degree, and with not less reason” (Paragraph 2)
D. “He may be incomparably more useful to his family than the other, but so far as education goes he is only a ‘wild’ lad” (Paragraph 3)
E. “He has very little opportunity to learn anything of practical affairs, and still less disposition” (Paragraph 5)
F. “So far as they go these are valuable acquirements, although they can scarcely be termed an education” (Paragraph 6)

Answers

D hope that helps have a good one

PLS HELP

which line from the passage best supports the inference that the author believes a female is better suited for recognizing love​

Answers

Answer:

And the girl shoots with her eye

Explanation:

I took the test and got it right

Based on the case studies, what are some of the things these former students had to sacrifice in order to pay back their student loans?

Answers

Answer:

Furniture, Electronics, Cars, Houses, even jewlery.

Explanation:

There is no text, so these are the most common items.

the last day of slavery Event 1​

Answers

Answer: slavery is no good

i hate slavery

Explanation: thank for the points

june 18 1865

Explanation:

i looked on the web


Inference
Excerpt from Les Misérables by Victor Hugo
What is the author trying
It is important to mention here the various rumors to say in the beginning

A family ties are more
important than actions

B a person's past shapes their
future

C talk can be as important as
actions

Which is true about Myriela
A He is noble,

B He is charitable.

C He is strong

D He is powerful.

Short Answer: What other
questions would you ask to learn more about Myriel

Answers

Answer:

.

Explanation:

Reread page 299. At this point in the play, how would the people of the Annex describe Anne? Support your answer with details from the text.

Answers

Answer:

The people of the annex described Anne as a quiet, smart, and intelligent girl with a great detail and a feel for emotions and observations. They considered her to be charming, self-aware, sensitive, often impatient,  sometimes a know-it-all, open, determined, easily hurt, spirited, hopeful, fun-loving, desperate, with all  the longings, expectations, and attitudes that adolescence brings.

Explanation:

Anne spent 761  days in the annex. During these days, Anne portrayed herself in a very versatile mode which is evident from the various anecdotal remembrances by various members of the annex.

PLEASE HELP! DUE TOMORROW (MAJOR GRADE) FOR 50 POINTS!!!

Prompt Options for Tier 3

Utilizing the twelve words from your Tier 2 vocabulary, write a well thought out, concise, short fiction story utilizing one of the following prompts. Please highlight the vocabulary words as you use them to help with grading purposes. Your short story should include well developed characters, dialogue, and an identified theme. Word count should at least be 500 words and no more than 800 words.

This is worth 50% of your first major grade.

Students will submit their final papers via TURNITIN.com

This is an IN CLASS essay. Online students must be on the zoom with cameras on.


Write a fiction story where the sales manager of a local store has had enough. Make sure to use ALL vocabulary words in your story.


Write a fiction story where a hairdresser received a shocking confession from a customer. Make sure to use ALL vocabulary words in your story.


Write a fiction story where a famous FICTIONAL character has been written into the wrong story. Make sure to use ALL vocabulary words in your story.


Write a fiction story where the main character is startled awake by . . . . Make sure to use ALL vocabulary words in your story.


Write a fiction story where a priest is hearing a unique confession. Make sure to use ALL vocabulary words in your story.


Write a fiction story where ten people are in a power outage. Make sure to use ALL vocabulary words in your story.


Write a fiction story where the reader is privy to a Fan Fiction Writer's Group meeting. Make sure to use ALL vocabulary words.

Just choose from one and write any fictional story that matches with the one you picked, and use all 12 of the vocabulary words. PLEASE AND THANK YOU

Answers

the story was too long so I put it in a pdf gogle document :) hope it is good...it is a bit long sorry!!

Answer:

ight

Explanation:

What is a claim? Statement the writer is trying to prove is true. What the evidence and explanation show Supporting arguments as to why the argument is true. Reasons why the counter argument isn't strong.​

Answers

Answer:

Statement the writer is trying to prove is true.

Explanation:

The author writes that people are
at
18 than at 16 or 17. He supports this
second claim with two pieces of
evidence: Most 16- and 17-year-olds
don't
on their own. Instead, it is
that help
them develop this ability.

Answers

Answer: Wiser and more mature

Explanation: This is because people who are older have more responsibility and know right from wrong.

Hope this helped!         :D

Answer:

Wiser and more mature

Explanation:

Hey if you could help me out with this that would be great!​

Answers

Answer:

for 2 you can use petit to describe the brother

Explanation:

for 3 you can use massive or huge to describe the cows and use towering for the mountain.

What is the best way to organize a conclusion?

by summarizing the thesis, the topic sentences, and the details, and ending with final thoughts
by restating the thesis using different words, summarizing the main ideas, and ending with final thoughts
by stating a new thesis, supporting it with details from the essay, and drawing a conclusion
by repeating the thesis using the same words, listing all of the main ideas, and drawing a conclusion

Answers

Answer:

By restating the thesis using different words, remember not to add extra ideas to it and just stick to summarazing the main ideas and ending with whatever extra thoughts you need to conclude the essay.

Explanation:

A conclusion is the ending paragraph where readers are finishing up reading and gathering ideas from what they read, you need to emphasize the thesis, which is your position about the prompt, by restating it. Remember to use different words when restating your thesis in order to really show what you are trying to say. Finish up with some concluding statements that support the main idea of the whole paper and you're good to go!! I hope this helps!

Answer:

B, restating the thesis using different words.

Edg 2023

"Haven't you heard? I'm as cold as the tip of the iceberg that tipped the Titanic." - "KOD" by J. Cole A. Simile B. Metaphor C. Oxymoron ​

Answers

Answer:

A.simlie

Explanation:

Other Questions
When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3 8) Lisa and Jasmine are selling cheesecakes for a school fundraiser. Customers can buy pecancheesecakes and apple cheesecakes. Lisa sold 3 pecan cheesecakes and 7 apple cheesecakes for atotal of $130. Jasmine sold 12 pecan cheesecakes and 14 apple cheesecakes for a total of $338.Find the cost each of one pecan cheesecake and one apple cheesecake.