Qué elementos arquitectónicos escultóricos tiene en común Chichén Itzá y Tula​

Answers

Answer 1

Chichén Itzá y Tula son dos sitios arqueológicos importantes de la cultura mesoamericana en México. Ambos sitios tienen elementos arquitectónicos y escultóricos en común, lo que sugiere que hubo interacción cultural entre las dos regiones.

Uno de los elementos más destacados en común es la presencia de columnas y pilares decorados con relieves de figuras humanas y animales. Estas columnas son un ejemplo de la arquitectura tolteca, que se caracteriza por sus detalles en piedra tallada.

Otro elemento en común es la presencia de un juego de pelota en ambos sitios. Este juego ritual era un elemento importante en la cultura mesoamericana y se jugaba en una cancha rectangular con paredes verticales.

Además, en ambos sitios se encuentran representaciones de la serpiente emplumada, una deidad importante en la cultura mesoamericana. En Chichén Itzá, la serpiente emplumada está representada en la figura del dios Kukulcán, mientras que en Tula está representada en la figura del dios Quetzalcóatl.

Por último, tanto Chichén Itzá como Tula tienen arcos y bóvedas en sus edificios, lo que sugiere una influencia de la arquitectura romana y bizantina en la región. Estos elementos arquitectónicos y escultóricos en común muestran la rica diversidad cultural de la región mesoamericana y la importancia de la interacción entre diferentes culturas.


Related Questions

According to document C, why are they sharing the coded message in document A with the United States?

Answers

Answer:

what do u mean doc C and A there is no docs attached

one of the most powerful families in italy during the renaissance was the hapsburg family. truefalse

Answers

Answer:

True

Explanation:

Its a 50 50 im just guessing

Which strategy did Mahatma Gandhi use to help gain independence for India after World War II?

Question 5 options:

violent terrorist attacks


Guerrilla warfare


protest through refusal to obey unjust laws


democratic elections

Answers

Answer:

C. Protest through refusal to obey unjust laws

Explanation:

C.
Gandhi was a a peaceful protester so A and B are immediately incorrect.

Compare the Pre European lifestyle of Ojibwa to Post-European influences/contact changes

Answers

The Ojibwa, also known as the Chippewa, are a Native American people who have traditionally lived in the Great Lakes region of North America. Prior to European contact, the Ojibwa lived a traditional lifestyle that revolved around hunting, fishing, and gathering.

Pre-European Ojibwa lifestyle:

The Ojibwa people lived in small, mobile bands that moved throughout the region in search of food and resources. They relied on hunting and fishing to sustain themselves, and also gathered wild plants and fruits for food. The Ojibwa were skilled hunters who used bows and arrows to hunt game, and they also fished using nets and traps.

The Ojibwa were also known for their strong oral tradition, which included stories, legends, and songs that were passed down through generations. They had a deep respect for the natural world and believed in the interconnectedness of all things.

Post-European influences/contact changes:

The arrival of European explorers and settlers had a significant impact on the Ojibwa way of life. Europeans brought with them new technologies, such as firearms, which made hunting easier and more efficient. They also introduced new diseases, such as smallpox, which had a devastating impact on Ojibwa populations.

As Europeans established trade relationships with the Ojibwa, they also introduced new goods, such as blankets, cloth, and metal tools, which changed the Ojibwa economy and way of life. The Ojibwa began to rely more on agriculture and trading, and less on hunting and gathering.

The arrival of European missionaries also had a significant impact on the Ojibwa religion and culture. Many Ojibwa people converted to Christianity and adopted new religious practices.

Today, the Ojibwa continue to maintain their cultural traditions and practices, while also incorporating elements of modern society. They have adapted to the changes brought by European contact, but have also worked to preserve their unique heritage and way of life.

how did the economy of the 1920s impact the farmers

Answers

Answer:

The economy of the American farmers experienced the Great Depression after World War I. For much of the Roaring '20s, the American farmer was trapped in a never ending cycle of debt caused by falling farm prices and the need to purchase expensive machinery.

Explanation:

This answer wasn't plagurized, I paraphrased my research I found.

At which location does the movement of tectonic plates form isolated volcanic islands such as Hawaii?

Answers

Answer:

The movement of tectonic plates that form isolated volcanic islands such as Hawaii occurs at hotspots. A hotspot is a location on the Earth's surface where a plume of hot magma rises from deep within the mantle and forms a volcanic island when it reaches the surface. The tectonic plates move over the hotspot, which creates a chain of islands that extends away from the hotspot. In the case of Hawaii, it is formed by a hotspot located beneath the Pacific Plate, which has created a chain of islands that includes the Hawaiian Islands.

Explanation:

Which statement best describes the debate over tariffs in the 1840s?
OA. Northern states wanted lower tariffs, while southern states
wanted higher tariffs.
B. Northern states wanted higher tariffs, while southern states
wanted lower tariffs.
C. Both northern states and southern states wanted lower tariffs.
D. Both northern states and southern states wanted higher tariffs.

Answers

I think the answer is B. Northern states wanted higher tariffs, while southern states wanted lower tariffs.

one reason muslim scholars settled in timbuktu was choose 1 answer: choose 1 answer: (choice a) the mali government protected them and encouraged them to come to the city a the mali government protected them and encouraged them to come to the city (choice b) it was one of the only cities where paper was available b it was one of the only cities where paper was available (choice c) it was built in a similar style to the city of baghdad and they felt at home there c it was built in a similar style to the city of baghdad and they felt at home there

Answers

The reason Muslim scholars settled in Timbuktu was because the Mali government protected them and encouraged them to come to the city.

prior to the french revolution, which group was considered part of the third estate?

Answers

Prior to the French revolution the gathering that was considered a piece of the third estate was the Merchants. option (B) is correct.

The French Revolution was a critical occasion in world history that started in the extended period of 1789 and finished in the last part of the 1790s with the presence of Napoleon Bonaparte. During this period, French residents fundamentally adjusted their political scene, evolving extremely old organizations like the government and the medieval framework.

The individuals from the Third Bequest went from unfortunate hobos and battling workers to metropolitan craftsmen and workers, from the retailers and business working classes to the country's most extravagant shippers and industrialists. Therefore, option (B) is correct.

Learn more about French Revolution:

https://brainly.com/question/2796465

#SPJ4

This question is not complete, Here I am attaching the complete question:

Prior to the French revolution, which group was considered part of the third estate?

(A) Nobles

(B) Merchants

(C) Priests

(D) Bishops

What was Charles de Montesquieu philosophy?

Answers

Montesquieu believed that the best way to protect individual liberty and prevent the abuse of power by government was to divide the powers of government into three separate branches: legislative, executive, and judicial. Each branch would have a distinct role and responsibility, and no single branch would have too much power.

Montesquieu argued that the legislative branch should make the laws, the executive branch should enforce the laws, and the judicial branch should interpret the laws. He believed that this system of checks and balances would prevent any one branch of government from becoming too powerful and abusing its authority.

Montesquieu also believed in the importance of individual freedom and the rule of law. He argued that laws should apply equally to all citizens, regardless of their social status or wealth. He also believed that the purpose of government was to protect the natural rights of individuals, including the rights to life, liberty, and property.

Overall, Montesquieu's philosophy of government was influential in the development of modern democracies, and his ideas about the separation of powers and checks and balances continue to be relevant to political theory and practice today.

Summarize the steps that Axis powers took to achieve world power prior to WW II.

Answers

The Axis powers, led by Nazi Germany, took several steps to achieve world power prior to WWII, including militarization, territorial expansion, and alliances with other nations.

The Axis powers, consisting of Nazi Germany, Fascist Italy, and Imperial Japan, sought to expand their influence and control in the years leading up to WWII. They took several steps to achieve this, including militarization, territorial expansion, and alliances with other nations.

Nazi Germany, under the leadership of Adolf Hitler, pursued a policy of rearmament and military expansion, building up its army and navy and increasing its military presence in Europe. Germany also annexed Austria and parts of Czechoslovakia, and later invaded Poland, which led to the outbreak of WWII.

Fascist Italy, led by Benito Mussolini, sought to expand its territory and influence in Africa and the Mediterranean. Italy invaded Ethiopia, Albania, and Greece, and allied with Germany and Japan. Imperial Japan, under the leadership of Emperor Hirohito, pursued a policy of territorial expansion in Asia and the Pacific. Japan invaded and occupied China, Korea, Manchuria, and other parts of Southeast Asia, and later allied with Germany and Italy.

Overall, the Axis powers sought to achieve world power through military strength, territorial expansion, and alliances with other nations. These actions ultimately led to the outbreak of WWII and the defeat of the Axis powers by the Allied powers.

To know more about the WW II, here

https://brainly.com/question/30236817

#SPJ4

Why did the cartoon of president bush state of the union address appear in 1909

Answers

It is not possible for the cartoon of President Bush's State of the Union address to have appeared in 1909, as he was not president at that time.

George W. Bush was the 43rd President of the United States, serving from 2001 to 2009. It is possible that you are referring to a different president or cartoon.

What is President?

A President is the head of a state or a country, typically a democratic republic. The President is usually responsible for overseeing the government, executing laws and policies, serving as a commander-in-chief of the military, representing the country in international relations and diplomacy, and carrying out ceremonial duties. The specific powers and responsibilities of a President vary depending on the country and its political system.

To know more about president, visit:

https://brainly.com/question/497462

#SPJ1

when did british forces take the benin bronzes from what is now nigeria?

Answers

British forces took the Benin Bronzes from what is now Nigeria in 1897. The Benin Bronzes are a collection of metal castings created by the Edo people of the Kingdom of Benin in what is now Nigeria.

They were made between the 13th and 16th centuries and were primarily used for decorative purposes. These pieces were created using the lost-wax casting method, which entails carving a wax model of the desired object, coating it in clay, and then melting away the wax, leaving a hollow clay mold that can be filled with molten metal, resulting in a cast image. The Benin Bronzes depict a variety of subjects, including humans, animals, and mythological beings, and were used for a variety of purposes, including religious rituals, historical commemorations, and courtly displays.

British forces took possession of the Benin Bronzes in 1897, when they invaded and destroyed the Kingdom of Benin. The British looted thousands of objects from the royal palace, including many of the Bronzes, which were taken as spoils of war. These objects were later sold or given to various museums and collectors, most of them in Europe and the United States. This has been a point of contention between Nigeria and many Western countries for years.

For more such questions on Benin Bronzes

https://brainly.com/question/12408495

#SPJ11

What was the HoChi Minh Trail

Answers

Answer: Between 1959 and 1975, the Democratic Republic of Vietnam (North Vietnam) used a series of trails running through Vietnam, Cambodia and Laos to transport weapons, supplies and reinforcements to the North Vietnamese Army and other sympathizers within South Vietnam.

Explanation:

Atoms are the basic building blocks of ordinary matter

Answers

Answer:

Atoms are the basic building blocks of ordinary matter. Atoms can join together to form molecules, which in turn form most of the objects around you. Atoms are composed of particles called protons, electrons and neutrons.

Explanation:

Who thought that governments should be headed by philosopher-kings?
Astronomers
Stoics
Plato
Nomads

Answers

Plato thought that governments should be headed by philosopher-kings. Hence, option C is correct.

During the Classical era in ancient Greece, the philosopher Plato was born in Athens. Plato established the Academy, a school of philosophy in Athens, where he taught the ideas that would later come to be known as Platonism.

Greek philosopher Plato is most known for his philosophical writings, which have had an unequaled impact on Western thought. He was a pupil of Socrates, a teacher of Aristotle, and the founder of the Academy. In The Republic, Plato makes the case that kings ought to become philosophers or that philosophers ought to become kings, or philosopher kings since they have a particular kind of knowledge that is necessary to successfully administer the Republic.

Although in theory, it would be ideal for knowledge to rule the Republic and the contemporary state rather than power, power is an essential component of political activity.

To learn more about Philosopher King of Plato, click here:

https://brainly.com/question/13033273

#SPJ4

What happened to Yugoslavia in the 1990s?

Answers

In the 1990s, Yugoslavia experienced political and social instability, leading to a series of wars and ultimately the breakup of the country into several independent states.

What happened to Yugoslavia in the 1990s?

The 1990s were a period of upheaval in Yugoslavia, which ultimately led to the disintegration of the country. Following the death of longtime leader Josip Tito in 1980, Yugoslavia experienced increasing political and economic instability, which was exacerbated by the fall of the Soviet Union and the end of the Cold War.

The breakup of Yugoslavia began in 1991, when the Republic of Slovenia and the Republic of Croatia declared their independence from Yugoslavia. This led to a brief war between the newly independent states and the Yugoslav military, but both were eventually recognized by the international community.

The next state to declare independence was the Republic of Bosnia and Herzegovina, which led to a brutal conflict between Bosnian Serbs, Bosnian Croats, and Bosniaks. The war lasted from 1992 to 1995 and resulted in the deaths of approximately 100,000 people and the displacement of over two million more.

In 1998, conflict broke out again in Kosovo, a province of Serbia with a majority Albanian population. The Kosovo War ended in 1999 with NATO intervention and the establishment of a UN-administered province. By 2006, Yugoslavia no longer existed, and its former republics had become independent states.

Learn more about Yugoslavia https://brainly.com/question/756850

#SPJ11

Which statements accurately describe the Persian Wars?

Select all correct answers.

1.Xerxes thought he could conquer Greece because the city-states would not unite.
2.The Spartan king, Leonidas, saved Greece by delaying the Persians at Thermopylae.
3.the Athenian fleet defeated the Persians at Salamis.
4.Athens was destroyed by the Persians and never regained its strength.
5.The Greeks attacked Persia because Darius captured Sparta's king.

Answers

Option (a), (b) and (d), Because the city-states did not come together, Xerxes believed he could conquer Greece. In Salamis, the Athenian navy beat the Persians. Leonidas, the king of Sparta, prevented the Persians from capturing Thermopylae, saving Greece.

How did the Athenian navy defeat the Persians in the Battle of Salamis?

The Persian fleet was subsequently duped by the Greek commander Themistocles into the strait at Salamis, where the numerous Persian ships had difficulty navigating. The Persian ships were then attacked fiercely by the Greek triremes, who boarded some and battered or sank others.

How did the Greeks succeed to overcome the Persians during the Persian Wars?

The longer spears and heavier armor of the bronze-clad Greek warriors beat the Persian infantry with their small spears, wicker shields, and cushioned clothing. The defeat was over. Herodotus asserts that the Persians lost 6,400 soldiers, whilst the Greeks only suffered a loss of 192.

Learn more about Persian Wars: https://brainly.com/question/11027063

#SPJ1

which provision of the compromise of 1850 had the greatest influence on convincing many northerners to support abolition?

Answers

The provision of the Compromise of 1850 that had the greatest influence on convincing many Northerners to support abolition was the Fugitive Slave Act.

What is the Compromise of 1850?

The Compromise of 1850 was a series of bills that were passed in the United States by Congress to settle tensions and disputes arising from the expansion of slavery into Western territories.

It was an agreement between the pro-slavery South and the anti-slavery North that allowed California to be admitted as a free state while also enforcing a stricter Fugitive Slave Act.

What was the impact of the Fugitive Slave Act?

The Fugitive Slave Act, one of the most contentious provisions of the Compromise of 1850, had a significant impact on the issue of abolition in the North. It mandated that citizens of free states had to assist in the return of runaway slaves to their masters or face penalties.

In the North, the passage of the Fugitive Slave Act sparked outrage and a wave of anti-slavery sentiment. Many Northerners, who previously had not been particularly interested in the abolition movement, were now appalled by the idea of returning runaway slaves to bondage.

The act's provisions also allowed for the forced removal of free blacks to the South, furthering resentment and anger towards the pro-slavery legislation.

The Fugitive Slave Act was a significant factor in the growing abolitionist movement in the North. As more people became aware of the horrors of slavery and the reality of its impact on the country, they became more committed to ending the practice.

The Act was one of the most important pieces of legislation passed during this period, and its impact is still felt today.

To learn more about Fugitive Slave Act, refer below:

https://brainly.com/question/26160636#

#SPJ11

Question 5(Multiple Choice Worth 5 points)

(01.05 MC)

What was the position of the eastern church in the Byzantine empire on icons throughout the period 500-1000?

It opposed them as being idolatrous.
It defended them as aiding in religious devotion.
It advised individuals to be discerning on the issue but took no institutional position.
It switched between banning and approving them at least twice

Answers

it opposed them as being idolatrous

Which movement received national attentionbecause of the Scopes Monkey Trial?A. the Suffrage MovementB. the Progressive MovementC. the Temperance MovementD. the Fundamentalist Movement

Answers

Answer:

Explanation:The movement that received national attention because of the Scopes Monkey Trial was the Fundamentalist Movement. The Scopes Monkey Trial took place in 1925 in Dayton, Tennessee, and was a highly publicized court case that pitted fundamentalist religious beliefs against the teaching of evolution in public schools. The trial was seen as a symbolic struggle between traditional religious values and modern scientific knowledge and attracted widespread media attention, making it a significant event in American cultural history. While the trial itself was focused on the teaching of evolution, it reflected broader debates over the role of religion and science in American society and the tensions between traditional values and social change in the early 20th century.

Que significa que somos diferentes en creencias

Answers

The fact that we have different beliefs means that we hold different opinions, perspectives, values, and attitudes about various aspects of life, such as religion, politics, morality, culture, and so on.

These differences can arise from various factors, including our upbringing, education, socialization, experiences, and personal reflection.Having different beliefs can lead to diverse and sometimes conflicting viewpoints, which can create tension and disagreement among individuals and groups. However, it is important to recognize and respect these differences, as they reflect the diversity of human experience and expression. Engaging in open and respectful dialogue, seeking to understand and appreciate other people's beliefs, and finding common ground and shared values can help bridge the gap between different beliefs and foster greater understanding and cooperation.

To learn more about religion click the link below:

brainly.com/question/30390910

#SPJ4

What might the author Donald P. Steury have meant when he wrote, Yet, permanent though it appears, the Wall was impermanent ?

Answers

Answer:

Perhaps the author meant that although the Wall was built to last forever, it eventually fell and crumbled. Alternatively, he may have been referring to the fact that even though the Wall physically stood for many years, it did not ultimately prevent the collapse of the Roman Empire.

Explanation:

think about the way in which society was organized under the old regimes: in what ways, then, do the provisions in this document add up to a revolution?

Answers

Under old regimes, power was typically concentrated in the hands of a monarch or ruling elite, with limited rights and freedoms for the general population. Provisions that challenge this status quo and expand rights and freedoms for the population could be considered revolutionary.

Examples of provisions that could add up to a revolution include:

The establishment of a democratic government that gives power to the people and limits the authority of the monarch or ruling elite.The granting of individual rights and freedoms, such as freedom of speech, religion, and assembly, that were previously restricted.The abolition of a rigid social hierarchy that divides society into distinct classes or castes, and the establishment of greater social and economic equality.The recognition of the rights of previously marginalized or oppressed groups, such as women, minorities, and workers.

Overall, provisions that add up to a revolution are those that fundamentally transform the existing power structures and establish a new order that better reflects the needs and desires of the population.

This story is about Tom Sawyer pirate

Answers

Answer:

15: B


17: A Or D (pick one that fits


18: C

Explanation:

ESSAY: Native American culture.

Here is your goal for this assignment:

Write an essay on the culture of a present-day Native American tribe of your choice


Choose one of the present-day tribes of Native Americans and write an essay on their culture. Be sure to answer the following questions in your essay:

Who were their ancestors? How did they meet the basic needs of food, shelter, and clothing? In other words, what was their economic system like?
What were their values and beliefs and how were the roles of the men and women in their society different?
What are some of the tools, utensils, or other artifacts the people made and used?
Use an encyclopedia, the Internet, or other sources to help you when writing your essay.

Your essay should be 250 words in length.

Proper documentation includes both parenthetical citations within the body of your essay anytime you summarize or quote a source, as well as a works cited page.

Answers

Answer: The Navajo Nation is a present-day tribe of Native Americans with a rich cultural heritage. The Navajo people, also known as the Diné, are believed to have migrated from the northwestern parts of Canada and Alaska around 1400 CE. They initially lived as hunters and gatherers, relying on the natural resources of their surroundings for food and shelter.

The Navajo people developed a strong economic system that allowed them to meet their basic needs. They became skilled farmers, herders, and weavers, and developed irrigation systems to cultivate crops. They also raised livestock such as sheep, goats, and horses for food and transportation. Additionally, the Navajo people traded goods with neighboring tribes, such as Puebloans and Apache, to obtain resources they could not produce themselves.

The Navajo people's values and beliefs are centered around respect for the natural world, family, and community. Their spiritual beliefs are tied to their relationship with the land and animals, and they practice various ceremonies and rituals to honor and maintain that relationship. Men and women had different roles in Navajo society, with men traditionally responsible for hunting, farming, and providing protection, while women were responsible for weaving, cooking, and raising children.

The Navajo people also created and used a variety of tools, utensils, and artifacts. They used stone tools such as knives, axes, and scrapers for hunting and crafting, and they also made pottery and baskets for storing and carrying goods. The Navajo people are known for their intricate weaving, creating blankets, rugs, and other textiles using natural dyes and wool from their livestock.

In conclusion, the Navajo Nation has a rich cultural heritage that emphasizes respect for the natural world, family, and community. Their economic system, values, and beliefs have been shaped by their history and environment, and their tools and artifacts reflect their ingenuity and resourcefulness.

Explanation: .

1. To what the phrases ¨the dark past,¨ the ¨stony¨ road, and the ¨way that with tears has been watered¨ refer?
-
2. What do you think Johnson means by the lines, ¨Have not our weary feet / Come to the place for which our fathers sighed?¨
-
3. What does the song tell you about the religious beliefs of some African Americans at the time?
-
4. How would you compare the tone of Johnson's poem with the work of Wharton and Fitzergreald?

Answers

The phrases "the dark past," "the stony road," and "the way that with tears has been watered" all refer to the difficult and painful history of African Americans in the United States, particularly during the era of slavery and segregation.

To what the phrases ¨the dark past,¨ the ¨stony¨ road, and the ¨way that with tears has been watered¨ refer?    The phrases "the dark past," "the stony road," and "the way that with tears has been watered" all refer to the difficult and painful history of African Americans in the United States, particularly during the era of slavery and segregation.

   When Johnson writes, "Have not our weary feet / Come to the place for which our fathers sighed?" he is referencing the long and difficult struggle for civil rights that African Americans have endured in the United States. He is suggesting that, despite the many challenges and obstacles they have faced, they have finally arrived at a place where their ancestors had hoped and prayed they would someday be.

   The song suggests that many African Americans at the time were deeply religious and found solace and strength in their faith. The references to "God's unchanging hand" and "the light of hope" are indicative of this religious belief and the comfort it provided to those facing oppression and hardship.

   The tone of Johnson's poem is one of perseverance, resilience, and hope in the face of adversity. Wharton's work often deals with themes of social class and privilege, while Fitzgerald's work tends to focus on the disillusionment and decadence of the Jazz Age. While all three writers address issues of race and identity, Johnson's work is distinct in its emphasis on the struggle for civil rights and the resilience of the human spirit.

Learn more about phrase here:https://brainly.com/question/27892321

#SPJ1

separatist movements have plagued indonesia since independence. which of these regions has not been involved in a significant separatist movement?

Answers

In Indonesia, there hasn't been a sizable separatist movement on Sumatra. Due to historical, cultural, and economic factors, separatist movements have occurred in other places, including Aceh, West Papua, and East Timor.

What separatist organisations exist in Iran?

The Kurdish-Persian conflict, also known as Kurdish separatism in Iran, is an ongoing, protracted war between the Kurdish resistance in Western Iran and the Iranian government that has existed since Reza Shah Pahlavi's rise to power in 1918.

Which of the following was the response for the separatist movement?

The Naxal-Maoist insurgency, the Khalistan movement, the Assam separatist activities, the Karbi Separatism, and other well-known separatist movements have all occurred in India.

To know more about separatist movements visit:-

https://brainly.com/question/29058513

#SPJ1

Pls help 30 points
The state government of Washington is responsible for running the education system in the state. Which of the following best explains why this is true?
A.
The U.S. Congress gives states the power to run schools.
B.
The 10th Amendment gives states the power to run schools.
C.
The national government cannot afford to pay for schools in the state of Washington.
D.
The state of Washington does not trust the national government to run schools.

Answers

Answer:  The correct answer is B. The 10th Amendment gives states the power to run schools.

Answer:

The correct answer is B

Explanation:

However the 10th Amendment states that powers not delegated to the federal government are reserved to the states or to the people. Thus, education became a function of the state rather than the federal government.

During the seventeenth century, indentured servants:

had a great deal of trouble acquiring land.

were almost entirely Irish.

had to pay half of the fare to get them to the New World.

had to surrender their freedom for a minimum of ten years to come to the colonies.

made up less than one-third of English settlers in America.

Answers

During the seventeenth century, indentured servants had to surrender their freedom for a minimum of ten years to come to the colonies. They were typically English, though some were also Scottish, Welsh, or Irish.

Indentured servants were often poor individuals who could not afford the cost of the passage to the New World. They would agree to work for a set number of years in exchange for transportation to the colonies. While they did not have the same level of freedom as other colonists, they were not slaves, and their contracts typically included some provisions for their eventual release and the possibility of acquiring land or other property.

It is not accurate to say that indentured servants were almost entirely Irish or that they made up less than one-third of English settlers in America. While there were certainly Irish indentured servants, they were not the majority, and the majority of English settlers in America were not indentured servants.

Other Questions
if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be? which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin How did US and Soviet nuclear arsenals compare? Use the equation in the example to find the number ofcups of water you need if you have 12 cups of flour. when carbonyl compounds are reduced with a reagent such as lialh4 or nabh4 and a new stereogenic center is formed, what will the composition of the product mixture be? 7The United States receives more immigrants than any other nation in the world. However, many countries, like Saudi Arabia and Australia, have a greater percentage of their population made up of immigrants. What does this information reveal about these countries? A. They have smaller populations than that of the United States. B. Their life expectancy is less than in the United States. C. They have more lenient immigration policies than those in the United States. D. They encourage immigrants to move there more than the United States does. why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct. macy does not like a few of the standard operating procedures adapted for the new project. however, she discussed the items with the team and told them that she realized she was in the minority and that she would adapt the new procedures to maintain smooth operations within the team. which conflict-handling mode did macy use? spicy dish, a large distributor of canned beans and salsa, is organized into four business units: (1) north america salsa, (2) north america legume, (3) latin america, and (4) europe and asia. what two types of departmentalization are illustrated in this example? question 8 options: Describe the cities of the Indus River Valley (Use atleast 3 details):3 4. Myron Security, Inc., had total sales for 1 year of $945,860. Their advertising expenses were $57,370. a. Estimate the percent advertising expenses were of total sales. How do u think readers responded to the William Travis letter with this corrective lens in place, what is her new near point? express your answer with the appropriate units. Write an essay of 400-450 words (2-2 pages) on ONE of the following topics. Write downthe NUMBER and TITLE/HEADING of your essay.The goals left behind tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are? why are some organizations more efficient and effective at what they do than others? A plan of a school compound is drawn to a scale of 1cm represent 5m. 1 find its length and breadth of the drawing. If the football field is 50m by 30m. 2 if the scale drawing of the hall is 7cm by 32cm rectangle, find its length and breadth The breakdown of lipids and the breakdown o carbohydrates are similar because they both blank energy Find the measure of XY.Y74NX Two of cryus ideas about government explian how these can be an example for leaders of nations today