Read the following passage carefully and answer the questions given below:
i. Polythene shopping bags and wrappers are a potential threat to urban environment. Once you have discarded them after use, you do not lose your link with them. They return to you in a variety of ways, though you do not realise it. For example, they choke your drains and provide breeding facilities to deadly germs.
ii. A recent study has shown that about 250 tonnes of plastic waste come out of various colonies of major cities every day. This disrupts the sewer system, the essential arteries of city life, choke the land mass and clog the pores of the wetlands.
iii. Unfortunately, even the villages and small towns are not free from this danger. Millions of people returning to their home towns everyday carry their shopping in colourful bags. This pleases their family and children, who after preserving them for a time dispose them in wells, rivers, tanks and drains. Many throw them off into the fields. They do it with a sense of pride, to show off. When their neighbours see that their men from the cities regularly send them those good things of life, they are impressed.
iv. All over the world the worst offenders are the upper income groups of the so-called posh colonies. Though educated, the residents of these affluent areas are unaware of the damage done by the plastic bags. Millions of children in schools carry their lunch boxes in plastic bags. They callously throw them away and cause an unhealthy environment.
v. As it is convenient for mothers to wrap the food in plastic, it is difficult to persuade them against doing this. According to a drill master of a school, it becomes a drill to clean the fields after the children leave. When the midday meal scheme is fully implemented, it must be seen that no plastic wrappers are used.
vi. As these wrappers are light in weight, they are borne aloft by the wind causing visual shocks. Unlike cotton or paper bags they remain undissolved in the mud and stop rain water from seeping deep in the earth. This affects the natural growth of greenery.
Questions:
a. How do polythene bags become health hazards?
b. What are the findings of the latest research about plastic waste?
c. How do the school children pollute the environment?
d. How do plastic bags hamper the growth of greenery?
e. Find the synonyms for the following words from the given passage:
thrown & wealthy
f. Find the antonyms for the following words from the given passage:
poor & shame
g. Give an appropriate title to the passage.
h. Write the meanings of the following words and frame sentences which should not match the content of the passage.
Damage & posh
i. Give the essence of the passage in not more than 75 words.

Answers

Answer 1
Orange yellow blue blue yellow red yblue gete r egwj w wuywuyou y. Orange. Orange. Hwbw efce erhebe

Related Questions

Refer to Explorations in Literature for a complete version of this story. Reread this example of foreshadowing from “After Twenty Years” by O. Henry. "... But I know Jimmy will meet me here if he's alive, for he always was the truest, stanchest old chap in the world. He'll never forget." Which statement best explains how the author's use of foreshadowing affects the story? It creates suspense by hinting at the fact that Silky Bob already knows that Jimmy will not show up to meet him. It adds to the surprise created later when it's revealed that Jimmy did meet Silky Bob; indeed, Bob is saying these words to Jimmy himself. It adds humor to the story since readers, unlike Silky Bob, already know that he's speaking to Jimmy when he delivers these lines. It creates mystery in the story by subtly suggesting that something awful has happened to Jimmy.

Answers

Answer:

It adds to the surprise created later when it's revealed that Jimmy did meet Silky Bob; indeed, Bob is saying these words to Jimmy himself.

Explanation:

Foreshadowing is a literary device in which the writer gives hints about what is going to happen later in the story. This is what O. Henry does in his short story After Twenty Years.

The story tells about two close friends, Jimmy Wells and Silky Bob. They grew up together, but later they chose different paths. However, they made a deal - to meet in twenty years at the restaurant where they last saw each other.  Twenty years later, Bob is waiting for Jimmy. A policeman stops by to question him, and Bob tells him his story, expressing no doubt that Jimmy would show up. That's when he says the words you were given as an example of foreshadowing. Soon after, a man who introduces himself as Jimmy Wells arrives, but Bob notices that his nose is not the same as Jimmy's. It turns out that the man is a plainclothes policeman who arrests Bob, a wanted criminal. He gives Bob a letter from Jimmy, and Bob realizes that the policeman he met earlier was in fact the true Jimmy. In the letter, Jimmy explains that, when he arrived at the meeting spot and realized that Bob was the wanted criminal, he didn't have the heart to arrest him and sent a plainclothes officer to do it instead.

Based on the entire story, we can conclude that the given example of foreshadowing adds to the surprise created later when it's revealed that Jimmy did meet Silky Bob; indeed, Bob is saying these words to Jimmy himself.

is the phrase "this bowl" a complete sentence

Answers

Answer: No I don’t think so

Answer: it depends on which term that you are using it, like if someone ask you which bowl got the salt, and there are 2 bowl one got sugar one got salt, you're gonna answer "this bowl" but you can't using on other terms. but i think it will be not a complete sentence

(hope this helps)

Explanation:

Help plz I have 10 minutes

Answers

Answer:

The last one

Explanation: Its the proper thing to do

Need help ASAP
Marking brainliest

Answers

Answer:

9

Explanation:

3^4/3^2 is 3^2 or 9. If you are dividing powers that have the same base, SUBTRACT. Do not divide.

Hope this helps plz mark brainliest if correct :D

Answer:

it is b

Explanation:

because you have to make them into a mixed number and then divide them

which contains an adjective? (describe a person place object or thing )​

Answers

Answer:

The blue boat.

Explanation:

An adjective is a part of speech in grammar that describes or modifies a noun. It adds detail about a noun or pronoun in the sentence.

Among the given options, "the blue coat" contains an adjective. This is because the noun "coat" is described as "blue", which is an adjective. The other options contain no adjective in them.

The (article) blue (adjective) coat (noun).

Thus, the correct answer is the first option.

I need help, is basi english pleaseee​

Answers

Answer:

you are right

Explanation:

carry on. #40 is them #41 is yourself and #42 is herself. (: great job!!!

It happens when a person experience deep grief. *

Answers

Answer: ashamed about how you feel ... Profound sadness is probably the most universally experienced

Explanation:

Answer:

um depression? sadness? heart attack? are there choices to chose from or??

Explanation:

Commanders have recognized the need for some form of staff organization that can _____ to inform or influence the audiences in support of desired outcomes.

Answers

Answer:

Explanation:

there are a couple of answers to this particular question. I will mention just two of them.

The first is that

Commanders have recognized the need for some form of staff organization that can remain passive in the information environment to inform or influence the audiences in support of desired outcomes.

The second is that

Commanders have recognized the need for some form of staff organization that can craft the themes and messages to inform or influence the audiences in support of desired outcomes.

what information should be included? When contacting an online instructor?

Answers

reason for contacting?

Which sentence has a shift in verb tense?
As I came in the front door, Eddie is going out the back door.
o If anyone knows the answer, she does.
O A row of ants had filed up the chair leg and was about to consume our lunch.
o The barrier will drop down every time that a train approaches the crossing.

Answers

The barrier will drop

Hiroshima Character Graphic Organizer As you read, fill in observations for EACH chapter. Characters What factual details do you notice about the character? (Occupation, Attitude, Description, etc) What obstacles does the character face? Physical, Mental, and Emotional Explain how this obstacle is or is not a human rights issue. How does the character respond to each obstacle and what is the effect of that response? Include a quotation with the page that shows the obstacle. How does the time period affect the character's approach to the obstacle? How does this character interact with others? Miss Sasaki Dr. Fujii Mrs. Nakamura Father Kleinsorge

Answers

Hiroshima Character Graphic Organizer describes about Miss Sasaki and the obstacles and struggles faced by her when the bomb went off in East Asia Tin Works. It can be explained further by the following answers to the given questions:

1. Characters What factual details do you notice about the character? (Occupation, Attitude, Description, etc.)  

Ans: This girl possessed incredible strength. Only the two individuals imprisoned in the shed with her knew she was alive for days.

2. What obstacles does the character face? Physical, Mental, and Emotional?  

Ans: Her leg had been badly damaged and was on the verge of being amputated. It had become so contaminated that it had begun to spread throughout her body.

3. Explain how this obstacle is or is not a human rights issue.

Ans: Because she was an innocent human being who was almost killed, this impediment is a human rights concern.

4. How does the character respond to each obstacle and what is the effect of that response?  

Ans: When Miss Sasaki hears of her leg troubles, she is quite strong and confident.

5. Include a quotation with the page that shows the obstacle.  

Ans: “There, in the tin factory, in the first moment of the atomic age, a human being was crushed by books.”

6. How does the time period affect the character's approach to the obstacle?

Ans: She didn't have access to the same level of technology that we have today. She could have called someone on her cell phone to let them know where she was if it had been today.

7. How does this character interact with others? Miss Sasaki Dr. Fujii Mrs. Nakamura Father Kleinsorge

I'm not sure whether this is what you'd call an interaction, but she was imprisoned in a shed with two other injured people for days.

Learn more about Hiroshima bomb drop here:

https://brainly.com/question/1376505

i was teaching english when she _____the classroom(enter)​

Answers

I was teaching English when she Entered the classroom

Answer:  came in

Explanation:

What is one difference between Veterans Day and Memorial Day?

Answers

Veterans day is to celebrate all the veterans that served for the states and that have died. Memorial day is a day to thank the veterans who served in wars

What is the moral of pandora's box?

Answers

Answer:

is that unchecked curiosity and disobedience can be dangerous, but hope remains.

Hope it helps

In Anne Frank: The Diary of a Young Girl, how does Anne make a connection between herself and Peter Van Daan?

Answers

Peter van Pels was 15 years old when he had to go into hiding with his parents. They arrived at the hiding place one week after the Frank family. Peter was the only boy in the Secret Annex.

Answer:

Peter van Pels was 15 years old when he had to go into hiding with his parents. They arrived at the hiding place one week after the Frank family. Peter was the only boy in the Secret Annex.

Explanation:

can someone please help me with this journal

Answers

Answer:

.

Explanation:

Car makers have an idea about changing the body of
a car so that the car would not need a battery. The
body of the car would be able to
А. become larger or smaller.
B. change color.
С. store energy.
D. fix itself after a crash.

Answers

Answer C. because if it would not need a battery it would need another source of energy

in story Two kinds what does the mother hope for her daughter ​

Answers

Answer:

Jing-mei's mother wants her daughter to live the American Dream. She believes America is the land of endless opportunities. Specifically, she wants her daughter to be a prodigy.

Explanation:

Answer: She wants her to learn a special talent and become a child prodigy.

Explanation:

Hope This Helps ! : )

PLEASE HELP ME I DON'T KNOW THE ANSWER WILL GIVE BRAINLIEST
The disease that causes difficulty breathing, coughing, wheezing, and constriction of the bronchial airways is called:

Answers

Answer:

corona

Explanation:

1. Whar problem did Seabiscuit face in the race?
A. The track was not dry.
B. The track was new to him.
C. His jockey was new to him.
D. His blinders bothered him.

Answers

Answer:

its C

Explanation:

Discuss these questions with partther.

Answers

let’s discuss he answe

My mother always told me that I had an overactive imagination, but look at me now. I'm writing Hollywood movies for big budget studios. I drive a fancy red bicycle. I eat so much sushi that I've got tapeworms living in my body. Isn't that something? All of this is due to the power of imagination. If it weren't for my powerful imagination, I wouldn't be able to write all of these ridiculous stories.

What point of view is this:

A.) First-person subjective

B.) Second-person objective

C.) Third-person objective

D.) Third-person limited omniscient subjective

E.) Third-person omniscient subjective

Answers

Answer:

A is the answer

The principle crop of the Mayans was
O bananas
Orice
spaghetti
corn

Answers

Answer:

D. Corn

Explanation:

The Mayans had many crops like beans, squash, other fruits, etc. But they had over 60 different kinds of corn. Corn was also very important to them because so many of their dishes included corn.

Answer:

corn vb

Explanation:

can anyone help me please ​

Answers

Answer:

1. Intuitively intelligent. Excellent communicators. Live in groups.

2. Dolphins protected fishermen in 2001, saving them from danger. Have saved people from drowning.

3. Pollution and being drowned in fishing nets.

Explanation:

Nice to see you again! Have a good day/night!

im reallybneed help, is vasic english the answers go in the spaces where the numbers are.​

Answers

27 should be "neither", the others are right

Which sentence demonstrates correct subject-verb agreement? A: Where are the watering cans stored? B: Where are the hookup for the hose? C: Where is the plants growing? D: Where is the students going to weed?

Answers

Answer:

The correct answer is where are the watering cans?

Explanation:

All the other sentences do not make sense as they are written in the wrong person.

Which of the following references can be used to find the definition of an unknown word? (Encyclopedia dictionary glossary thesaurus)

Answers

Answer:

Dictionary

Explanation: Thats where you find word meanings

Answer:

Dictionary

Explanation:

In the dictionary you can get the definition or meaning of any word

Help me with this basic english pleaseeeee. the answers go in the spaces where the numbers are.​

Answers

what do you need help with? these questions/ answers are correct from what you put

Answer:

you are correct

Explanation:

chapter 22 summer of mariposas summary? pls

Answers

Answer:In chapter 22 of summer of la mariposa Odilia is having her sweet 16th birthday party she has grown up a lot Odilia and her sister are starting to go back to school. Mama has also gone back to school and now has a job in a private school and her boss does not mind that she keeps a close eye on the girls.  While the party Odilia's father shows up she begins to talk to Odilia and as he talks Odilia becomes more clear of why he is here he wants to talk to mama. But after talking to Odilia he decided to leave, Odilia wasn't mad she was happy.

Explanation:

The summary of Chapter 22 of Summer of the Mariposas by Guadalupe Garcia McCall recalls the return of Odilia's absent father at her 16th birthday party.

This 16th birthday happened after Odilia with her sisters had returned from their Odyssey journey from the world of the spirits, helped only by a benevolent spirit, La Llorona. They had earlier embarked on the cross-border journey to return the body of a dead man that they found in the Rio Grande.

Earlier, the father of the four sisters had disappeared.  Perhaps, he followed another woman while abandoning the girls to the care of their mother. But on Odilia's 16th birthday, the father reappeared to seek reconciliation with their mother.

Thus, the summary of Chapter 22 is about Odilia's 16th birthday party and the return of their runaway father.

Learn more: https://brainly.com/question/21901162

Plzzz I need an anecdote Write about a time that you forget something really important and the consequences of your actions.plzzzzz

Answers

"I forgot to study for my test on Tuesday, and I ended up getting 63.29% on the test, but at least I didn't get an F!"

Other Questions
12 13 14 Qu frase es incorrecta? De nio, el hombre siempre jugaba en la selva. Carlos y Sofa vean muchas cosas interesantes and Costa Rica la semana pasada. Cuando yo era joven, yo miraba la tele de vez en cuando. Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys???