Please help!

Identify the highlighted structure.

Please Help!Identify The Highlighted Structure.

Answers

Answer 1

The canaliculi are the highlighted structure. The extracellular matrix is the connective tissue's prominent component.

Which structure has white pulp highlighted?

The white pulp as well as the red pulp make up the human spleen. Its periarterial lymphatic sheathing (PALS) and follicles, two collections of mobile T- and B-lymphocytes, respectively, make up the white pulp.

What layer has been highlighted?

The pia mater of the dermis is the skin layer that is highlighted. The structure that is highlighted secretes sebum. The structure that is highlighted secretes sebum.

To know more about tissue's visit:

https://brainly.com/question/17664886

#SPJ1


Related Questions

3. Circle the words that correctly complete the sentences.
•The individuals selected for breeding have certain traits, which are determined
by [alleles/engineering].
• The alleles for selected traits become [less/more] common in a population as
its genetic diversity [decreases/increases].

Answers

The individuals selected for breeding have certain traits, which are determined by alleles.

• The alleles for selected traits become [more] common in a population as its genetic diversity decreases

What are alleles?

Alleles are different versions of a gene that exist at the same location (locus) on a chromosome. Each individual inherits two copies of each gene (one from each parent), and therefore two alleles at each locus.

Alleles may differ in their DNA sequence, resulting in differences in the physical or functional characteristics of the trait they control. For example, the gene for eye color has different alleles that produce brown, blue, or green eyes.

The combination of an individual's alleles at a particular locus is known as its genotype, and the physical expression of the genotype is called its phenotype.

learn about Alleles here https://brainly.com/question/23516288

#SPJ1

3. The amount of nitrogen in the soil, water, and air have become unbalanced because
a. fish produce too many nitrates.
b. human beings have destroyed too many plants.
c. human beings use too many fertilizers.
d. human beings grow crops that don't use very many nitrates.

Answers

Nitrogen is actually considered the most vital thing for assisting plant growth. Nitrogen is part of the chlorophyll molecule, which gives plant life their green shade and is involved in developing food for the plant thru photosynthesis.

Lack of nitrogen indicates up as familiar yellowing (chlorosis) of the plant.

What are the fundamental motives of nitrogen loss from the soil?

Image end result for three The quantity of nitrogen in the soil, water, and air have turn out to be unbalanced due to the fact a. fish produce too many nitrates. b. human beings have destroyed too many plants. c. human beings use too many fertilizers. d. human beings grow crops that do not use very many nitrates.

Nitrogen can be misplaced from agricultural lands via soil erosion and runoff. Losses thru these occasions commonly don't account for a giant portion of the soil N budget, however should be regarded for surface water fine issues.

Learn more about nitrogen soil, water here;

https://brainly.com/question/20848502

#SPJ1

One way to discourage food sovereignty would be to:
Please choose the correct answer from the following choices, and then select the submit answer button.
Answer choices

promote local control of land, seeds, and other needed agricultural resources.

encourage food growth for export.

value food providers' right to live and work with dignity.

recognize that solutions must be place-based.

Answers

Answer:

Encouraging food growth for export would be one way to discourage food sovereignty

Explanation:

.This is because if the focus is on exporting food, it may lead to a situation where the domestic market is neglected, and food production is not geared towards meeting local needs. This could result in food shortages and make the local population dependent on imported food. In such a scenario, the control over food production and distribution would lie with external forces rather than local communities, which goes against the idea of food sovereignty.

what fluid is found at the base of the petals

Answers

nectar. which is produced in glands called nectaries which are found at the base of flowers. hope this helps :)

Why are two primers necessary for pcr amplification to work?

Answers

Answer:Two primers are utilized, one for each of the complementary single strands of DNA released during denaturation. The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the complementary strand of DNA (the sense strand).

Explanation:

Make a claim related to asthma and pollution. Provide data from your research and provide a reasoning to back up your claim.

Answers

Your lips or nose could let tiny airborne particles into your lungs. Air quality issues are caused by airborne particles, which include haze, smoke, and airborne dust.

Breathing in microscopic particles puts those who have asthma at more risk. Asthma symptoms may worsen as a result of the particles.

More than 23 million Americans suffer from asthma, a dangerous and potentially fatal chronic respiratory condition, which is connected to air pollution. Air pollution can exacerbate asthma symptoms and precipitate asthma episodes.

In order to lessen the health burden associated with the disease, EPA conducts research on the relationship between air pollution and asthma.

Learn more about asthma here:

https://brainly.com/question/8195337

#SPJ1

39. Imagine that you are at the local fitness center and see a bunch of girls from your school. So, you try to impress them by doing bicep "curls". What is the correct sequence for how your nervous system tells your
muscles to move and "curl" the weight?

1.motor neuron-brain-spinal cord-muscle
2. brain-spinal cord-motor neuron-muscle
3.muscle- motor neuron-spinal cord-brain
4.brain-motor neuron-spinal cord-muscle

Answers

The correct sequence for how your nervous system tells your muscles to move and "curl" the weight is:

Brain-spinal cord-motor neuron-muscle; option 2.

What is the correct sequence for how your nervous system tells your muscles to move and "curl" the weight?

The movement of the bicep "curls" is initiated by the brain, which sends a signal down the spinal cord to the motor neuron.

The motor neuron then transmits the signal to the muscles in the bicep, causing them to contract and move the weight.

This sequence of events is known as the motor pathway and is responsible for voluntary movement in the body.

Learn more about nervous system at: https://brainly.com/question/869589

#SPJ1

Unit 9 Study Guide - The Restless Earth Science. I NEED ANSWERS ASAP!!!!!!! PLEASE ANSWER!!! PLEASE HURRY!!!! PLEASE ANSWER ALL 21!!!! THERE ARE 21 QUESTIONS PLEASE ANSWER THEM ALL AS SOON AS YOU CAN!!!!!!!!!!!!!!!!!

Answers

The image is a graph showing the trend of global temperatures over the past century, based on data collected from various sources. The graph indicates that global temperatures have been steadily rising since the 1900s, with the past few decades showing a particularly sharp increase.

What is the graph's primary trend?

The main trend shown in the graph is the steady increase in global temperatures over the past century, with a particularly sharp increase in the past few decades. This trend is a cause for concern as it indicates that the Earth's climate is changing at an unprecedented rate.

What factors contribute to the increase in global temperatures?

The increase in global temperatures is primarily caused by human activities that release greenhouse gases, such as carbon dioxide, into the atmosphere.

These gases trap heat from the sun, leading to a warming effect on the Earth's surface. Other factors that contribute to the increase in global temperatures include deforestation, industrial activities, and transportation.

To know more about global temperatures,visit:

https://brainly.com/question/9089155

#SPJ1

If given: two solutions separated by a semi-permeable membrane. One side is 15% solute and the other is 30% solute. In what direction will water move?

Answers

Answer: Water will likely move to the 30% side to balance out the substance.

Explanation: In osmosis, water always move to wherever there is more solutes so that the solution is balanced out with an equal amount of solutes on both sides of the semi-permeable membrane.

ASAP!!!A scientist designed an experiment to test where a plant's matter came from. She
measured the starting mass of a willow tree, the soil, and the container. After five
years, she repeated the measurements and observed that the tree gained 74 kg (164
lbs) but the soil had not changed much at all (only lost 57 g, approximately 0.12 lbs).
1. Use evidence, from the results, to explain that the idea that the mass of a tree
comes from the soil, is incorrect. 2 points
2. Why is it incorrect to say that the tree's mass comes from sunlight? 1 point
3. If the mass of the tree does not come from the soil or sunlight, explain the trees
increase in mass. 2 points

Answers

Explanation:

The fact that the soil did not change significantly after five years, while the tree gained 74 kg, suggests that the tree's mass did not come from the soil alone. If the tree had gained all its mass from the soil, the soil would have lost an equivalent amount of mass, which did not occur. Therefore, this evidence suggests that the mass of a tree does not come solely from the soil.

While sunlight is necessary for photosynthesis, which allows the tree to produce glucose, the mass of a tree does not come directly from sunlight. Rather, the tree uses the glucose produced during photosynthesis to build its own tissues, such as leaves, branches, and roots. Therefore, while sunlight is necessary for the tree to grow, it is not the source of the tree's mass.

The tree's increase in mass is primarily due to the process of photosynthesis. During photosynthesis, the tree uses energy from sunlight to convert carbon dioxide and water into glucose, which it then uses to build new tissues. Additionally, the tree may have also taken up nutrients, such as nitrogen and phosphorus, from the soil, which it incorporated into its tissues. However, it's important to note that the majority of the tree's mass comes from the carbon that it takes up during photosynthesis, rather than the nutrients in the soil.

What is the purpose of the digestive enzymes found in the synaptic cleft?

Answers

The synaptic cleft does not contain any digesting enzymes. Neurotransmitters are released into the synaptic cleft, a tiny space between neurons, to carry messages from one neuron to the next.

What function do enzymes serve in the synaptic cleft?

Certain neurotransmitters are broken down by synaptic enzymes, which are found in the synaptic cleft. A synapse is the junction of two neurons where neurotransmitters carry information.

In the synaptic cleft, what enzyme is present?

A type-B carboxylesterase enzyme called acetylcholinesterase is largely found in the synaptic cleft, with a minor amount being present in the extrajunctional region. The muscle secretes acetylcholinesterase, which is kept bound to it by collagen linked to the basal lamina.

To know more about synaptic cleft visit:-

https://brainly.com/question/6346282

#SPJ1

06. A deer population increases in size from 2000 to 2300 individuals over one year. Calculate the growth rate of the population during this time interval. (3mks)​

Answers

Answer:

15%

Explanation:

(2300 - 2000) / 2000 = 15%

steps

To calculate the growth rate of the deer population during this time interval, we need to use the following formula:

Growth rate = (final population size - initial population size) / initial population size

Plugging in the given values, we get:

Growth rate = (2300 - 2000) / 2000

Growth rate = 0.15 or 15%

Therefore, the growth rate of the deer population during this time interval is 15%

chatgpt

the relaxed pairing at the blank position of the codon and the blank position of the anticodon are blank and blank to follow the traditional base pair rules. this allows for a single trna to recognize multiple codons.

Answers

The relaxed pairing at the third position of the codon and the first position of the anticodon are wobble and able to follow the traditional base pair rules. This allows for a single tRNA to recognize multiple codons.

Relaxed pairing at the third position of the codon and the first position of the anticodon refers to the ability of the genetic code to tolerate non-standard base pairing between these positions during translation. Specifically, the third position of the codon (also known as the wobble position) can form non-Watson-Crick base pairs with the first position of the anticodon, allowing a single tRNA molecule to recognize and bind to multiple codons that differ only in this position. This phenomenon expands the coding capacity of the genetic code and helps to optimize the efficiency of protein synthesis.

To know more about protein synthesis

brainly.com/question/29763759

#SPJ4

An organism has a total of 32 chromosomes. What is the organism's diploid number? ______ Haploid number ______

Answers

Answer:

16 hap rest

Explanation:

genotype that below indicate where is the heterozygous in AA

Answers

Homozygotes are people having the genotypes AA and aa (i.e., they have two copies of the same allele). Those who have the genotype Aa are heterozygotes (i.e., they have two different alleles at the A locus).

AA could be heterozygous?A gene region where there are two distinct alleles present. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype (compound heterozygote).This is true for polydactyly, achondroplastic dwarfism, and Huntington disease. Heterozygous (Aa) carriers are not healthy individuals. They are affected by the illness in the same way as homozygous dominant (AA) people. being completely normal.

For more information on heterozygous gene kindly visit to

https://brainly.com/question/15267972

#SPJ1

B. Mark True or False statements
4. If all seeds fall under the parent plant they will grow into very healthy plants.

Answers

False

If all seeds fall under the parent plant there will be storage of space for germination of seeds.

Label the following Diagram with the words given

Answers

(a) Sunlight, (b) photosynthesis, (c) chloroplasts, (d) sugar, (e) chlorophyll, (f) carbon dioxide, (g) cellular respiration, (h) mitochondria

Explain the process of photosynthesis?

Photosynthesis is the process by which green plants and other organisms use sunlight, carbon dioxide, and water to produce oxygen and glucose (a type of sugar). This process is essential for the survival of plants and other organisms that depend on them for food and oxygen.

It is a process by which plants, algae, and some bacteria convert light energy into chemical energy in the form of glucose. This process takes place in chloroplasts, which are organelles found in plant cells. The energy from sunlight is used to split water molecules into oxygen and hydrogen ions. The hydrogen ions are used to produce ATP, which is a type of energy currency for cells.

Carbon dioxide from the air is also taken up by the plant and used to create glucose through a series of chemical reactions. Glucose is then used by the plant for energy or stored as starch. In summary, photosynthesis is a complex process that enables plants to create their own food and is essential for life on earth.

Learn more about photosynthesis here:

https://brainly.com/question/29764662

#SPJ1

A gene is a segment of DNA that determines all of part of a trail. How does the nucleotide sequence of a gene compare
to that of an entirely different gene ?

Answers

Answer:

Explanation:

The nucleotide sequence of a gene can be very different from the nucleotide sequence of an entirely different gene. Each gene has a unique sequence of nucleotides that determines the specific instructions for making a particular protein or RNA molecule. The sequence of nucleotides in a gene determines the order of amino acids in the protein or the sequence of bases in the RNA molecule. This sequence of nucleotides can vary widely between different genes, even within the same organism. However, there may also be similarities or conserved regions between genes that encode similar proteins or have similar functions, indicating a shared evolutionary history. In general, the nucleotide sequence of a gene is specific to that gene and is distinct from the nucleotide sequence of any other gene.

The basic unit of life is a cell. A student is studying for an exam comparing structure and functions of a plant cell and an animal cell. The student has to be able to identify the different organelles and the most likely location. Which type of proposed model would be best for the student to utilize in their studies and why?

A) The student should utilize a mathematical model comparing the percent of types of organelles in each so that they understand
the amount in each type of cell.
B) The student should utilize a hand-held size physical model of each type of cell so that they are able to see and compare the types
and locations of the organelles and how the organelle’s functions relate.
C) The student should utilize microscopic slides with real animal and plant cells so that they are able to identify the organelles and
location in a real cell and not a pretend one.
D) The student should utilize a model of the human body and plant so that they can understand how the cells of each type work with
the rest of the structure.
E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type
of cell is better.

Answers

Answer: E) The student should utilize a conceptual model that differentiates between the animal cell and plant cell in general and which type

of cell is better.

Explanation:

Structurally, plant and animal cells are very similar because they are both eukaryotic cells. They both contain membrane-bound organelles such as the nucleus, mitochondria, endoplasmic reticulum, golgi apparatus, lysosomes, and peroxisomes. Both also contain similar membranes, cytosol, and cytoskeletal elements.

Both animal and plant cells have mitochondria, but only plant cells have chloroplasts.

Animal cells have centrioles, centrosomes (discussed under the cytoskeleton), and lysosomes, whereas plant cells do not. Plant cells have a cell wall, chloroplasts, plasmodesmata, and plastids used for storage, and a large central vacuole, whereas animal cells do not.

The different types of plant cells include- collenchyma, sclerenchyma, parenchyma, xylem, and phloem.

What is speciation? Describe the three things required.

Answers

Speciation is the evolutionary process by which new species arise from existing ones.

What is speciation?

Speciation occurs when a group of organisms becomes reproductively isolated from the rest of their population, preventing gene flow between the two groups.

There are three key requirements for speciation to occur:

Genetic isolation: This occurs when a group of individuals becomes separated from the rest of their population, either geographically or ecologically, and is prevented from interbreeding with them. This can lead to the accumulation of genetic differences between the two groups.

Genetic divergence: Once genetic isolation occurs, the two populations can begin to evolve separately. This can happen as a result of genetic drift, natural selection, or other evolutionary mechanisms, leading to the accumulation of genetic differences between the two groups.

Reproductive isolation: Over time, the genetic differences between the two groups may become so pronounced that members of the two populations are no longer able to interbreed successfully, even if they are brought back into contact with one another.

Learn more about speciation at: https://brainly.com/question/2113835

#SPJ1

Circle the correct words to complete the sentences.
• Human insulin is now made with a biotechnology called [genetic
engineering/selective breeding].

• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell.

•After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin.

Answers

Answer:

Human insulin is now made with a biotechnology called [genetic engineering/selective breeding]. (Genetic engineering)

• After scientists [copy/remove] the gene for insulin from a human cell, the gene is inserted into the DNA of [a bacterial/another human] cell. (Copy, a bacterial)

• After the combined DNA is placed inside a [bacterial/human] cell, it becomes a [bioreactor/transgenic] organism that makes human insulin. (bacterial, bioreactor)


PLEASE HELP IM STUCK

Based on his pea-plant data, which three conclusions did Mendel reach? A. The alleles for a particular gene are inherited independently of each other. B. Parents pass some kind of factor to their offspring during reproduction. C. DNA is the substance that carries inherited information from parents to offspring. D. Dominant alleles mask recessive alleles.​

Answers

Based on his pea-plant data, Mendel reached the following three conclusions:

A. The alleles for a particular gene are inherited independently of each other.

B. Parents pass some kind of factor to their offspring during reproduction.

D. Dominant alleles mask recessive alleles.

Mendel did not know about DNA, as it had not yet been discovered. Instead, he referred to the "factors" that were passed down from parents to offspring. Later, scientists discovered that these factors are genes made up of DNA.

What is DNA?

DNA (Deoxyribonucleic Acid) is a molecule that carries the genetic instructions used in the growth, development, functioning, and reproduction of all living organisms and many viruses. DNA consists of a long chain of nucleotides, which are the building blocks of the molecule. Each nucleotide is made up of a sugar molecule (deoxyribose), a phosphate group, and a nitrogenous base.

The four types of nitrogenous bases found in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). The sequence of these bases along the DNA chain forms a genetic code that is responsible for the traits and characteristics of an organism. DNA is found in the nucleus of eukaryotic cells and in the cytoplasm of prokaryotic cells.

To know more about DNA, visit:

https://brainly.com/question/264225

#SPJ1

30. What is the potential where a cell membrane must be more positive than negative to initiate an impulse?

A.action potential
B.stimulus
C.threshold potential
D.membrane potential

Answers

The threshold potential is the value at which a cell membrane must be more positively charged than negatively charged in order to produce an impulse.

Threshold potential

The threshold potential is a crucial depolarization level that must be attained in order for a neuron to initiate an action potential or nerve impulse.

Voltage-gated ion channels in the membrane of a neuron open when the membrane potential reaches the threshold potential, enabling an influx of positively charged ions into the cell.

The result is a fast depolarization of the cell membrane, which generates an action potential that travels the entire length of the neuron.

It's crucial to understand that the threshold potential varies depending on the kind and location of the neuron, in addition to other elements like temperature and the presence of toxins or medications.

learn more about impulse here

https://brainly.com/question/477839

#SPJ1

Do you think the adaptations of the animal you chose are a result of its environment, genes, or both? Explain your answer.

Answers

Answer:

The adaptations are result of both the environment and genes. Animal develop adaptive characteristics in response to their environmental challenges. These adaptations help the animals survive in their environment. The animals are more likely to reach reproductive age. So,these adaptive traits are more likely to be passed on to offspring.In the case of cheetahs,tan coloring,conservation of water, and fast legs are traits that help them survive in the savanna. These traits,like all the other characteristics of cheetahs,are genetically passed from parents to offspring.

Explanation:

if it helped you please mark me a brainliest :))

-. Two genes-pointy-ness of chin and pointy-ness of nose-have the following
alleles: P = pointy chin, p = round chin, N = round nose, n = pointy nose. A man
with a pointy chin and pointy nose mates with a woman with a round chin and
ound nose and produces a child with a pointy chin and round nose. What are all
he possible genotypes for this child?


2. Inhumans, short fingers (F) and widow's peak (W) are dominant over long
ingers (f) and straight hairline (w). A heterozygote for both genes reproduces
with a similar heterozygote. What is the chance of any one child having the same
phenotype as the parents?

Answers

The possible genotypes for the child are: Pn and pn from the descriptions in the question.

What are the possible genes?

To determine this, we can use a Punnett square. The man has the genotype PPnn (pointy chin and pointy nose), and the woman has the genotype ppNN (round chin and round nose).

The offspring genotype possibilities are PNn, PnN, Pnn, and pnn. However, we are told that the child has a pointy chin and a round nose, so the only possible genotypes for this phenotype are Pn and pn.

Therefore, the child could have the genotype Pn (pointy chin, round nose) or pn (round chin, pointy nose).

Learn more about genes:https://brainly.com/question/8832859

#SPJ1

Transcribe and translate the following strands of DNA. Then answer the questions about protein synthesis.

1. DNA: TACCATCGATTGGAAGACCTTAACGAGCTAACT
mRNA:
amino acids:


2. DNA: CTGTTACTTTCAATCGTACACCAACACTGCTTTC
mRNA:
amino acids:

Answers

Answer:

so I don't know this one but will tell you how to solve it.

Explanation:

During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.

In dragons, blue horns
(B) are dominant to
yellow horns (b).
What percent of these
offspring would have
yellow horns?

50%
75%
0%
25%

Answers

The answer is 25 percent

Site-specific recombination is catalysed by:


DNA polymerase


Integrases


Gyrases


Topoisomerases

Answers

Answer: B

Explanation:

Site-specific recombination is catalyzed by integrases.

Which describes this landform?

anticline
shearing
syncline
tension

Answers

Answer:

since there is no picture we cannot help you but ive seen this question before with a picture and it was C. syncline

Explanation:

Answer: c. syncline

Explanation:

Definition: Meat extract, Yeast extract, Peptone (pepsic, tryptic and papainic), Agar-Agar ,gelatin Please help me necessary

Answers

Answer:

Explanation:

Meat extract: Meat extract is a concentrated meat stock that is made by boiling meat in water and then straining out the solids. The resulting liquid is then further processed to produce a thick, flavorful extract that is used as a base for soups, gravies, and other dishes.

Yeast extract: Yeast extract is a natural flavoring made from yeast cells that have been broken down using enzymes or heat. It is commonly used as a flavoring agent in soups, stews, sauces, and other savory dishes.

Peptone: Peptone is a complex mixture of amino acids that is produced by the partial hydrolysis of proteins. It is commonly used as a nutrient source in microbiology and biotechnology applications.

Agar-Agar: Agar-Agar is a gelatinous substance derived from red algae. It is commonly used as a gelling agent in food and pharmaceutical products.

Gelatin: Gelatin is a protein that is derived from collagen, which is found in the connective tissue of animals. It is commonly used as a gelling agent in food products such as jellies, marshmallows, and gummy candies.

Other Questions
when people develop explanations of behavior based on things outside the person's control, this is known as a(n) QuestionInnate immunity involves all exceptAAnatomical barriersBPhagocytic barriersCInflammatory barriersDAntibody production All income that a business receives over a period of time is called profit. True or false? What is the importance of intersectionality framework? Which best describes a social democracy?a country where industry is in private hands and military forces control the governmenta country where the government controls the economy but allows free elections and other civil libertiesa country where the government controls the economy and bans free elections and other civil libertiesa country where most workers live in communes and share goods and property alicia is leading a task force on increasing customer satisfaction. she takes the time to learn about her teammates views and suggestions and incorporates their input into her final decision. Escribe textos cortos con cada una e las funciones de la comunicacin estudiadas en esta gua? por favor ayuda es para maana Which of the following describes how air resistance affects the motion of a falling object? (15 points) JUST PLS HELP MEResponsesAir resistance may change the direction of a falling object but does not affect its speed.Air resistance opposes the force of gravity and causes an object to reach terminal velocity.Air resistance opposes the force of gravity and causes falling objects to lose speed once they reach terminal velocity.Air resistance works with gravity to pull a falling object toward the Earth kevin's father age is 5 years more than three times kevin's age. find kevin's age , if his father is 44 years old the objective of statistical process control (spc) is to question 38 options: 1) determine whether a batch of raw materials should be accepted or rejected 2) determine whether a batch of finished goods should be accepted or rejected 3) detect assignable cause variations versus normal random variations in the process 4) identify variable versus attribute measures history of america and it's culture If three coins are flipped, what is the probability of two heads and a tail coming up in anyorder? Justify your answer by constructing a sample space using an organized list or a treediagram (or both). How is voting a responsibility as well as a right?A) To keep the government truly representative each citizen has a responsibility to vote.B) If you dont vote there are penalties.C) Voting is required by law.D) If you are a member of a political party you must vote or lose your membership. Find the solution set for the following system graphically:2\3x+4 = y and y < 4x Box A has a length of 12 cm, width of 3 cm, and height of 5 cm. Box B is placed on top of Box A with length of 3 cm, width of 3 cm, and height of 3 cm. Box C is to the side of the other two boxes with length of 3 cm, width of 3 cm, and height of 3 cm.Part A. Tisha is putting boxes together to make an art project. She has already put two boxes together. What is the volume of the two boxes, A and B, that Tisha put together? A. 189 cm3 B. 207 cm3 C. 288 cm3 D. 519 cm3 HELP PLEASE I NEED IT BY TOMORROW photo attached POR is a right-angled triangle.Rx18 cm15 cm(b) Work out the size of the angle marked x.Give your answer correct to 1 decimal place.Q What is the area of this parallelogram? given that the lead time from the taiwan factory is 8 weeks, how much safety inventory does epson require in europe if it targets a csl of 95%? Write the standard equation for the hyperbola graphed above.