Solve the following system by substitution. CHECK the solution.

3y = 2x + 12
y + 3x = -7

Answers

Answer 1

We can use substitution to solve this system of equations. We can solve the first equation for y and get:

y = (2x + 12)/3

We can then substitute this expression for y into the second equation:

(2x + 12)/3 + 3x = -7

Multiplying both sides of this equation by 3 to eliminate the denominator, we get:

2x + 12 + 9x = -21

Simplifying this equation gives:

11x = -33

Dividing both sides by 11, we get:

x = -3

We can then substitute this value of x back into either of the two original equations to find y. Using the first equation, we get:

3y = 2(-3) + 12

3y = 6

y = 2

Therefore, the solution to the system of equations is x = -3 and y = 2.

To check the solution, we substitute these values back into both equations:

3y = 2x + 12 3(2) = 2(-3) + 12 6 = 6

This equation is true, so the solution (x = -3, y = 2) checks out.


Related Questions


PLEASE HELP ASAP PLEASE!!

Answers

Answer: a/ c/ d and e

Step-by-step explanation:

Pat listed all the numbers that have 15 as a multiple. What’s the numbers in Pats list

Answers

Answer:

15, 30, 45, 60, 75, 90, 105, 120, 135, 150, 165, 180, 195, 210, 225, 240, 255, 270, 285, 300, 315, 330, 345, 360, 375, 390, 405, 420, 435, 450, 465, 480, 495, 510, 525, 540, 555, 570, 585, 600, 615, 630, 645, 660, 675, 690, 705, 720, 735...

Step-by-step explanation:

Triangle WXY with W(0, 1), X(-4, 4), Y(0, 2)
in y-axis
(x, y) ⇒ (x − 1, y — 4)
a) Reflection
b) Translation

Answers

(a)The transformed vertices would be:

W' = (1, -3)

X' = (-3, 0)

Y' = (1, -2)

(b)The transformed vertices would be:

W' = (-0, 1)

X' = (4, 4)

Y' = (-0, 2)

What is reflection ?

a) Reflection: To reflect the triangle across the y-axis, we simply need to negate the x-coordinates of each vertex.

The transformed vertices would be:

W' = (-0, 1)

X' = (4, 4)

Y' = (-0, 2)

The reflected triangle would be W'X'Y'.

b) Translation: To translate the triangle by the vector (1, -4), we add (1, -4) to the coordinates of each vertex.

The transformed vertices would be:

W' = (1, -3)

X' = (-3, 0)

Y' = (1, -2)

The translated triangle would be W'X'Y'.

know more about translation visit :

https://brainly.com/question/21117201

#SPJ1

A house is advertised for sale. If the sale price
is $140,000. Calculate the mortgage of the deposit is 25% of the cash price

Answers

Answer: $105,000

Step-by-step explanation:

$140,000-25%deposit =$105,000

w/ solution please thanks

Answers

Answer:

x=-5, y=-2

Step-by-step explanation:

2x+4y=-18                (1)

5x-10y=-5                 (2)

apply 5×(1)+2×(2)

10x+20y=-90      (3)

10x-20y=-10   (4)

by adding (3) and (4)

20x=-100

x=-5

put the value of x in  (1)

we get 2×(-5)+4y=-18

⇒y=-2

After solving the given equations, the value of x and y are -5 and -2 respectively.

What are equations?

A mathematical equation is a formula that uses the equals sign to represent the equality of two expressions.

A mathematical statement that has an "equal to" symbol between two expressions with equal values is called an equation.

As in 3x + 5 Equals 15, for instance.

Equations come in a variety of forms, including linear, quadratic, cubic, and others.

So, we have the equations:

2x+4y=-18                (1)

5x-10y=-5                 (2)

Apply as follows: 5×(1)+2×(2)

10x+20y=-90      (3)

10x-20y=-10   (4)

After adding (3) and (4):

20x=-100

x=-5

Insert the value of x in  (1) as follows:

We obtain: 2×(-5)+4y=-18

⇒y=-2

Therefore, after solving the given equations, the value of x and y are -5 and -2 respectively.

Know more about equations here:

https://brainly.com/question/2972832

#SPJ1

Malinda wants to rent a compact car for eight days. Ace Rental rents these cars for $48 per day or $312 per week. Compute the cost of each plan for her. Which plan is more economical?

Answers

a) The total cost for renting a compact car for eight days is as follows for each plan:

Daily rental = $384Weekly rental = $360.

b) It is more economical to take the weekly rental plan than the daily rental plan.

How is the total cost determined?

Each plan's total rental cost is determined using multiplication or addition.

For instance, the total cost for the daily plan is a product of the daily rental cost and the number of days the car is rented.

The total cost for the weekly plan is an addition operation since the car is rented for 7 days (weekly cost) and 1 day (daily cost).

                               Day                  Week

Rental cost per      $48                   $312

1 week = 7 days

Total rental cost for

8 days                $384 ($48 x 8)     $360 ($312 + $48)

Learn more about mathematical operations at https://brainly.com/question/4721701

#SPJ1

PLSSS HELPPP QUICK
What is the product of the monomial x and the
trinomial 2x² -5x+1?

Answers

To find the product of a monomial and a trinomial, we need to multiply each term in the trinomial by the monomial and then add the resulting terms.

So, the product of the monomial x and the trinomial 2x² - 5x + 1 is:

x(2x² - 5x + 1) = 2x³ - 5x² + x

Therefore, the product of the monomial x and the trinomial 2x² - 5x + 1 is 2x³ - 5x² + x.

Find the value of z such that 0.5762
0.5762
of the area lies between −z

z
and z. Round your answer to two decimal places.

Answers

Answer:

  z = 0.80

Step-by-step explanation:

You want the value of z such that p(-z < X < z) = 0.5762 for a normal distribution.

Tails

The area outside the region of interest will be split evenly between the two tails. That is, the lower tail will hold (1 -0.5762)/2 = 0.2119 of the area of the distribution. The required value of z will be the magnitude of the Inverse CDF function for this value.

Inverse CDF

The attached calculator shows the required value of z is about 0.80.

Solving Systems of Quadratic Equations
5. Solve this nonlinear system of equations. Show your work.
a. Use substitution to combine equations. Rewrite so that one side is equal to 0. (1 point)
b. Factor your equation from Part a. (1 point)
c. Identify the x-values of the solutions. (1 point)
d. Identify the solutions to the system. (1 point)

Answers

Using equations,

A: y=-x²+6x-5

y=3

3=-x²+6x-5

y=0

B: (x-2) (x-4) =0

C: x-2=0 OR x-4=0

D: x=2 OR x=4

What are equations?

An equation is a mathematical statement that contains the symbol "equal to" between two expressions with identical values. as in 3x + 5 = 15, for example. There are many different types of equations, including linear, quadratic, cubic, etc.

Y=-x²+6x-5

Y=3

Using substitution:

3 = - x²+6x- 5

x²- 6x+8 = 0

Now factor your equation:

x²- 6x+8 = 0

⇒ x² -2x - 4x + 8 = 0

⇒ x (x-2) -4(x-2) = 0

⇒ (x- 2) (x-4) =0

Identify the x-values of the solutions:

x-2=0 or x-4 =0

x=2 or x=4

Identify the solution to the system:

x=2       y=3 and

x=4       y=3

To know more about equations, visit:

https://brainly.com/question/29657983

#SPJ1

solve using substitution method y = -3x 4x+y = 2

Answers

[tex]\Large\textbf{Please give complete questions}[/tex]

describe the key features que f the graph of the quadratic function f(x)=x^2-8-20

Answers

The graph is a parabola, with a vertex at (4,-4), an axis of symmetry at x = 4, x-intercepts at x = 10 and x = -2, and a y-intercept at (0,-20).

Define quadratic function

A quadratic function is a type of polynomial function of degree 2. It can be defined as a function in which the highest power of the independent variable x is 2.

The quadratic function f(x) = x² - 8x - 20 has a graph that is a parabola with a vertical axis of symmetry.

Vertex: The vertex of the parabola can be found using the formula x = -b/2a, where a and b are the coefficients of x² and x respectively.

In this case, a = 1 and b = -8, so the x-coordinate of the vertex is x = -(-8)/(2×1) = 4.

To find the y-coordinate of the vertex, substitute x = 4 into the equation: f(4) = 4² - 8(4) - 20 = -4. Therefore, the vertex is located at (4,-4).

Axis of symmetry: The axis of symmetry of the parabola is a vertical line passing through the vertex.

In this case, the axis of symmetry is the line x = 4.

Intercepts: To find the x-intercepts set y = 0 and solve for x: x² - 8x - 20 =0.

this quadratic equation can be factored as (x - 10)(x + 2) = 0

so the x-intercepts are x = 10 and x = -2.

To find the y-intercept, set x = 0 and evaluate f(0) = 0² - 8(0) - 20 = -20. Therefore, the y-intercept is (0,-20).

Image is attached below.

The graph is a upward-facing parabola, with a vertex at (4,-4), an axis of symmetry at x = 4, x-intercepts at x = 10 and x = -2, and a y-intercept at (0,-20).

To know more about vertex, visit:

https://brainly.com/question/30940247

#SPJ1

Without using a calculator, fill in the blanks with two consecutive integers to complete the following inequality.
__ __

Answers

Answer:

[tex]13 < \sqrt{181} < 14[/tex].

Step-by-step explanation:

We have been given an inequality ___[tex]< \sqrt{181} <[/tex]___. We are asked to fill in the blank with two consecutive integers to complete the given inequality.

We know that square root of 181 is not an integer. We can see that 181 is greater than square root 169 and and square root of 196.

[tex]\sqrt{169} < \sqrt{181} < \sqrt{196}[/tex]

We know that [tex]\sqrt{169}=13[/tex] and [tex]\sqrt{196}=14[/tex].

Therefore, our required inequality would be [tex]13 < \sqrt{181} < 14[/tex]

The graph of a proportional relationship contains the point (-12, 3).
What is the corresponding equation?

(A) y = 1/4x
(B) y = - 1/4x
(C) y = - 4/1x
(D) y = 4/1x
____
The variables x and y have a proportional relationship, and y=3 when x=4
Which equation represents this relationship?

(A) y = −12x
(B) y = 4/3x
(C) y = 7x
(D) y = 3/4x
____
correct answers gets brainliest

Answers

For number 1 it’s B y= -1/4x
& Number two
A ( Y=-12x)

Rewrite the following in scientific notation and calculate the answer in scientific notation. If​ necessary, convert your answer to scientific notation. 2,520,000/14,000

Answers

The given expression can be written in scientific notation as 1.8 x 10² To obtain this, we first divide 2,520,000 by 14,000 to get 180. Then, we express this as 1.8 x 10² by moving the decimal point two places to the left and adding an exponent of 2.

What is scientific notation?

For expressing very big or very small numbers in scientific notation, the number is written as the product of a number between 1 and 10 and a power of 10

How do you convert a number to scientific notation?

To convert a number to scientific notation, first express it in the form a x 10^b, where a is a number between 1 and 10, and b is an integer.

Then, move the decimal point in a to obtain a number between 1 and 10, and add an exponent to 10 that corresponds to the number of places you moved the decimal point.

To know more about Notation, visit:

https://brainly.com/question/29531272

#SPJ1

Find the absolute extrema of the function on the closed interval.
y = 3 cos x, [0, 2π]

Answers

The absolute extrema for the given function occurred at the critical points for Interval  [0, 2π] is 3.

Explain about the absolute extrema of function?

The point wherein the minimum or maximum value of the function is reached is known as the absolute extremum (also global extremum) of the function in the given interval.

The absolute extremum, or point equivalent to the highest or least value in the entire function, is frequently the interval specified, which is the domain of the function.

The given function :

y = 3 cos x,

Differentiate the function with respect to 'x'.

y' = -3 sin x

Find the critical point , by y = 0

-3 sin x = 0  

x = sin ⁻¹ (0)

Interval  [0, 2π]

So, critical points are: x = 0,π, 2π

Now, evaluate function by putting the critical points;

y(0) = 3 cos 0 = 3

y(π) = 3 cos π = 0

y(2π) = 3 cos 2π = 3

Thus, absolute extrema for the given function occurred at the critical points 0 and 2π that is 3.

Know more about the absolute extrema of function

https://brainly.com/question/2272467

#SPJ1

A bag holds 13 marbles. 6 are blue, 2 are green, and 5 are red.

Match the events on the left with probabilities on the right.

Answers

The probabilities of the events and their values are shown below

Matching the probabilities of the events

The total number of marbles in the bag is 13, with 6 blue, 2 green, and 5 red.

P(Blue or Green) represents the probability of selecting a blue or green marble on the first pick.

This is calculated as follows:

P(Blue or Green) = P(Blue) + P(Green)

= 6/13 + 2/13

= 61.5%

P(Blue and Green) represents the probability of selecting a blue marble and a green marble on two consecutive picks, with replacement.

Therefore:

P(Blue and Green) = P(Blue) * P(Green)

= (6/13) * (2/13)

= 7.1%

P(Blue and Green) represents the probability of selecting a blue marble and a green marble on two consecutive picks, without replacement.

Therefore:

P(Blue and Green) = P(Blue) * P(Green)

= (6/13) * (2/12)

= 7.7%

P(Blue) represents the probability of selecting a blue marble on the first pick.

This is simply the proportion of blue marbles in the bag:

P(Blue) = 46.2%

Read more about probability at

https://brainly.com/question/251701

#SPJ1

The three-dimensional figure below is a cylinder with a hole in the shape of a rectangular prism going through the center of it. The radius is 10 yards. Find the volume of the solid in cubic yards, rounded to the nearest ten.

Answers

The volume of the solid with a hole in the shape of a rectangular prism passing through the center of a cylinder with a radius of 10 yards is approximately 1410 cubic yards, rounded to the nearest ten.

The cylinder with the hole can be viewed as the difference of two solids: the cylinder and the rectangular prism. The volume of the cylinder is given by the formula V_cyl = π[tex]r^2h[/tex], where r is the radius and h is the height.

The height of the cylinder is equal to the height of the rectangular prism that passes through its center. The height of the rectangular prism is given as 12 yards, which is also the diameter of the cylinder. Therefore, the height of the cylinder is h = 12/2 = 6 yards.

The volume of the cylinder is therefore V_cyl = π[tex](10)^2(6)[/tex] = 600π cubic yards.

The rectangular prism has a length of 20 yards, a width of 10 yards, and a height of 12 yards. Therefore, its volume is V_prism = 20 × 10 × 12 = 2400 cubic yards.

The volume of the solid with the hole is then:

V = V_cyl - V_prism = 600π - 2400 = 600(π - 4) ≈ 1412.2 cubic yards.

Therefore, the volume of the solid is approximately 1410 cubic yards.

To learn more about volume please click on below link        

https://brainly.com/question/12877039

#SPJ1

I js need help with this question

Answers

Answer: D. y=-x+7

Step-by-step explanation: For example,

(-1,8)

x= -1

y=8

-(-1) = 1

1 + 7 = 8

Dario walks from his house to a comic book store along the route shown. Distances in the coordinate plane are in units of miles. How many miles does Dario walk to reach the comic book store

Answers

The distance walked by Dario from to reach comic book store is 1.4 miles.

What is distance?

Displacement and distance are two terms that, while they appear to imply the same thing, have quite different definitions and meanings. Displacement is the measurement of "how much space an item has covered while it has been in motion," whereas distance is the indication of "how much ground an object has covered during its motion." Let's examine the distinction between displacement and distance in this essay.

For the given route we have:

House to jewelry store:

0.2 - (-0.5) = 0.2 + 0.5 = 0.7 miles.

Jewelry store to bank:

0.6 - 0.2 = 0.4 miles.

Bank to comic book store:

-0.5 -(-0.8) = -0.5 + 0.8 = 0.3 miles.

House to comic book store:

0.7 + 0.4 + 0.3 = 1.4 miles.

Hence, the distance walked by Dario from to reach comic book store is 1.4 miles.

Learn more about distance here:

https://brainly.com/question/15172156

#SPJ1

The complete question is:

i need the answers please

Answers

Answer:

(7) AB is a tangent , (8) AB is not a tangent

Step-by-step explanation:

the angle between a tangent and the radius is 90°

if AB is a tangent then Δ ABC is right with hypotenuse AC

using Pythagoras' identity

the square on the hypotenuse of a right triangle is equal to the sum of the squares on the other 2 sides.

if AC² = AB² + BC² , then AB is a tangent to the circle

(7)

AC² = 34² = 1156

AB² + BC² = 30² + 16² = 900 + 256 = 1156

since AC² = AB² + BC² , then AB is a tangent to the circle

(8)

AC² = 28² = 784

AB² + BC² = 21² + 20² = 441 + 400 = 841

since AC² ≠ AB² + BC² , then AB is not a tangent to the circle

Determine f(3) for f(x)

A. 9
B. 19
C. 22
D. 27

Answers

the answer is B. 19
5 times 3 plus 4 is 19
19 is greater than or equal to 3

PLSSSSSSSSSSSSSSSSS HURRRYYYYYYYYYYYYYYYYYYYYYYY
A triangle with an area of 360 square meters was created from a triangle with an area of 2.5 square meters using a scale factor. What is the scale factor?

900:1
72:1
30:1
12:1

Answers

Answer:

Step-by-step explanation: Multiply all numbers and add all then divided by the lowest

Let x be the scale factor.

Then, the ratio of the areas of the two triangles is x².

We are given that the larger triangle has an area of 360 square meters and the smaller triangle has an area of 2.5 square meters. So we can set up the equation:

x²(2.5) = 360

Solving for x, we get:

x = sqrt(360/2.5)

x = sqrt(144)

x = 12

Therefore, the scale factor is 12:1. Answer: 12:1.

PLEASE HELP LATE HOMEWORK

Answers

The number of students who have both a cell phone and a tablet is 13. This corresponds to the intersection of the "Has Cell Phone" and "Has Tablet" sets.

What is meant by intersection?

In mathematics, the intersection of two sets A and B is a new set that contains all the elements that are common to both sets. In symbols, the intersection of A and B is denoted by A ∩ B, and it is defined as:

A ∩ B = {x : x ∈ A and x ∈ B}

Let A represent the set of students who have a cell phone, and B represent the set of students who have a tablet. The intersection of A and B, denoted by A ∩ B, represents the set of students who have both a cell phone and a tablet. Therefore, we want to find the cardinality (or size) of the set A ∩ B.

From the frequency table, we know that the total number of seventh graders surveyed is 100. We also know that there are 32 students who have a cell phone (i.e., |A| = 32) and 70 students who have a tablet (i.e., |B| = 70). We are given that 19 students who have a cell phone do not have a tablet, which means that there are 32 - 19 = 13 students who have both a cell phone and a tablet (i.e., |A ∩ B| = 13).

Therefore, the number of students who have both a cell phone and a tablet is 13. This corresponds to the intersection of the "Has Cell Phone" and "Has Tablet" sets.

To learn more about intersection visit:

https://brainly.com/question/29185601

#SPJ1

HELP ME PLS I LITERATELY CANT

Answers

To write a proportional equation for Jonathan's piano practice time, we need to use the given information to create a ratio, which can be expressed as a proportion.

Let's start by finding out how many minutes Jonathan practices per day. Since there are 14 days in 2 weeks, we can divide the total practice time by 14 to get the average daily practice time:

658 minutes ÷ 14 days = 47 minutes per day

Now we can write a proportional equation in terms of d, the number of days Jonathan practices:

t = 47d

This equation tells us that Jonathan's total practice time (t) is proportional to the number of days (d) he practices, with a constant rate of 47 minutes per day. As he practices more days, his total practice time will increase in a linear fashion.

Helena sketches a circular backyard skating pond that fits into a square section of her yard. In her sketch, what is the area of the shaded region?

Answers

Answer:

The area of the shaded region equals 21.43 sq. units.

Step-by-step explanation:

Why do we use area?

When calculating how much material is needed to cover a wooden table, how many tiles are needed to tile the floor, how much space is needed for a parking lot, how much paint is needed for the walls, etc., we employ the notion of area.

Given, A circle is circumscribed in the square,

Area of shaded region = area of square - area of circle

Area of square = Side²

= 10 × 10 = 100 sq. units,

Area of circle = Πr²

Radius = Diameter / 2

radius = 10 / 2 = 5 unitsArea of circle = Πr²

Radius = Diameter / 2

radius = 10 / 2 = 5 units

Area of circle = 22/7 × 5 × 5

= 78.57 sq. units

Area of shaded region = 100 - 78.57,

Area of shaded region = 21.43 sq. units

your mom got 20 cupcakes in you got 1 plate how the 1 and 20

Answers

Answer:

Step-by-step explanation:

explain you question more i cant understand if i could i would help

100 pts answer fast and brainliest

Answers

Answer:

1 c

2 d

3 a

4 b

5 e

Step-by-step explanation:

scale factor > 1 => expansion

scale factor < 1 => contraction

scale factor = 1 => no change

scale factor is (-) => opposite site

what is the length of tr?

Answers

Answer:

12

Step-by-step explanation:

In a survey by the Pew Research Center, adult members of the Church of Jesus Christ of Latter-day Saints in the U.S. were asked how important religion is in their life. 558 adults said religion is “very important” in their lives, 79 adults said religion is “somewhat important” in their lives, 20 adults said religion is “not too important” in their lives, and 7 adults said religion is “not at all important” in their lives. Which of the following columns (A, B, C, D, or E) correctly shows the responses to this question as a probability model? (A) (B) (C) (D) (E) Very important 63.5% 84% 84% 12% 77% Somewhat important 22.5% 12% 14% 84% 21% Not too important 2% 3% 5% 1% 5% Not at all important 1% 1% 3% 3% 3%

Answers

The correct column is (A), which correctly represents the responses as probability.

Define probability

Probability is a measure of the likelihood or chance that a particular event will occur. It is usually expressed as a number between 0 and 1, with 0 indicating that an event is impossible and 1 indicating that an event is certain.

The sum of all the responses is 558 + 79 + 20 + 7 = 664.

To represent the responses as a probability model, we need to divide each response by the total number of respondents, 664.  

The correct column is (A), which correctly represents the responses as probabilities:

(A)Very important 558/664 = 0.841

Somewhat important 79/664 = 0.119

Not too important 20/664 = 0.030

Not at all important 7/664 = 0.011

To know more about event, visit

https://brainly.com/question/12961938

#SPJ1

Katya owns two cockatoos, an older white cockatoo and a younger Galah cockatoo. At present, the sum of the cockatoos' ages is 44 years. In n years, where n > 0, the white cockatoo's age will be four times the Galah cockatoo's age. If n is an integer, determine the possible present ages of each cockatoo.

Answers

The possible present ages of each cockatoo, given the sum of the cockatoos would be Galah cockatoo is currently 10 years old and the white cockatoo would be 34 years old

How to find the ages of the cockatoos?

Let's use variables to represent the present ages of the two cockatoos. Let W be the present age of the white cockatoo and G be the present age of the Galah cockatoo. We're given that the sum of their ages is 44 years:

W + G = 44 (1)

In n years, the white cockatoo will be W + n years old, and the Galah cockatoo will be G + n years old:

W + n = 4(G + n) (2)

Since n > 0, 5G - 44 must be positive. We can try different values of G to find possible integer values for n.

For G = 8:

44 - 5(8) = 4

4 = -3n

n is not an integer.

For G = 10:

44 - 5(10) = -6

-6 = -3n

n = 2

So one possibility is that the Galah cockatoo is currently 10 years old. In this case, the white cockatoo would be 34 years old (since W + G = 44).

Find out more on age at https://brainly.com/question/27195683

#SPJ1

Other Questions
If triangle ABC has points A(2, -4) B(-3, 1) C(-2, -6) and you perform the following transformations, where will B' be?Reflection over the y-axis, rotation 90 clockwise, and translation (x + 2, y - 1)B'( , ) One more than two-thirds of a number is no less than 25 During a video about the Mayan civilization, you learn about a bright blue paint pigment that has not faded over time. The chemical composition of this paint pigment has allowed it to withstand not only natural elements, such as sun and rain, but also chemical solvents and acids. What paint did you MOST likely hear about? A. Maya blue B. stucco C. stela D. hieroglyphs you are attempting to interview a 20-year-old patient who brought her two young children with her to the office today she is a single mother who is pregnant with her third child and receives public assistance. how will this response impact your ability to be empathetic? in the context of the net promoter score (nps), which of the following is a difference between promoters and detractors? question 29 options: unlike promoters, detractors are customers who are associated with scores of 7 or 8. unlike promoters, detractors are satisfied customers who may switch to competitors. unlike promoters, detractors defect at higher rates. unlike promoters, detractors are less price sensitive. if you were asked to dissolve a solid into an aqueous solution, how could you speed this process up? how could you slow it down? listed below are a number of possible ways to alter the rate of this process. place them in the proper category. if you need help, think about putting sugar in your tea. items: add the solute in large chunks. add the solute slowly. increase the atmospheric pressure. stir or agitate the solution. if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind