The Centers for Disease Control (CDC) collect vast amounts of data. For this activity, we want you to use their Natality Information database to test various hypotheses about birth. For the following five issues, please create a hypothesis and then use the database to collect information about the issue. Once you the data is displayed, record it and indicate whether your hypothesis was supported by data.

The database functions in this manner:

Upon going to this website, you will need to comply with the CDC requirements for using the database. Because this is a school activity, you will be fine. Click I Agree.
The top section (Section 1) of the query engine will allow you to determine how your data sets will be displayed. You will want to Group Results by State for the queries you will perform.
Be sure to select the correct measure for your question/hypothesis. Select only one measure for each query.
Section 2 allows to select individual states or multiple states for comparison. If you have selected states in Section 1, you can run multiple data sets here and see them displayed by state. If you did not, the only way to see individual state data is to run the query one state at a time.
The remaining sections include the conditions you can use for comparison. You will need to find the appropriate section for the condition you are testing for. Once you have found it, go ahead and run your query by clicking Send.
Let me talk you through the process. Seriously, watch this video explanation of what you're doing.

Here's an example. Which state, Utah or New York, has the highest average age for mothers giving birth?

Hypothesis: New York has the highest average age for mothers giving birth.
Data (based on the following settings)
Section 1: Group Results by State; Measure: Average Age of Mother (years)
Section 2: Select Utah and New York

Run the report (click Send) and the data says that New York's average age of mothers is 30.26 and Utah's is 28.59
Supported hypothesis: Yes
Data Questions
Now run the data queries for the following questions and record your hypothesis, data, and whether your hypothesis was supported.

Which state, Wyoming or Texas, has the highest fertility rate?
In which state, Hawaii or Illinois, is the mother's education the highest?
Pick two states and determine which state has the most births in May. (For this question and the next two, don't forget to make a hypothesis about which one you think it is.)
Pick two states and determine which state has the most twins.
Pick three states and determine which state has the most babies with Down syndrome.

Answers

Answer 1

Answer:

Texas saw 382,050 births in 2017 the total fertility rate was 1,884 for whites, 2107. for black 2263

hawala............ higher education rank #21


Related Questions

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Help me please! Do 1,2,3 by filling in the blank!!!!

and no website

Answers

The answer is Glucose

Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.

Answers

Answer:

The phenotypic ratio is 9:3:3:1

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

R is the dominant alleler is the recessive allele

Let us also assume that axial is the dominant trait, so

A is the dominant allelea is the recessive allele    

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)

Answers

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

Can someone name and explain each lymph organ?

Answers

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

Suggest reasons for the color patterns of the frog and its lack of color on the ventral surface.

Answers

Answer:

To save itself.

Explanation:

The color patterns of the frog and its lack of color on the ventral surface allows the frog to protect itself from their predators because the frog changes its colour and the predators are unable to see them. The color patterns of frogs and their lack of color on the ventral surface allow frogs to escape from their predators. If the frog does not change its colour, the predators will see them and the frog will be catch by its predators and feed on them so this is the reason that frog changes colour or the presence of colour patterns.

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

For predation to occur, there must be a predator species and a prey species. Define predator and prey and give an example of each.

Answers

A predator is a carnivore animal that preys on prey animal. Prey animals are usually small herbivores or just smaller animals. Examples, lion and gazelle, bear and salmon, wolf and deer.

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

Why does a mountain create a rain shadow on the other side of a mountain?

Answers

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

What were the old women doing?
In Percy jackosn

Answers

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Other Questions
The bedroom and office in the diagrams below are similar rectangles. The walls on the left sides in the diagram are proportional, and the walls on the top sides in the diagram are proportional. How long is the missing wall of the office (shown in red below)? What is the volume of a rectangular prism that has a length of 8 square inches, a width of 6 3/4 square inches, and a height of 5 1/4 square inches? c)(-6, 3)d) (-3,0)cion...What will be the new position of the given point (9,-4) after reflection acrossthe line x = 1?racticea)(7,4)b) (7,-4)c)(-7,-4)d) (-7,4)Tr...azeITransform...MazeNo Key Which of these situations can be represented by the opposite of -25 select all that apply An expression is shown below:f(x) = 2x^2 x 10 Part A: What are the x-intercepts of the graph of f(x)? Show your work. (2 points)Part B: Is the vertex of the graph of f(x) going to be a maximum or minimum? What are the coordinates of the vertex? Justify your answers and show your work. (3 points)Part C: What are the steps you would use to graph f(x)? Justify that you can use the answers obtained in Part A and Part B to draw the graph. (5 points) what does melody think of jill in out of my mind? Can someone please help me on this please I beg you no links and zoom in if you need Use the function below to find F(1).F(t) = 21/2^3tPlease Help HELP ASAPPP Pls-In a state, one town is 250 feet above sea level and another town is 30 feet below sea level. what is the difference in elevations?(NO LINKS OR ILL REPORT) Why do the chromosomes line up in the middle of the cell -5x - 2y = 18 in slope intercept form. What is the role of the green substance chlorophyll in photosynthesis? (2 points)Chlorophyll collects water from the ground.Chlorophyll captures energy from the sun.Chlorophyll captures carbon dioxide from the air.Chlorophyll moves water up the stem to the leaves. What is the correct meaning of the word dictatorial? The person _________ the golf hole shoots or putts first.third fromfarthest away fromsecond fromclosest to Find angle R as shown by the pictureI need an explanationWill name brainliest please help me with theseQuincy is having a sale at his store. He is selling a table for $450. If the sales tax is 8.5%, then how much will a customer need to pay in taxes if they buy the table? *answer choices$14.50$22.75$38.25$45.50if you deposit $2500 into a savings account that earns 2% simple interest, how much will be your account in all after 4 years? answer choices $200$250$2700$3750You have saved up enough money to buy some awesome jeans. Store A is offering the jeans for 15% off. Store B is offering the jeans for $10 off. If the jeans cost $45 before the discounts, which store is offering the jeans at a lower cost? *answer choicesStore AStore BThey both end up costing the same amount The period following the Tokugawa shogunate, during which Japan adopted customs of western countries is called what? 2. The Chinese Exclusion Act affectedO only unskilled laborersO only skilled laborersO all professionalsO all laborersD.) all laborers If 4.00 moles of gasoline are burned, what volume of oxygen is needed if the pressure is 0.953 atm, and the temperature is 35.0C? (No linksssssssssssss)Pls help me~English ~Ill mark brainliest if correct