PAST DUE PLEASE ANSWER. Which European country controlled the most territory in the Americas?
France
Spain, France, and England all had the same amount of control.
Spain
England

Answers

Answer 1

Answer:

During the war of 1812, Spain controlled the most territory in the Americas.

Explanation:

Answer 2

Answer:

Spain, France, and England all had the same amount of control.

Explanation:

Spain would start as the owner of the most territory, but France soon had Canada and the middle of the continent. England would colonize the Atlantic seaboard. It appears that Spain no longer had more land than the others, and all had equal amount of control.


Related Questions

1. What does the rule of law mean?


2. How does the rule of law protect Citizen?


3. How does the rule of law impact lawmakers and courts? i will give brainliest if anyone answer this the right way

Answers

Answer:

1. Rule of law is a principle under which all persons, institutions, and entities are accountable to laws that are: Publicly promulgated. 

2. The laws are clear, publicized, and stable; are applied evenly; and protect fundamental rights, including the security of persons and contract, property, and human rights. 

3. don't know.

How did the Umayyads invade the Iberian Peninsula in the 700s?
O They used land routes in Europe.
O They moved there from Asia in the east.
O They came from the west and from Portugal.
O They crossed the Mediterranean Sea.

Answers

Answer: a

Explanation: you probably already answered but to the other people who need it! I hope this helps

Answer:

The answer that you are looking for is aaaaaaa

Explanation:

or you can say A:They used land routes in Europe.

;0

3. By the end of Act II, Hamlet realizes he’s been betrayed. What should he do now that he has discovered the deception?
5. Assume you are Hamlet and have just read the communication from Claudius to the King of England. Rewrite the message which Hamlet sends instead.
6. How did you feel about the ending of the play? Why?
ANSWER IN 5-7 SENTENCES PLEASE ILL GIVE YOU 20 POINTS

Answers

Answer:

The next day at Elsinore Castle, Hamlet tells Horatio how he plotted to ... He has come to tell them that Claudius wants Hamlet to fence with Laertes and that ... Laertes for forgiveness, claiming that it was his madness, and not his own will, that ... They select their foils (blunted swords used in fencing), and the king says that if ...

Explanation:

Middle East Partition crossword puzzle

Answers

i cant solve unless i can see the puzzle! :)

in the early to mid 1800s, as compared to today, newspapers were

A. more partisan
B. Less partisan
C. about the same in terms of partisan
D. not partisan at all

Answers

Answer:

A.More Partisan

Explanation:

they used them more than they do now because they didnt have Social Media so that was their only way of knowing the news

In the early to mid 1800s, as compared to today, newspapers were more partisan, as the people get news from the newspaper.

What is the difference in reading style of today's newspaper verses then newspaper?

Before Newspaper is considered as the only sources of news and spread awareness about anything is the main reason of popularity of newspaper, but now there are many other sources of news so the popularity of newspaper decreased.

Thus, option A is correct.

For more information about Newspaper, click here:

https://brainly.com/question/21528399

#SPJ2

Luther’s 95 Theses was primarily addressing which abuse of the Catholic Church?

Answers

Answer:

Born in Eisleben, Germany, in 1483, Martin Luther went on to become one of Western history's most significant figures. Luther spent his early years in relative anonymity as a monk and scholar. But in 1517 Luther penned a document attacking the Catholic Church's corrupt practice of selling “indulgences” to absolve sin.

Explanation:

Why was there public support for Nathaniel Bacon's rebellion?

Answers

Answer: Bacon's followers used the rebellion as an effort to gain government recognition of the shared interests among all social classes of the colony in protecting the "commonality" and advancing its welfare

Explanation:

Which conclusion is BEST supported by the data in the graph?

A) Over the years, schools have succeeded in consistently lowering dropout rates for all students.
B) Schools must do more to lower dropout rates, especially for African-American and Hispanic students.
C) Schools have worked hard to keep dropout rates lower for African-American and Hispanic students than for white students.
D) After dropout rates reached a peak in 2000, schools worked harder to help students from all ethnic backgrounds graduate from high school.

Answers

The answer is B. All other answers relating to the graph would be incorrect with the information given

Answer:

b

Explanation:

my reson being that while the white and hispanic student dropout rates lowerd black students dropout rates continued to rise. aswell as the other lowerd but hispanic still has a long way to to be a normal rate.

1. What is Newton's universal law of gravitation?
2. How would such a law make the universe seem
like a machine?

Answers

Answer:

1.Newton's law of universal gravitation is usually stated as that every particle attracts every other particle in the universe with a force that is directly proportional to the product of their masses and inversely proportional to the square of the distance between their centers.

2.Both saw the universe as a vast machine operating by mechanical laws of ... Newton felt that this machine would, if unattended, operate somewhat imperfectly. ... God made the universe machine, set it running, and it would run perfectly ... would recur many times, and such questions were at the heart of the theory of relativity

Determine whether the following effects were the result of trade expansion in Italy or the Crusades.

A) Industries such as shipping,
manufacturing, and banking
developed and flourished.

B) Wealth increased, allowing
people to sponsor talented
artists and scholars.

C) People lost faith in the church
and turned their attention
from the divine to the
human world.

D) Europeans interacted with
foreign cultures of the East
and became aware of new
ideas and experiences.

Answers:
Trade Expansion: A and B
Crusades: C and D

I hope this helps.

Answers

Answer:

Trade Expansion:

✔️A) Industries such as shipping, manufacturing, and banking developed and flourished.

✔️B) Wealth increased, allowing people to sponsor talented artists and scholars.

Crusades:

✔️C) People lost faith in the church and turned their attention from the divine to the human world.

✔️D) Europeans interacted with foreign cultures of the East and became aware of new ideas and experiences.

Explanation:

During the trade expansion, industries were developed and they also flourished. Some of the industries that were greatly impacted are the shipping (because these were the point were goods came from other countries), manufacturing and banking (the growth of banking houses). There was increase in wealth as people made money from the trade.

During the crusades, the church was growing in political power through their militaristism actions. This made people to start doubting the spiritual state of the church. Also, as diseases broke out, the church could not profer solutions to the problems. This led to people "losing faith in the church". At this time too, there was new experiences and ideas people learnt.

Answer:

Yes, this picture in the answer is the answer for Plato

Explanation:

I'm in Plato


New Jersey was named after the island of Jersey, where the proprietor Sir George Carteret was born. Where is this island?

Answers

St. Helier, Jersey, Channel

what important event occurred at appomattox court house in 1865​

Answers

Answer:

The Battle of Appomattox Court House was fought on April 9, 1865, near the town of Appomattox Court House, Virginia, and led to Confederate General Robert E. Lee's surrender of his Army of Northern Virginia to Union General Ulysses S.

Explanation:

I hope this helps!! ;))

What was the name of the essays written by the anti federalists to convince others not to ratify the constitution

Answers

Answer:

The Anti-Federalist Papers

Explanation:

That is what popped up when I googled it.

What name did Sir Robert Montgomery give Georgia?
Georgia
Fort King George
Guale
Azilia

Answers

Answer:

Explanation:

the Margravate of Azilia

In 1717, sixteen years before Georgia was founded, Sir Robert Montgomery proposed the creation of the Margravate of Azilia.

Which two inventions increased jobs for women
A( Phonograph & Typewriter
B( Steel & light bulb
C( electricity & telephone
D( Telephone & typewriter

Answers

Answer:

a

Explanation:

because thats the only thing women could do

Which two challenges did farmers face following the Civil War?

Answers

overproduction of crops, tariffs, and the change in the monetary system to just gold made farming very tough after the Civil War. Farmers came together by forming the Farmer's Alliance and the Granger movement.

Which of the following was a factor that contributed to the formation of the People’s Party in 1891?
Farmers wanted to own their own banks and railroads.
Farmers wanted well-paying jobs with large businesses.
Farmers wanted higher commodity prices and shipping costs.
Farmers wanted a political party that represented their interests

Answers

Answer:

B

Explanation:

edge 2020 >:)

ig : d4me597 ;)

Answer:

its D

Explanation:

edge 2021 :)

The principle of checks and balances limits government power by:
A. making sure that laws apply to leaders and common citizens.
ООО
O B. requiring citizens to vote to approve all laws passed by Congress.
C. preventing the government from taking certain freedoms away
from citizens.
O D. giving each branch of government some power over the others.

Answers

Answer:

D. giving each branch of government some power over the others.

Explanation:

Each branch being able to check the power of other branches stops one form of government from taking to much power and pulling rights from the people.

Answer:

D

Explanation:

Why are there less organisms as you move up the pyramid?

Answers

Answer: As we go further along a food chain, there are fewer and fewer consumers. The further along the chain you go, the less food (and hence energy) remains available. In other words, a large mass of living things at the base is required to support a few at the top

Because the organisms on top of the pyramid are what feed off of the ones more bottom on the food scale, the organisms on top are the main compatetors

A chart is a type of graph

Answers

Yes it A chart is a graphical representation of data, in which "the data is represented by symbols, such as bars in a bar chart, lines in a line chart, or slices in a pie chart". ... A data chart is a type of diagram or graph, that organizes and represents a set of numerical or qualitative data.

How did the Crusades weaken the Byzantines

Answers

They lost control of trade and most of their wealth.

Answer:

The Crusades, which were first created for the objective of not only recapturing Jerusalem for Christianity, but also to protect the failing Byzantine Empire, weakened the Byzantium empire considerably. They were hailed as saviors of Christianity and was given open doors, but they instead looted the already poor Byzantium Empire of whatever treasures they owned. They also destroyed parts of the wall and significantly reduced the population through murderings in the streets.

~

How were you able to identify which period does each song represent?

Answers

Hi, you've asked an incomplete question. However, I only answered from a general musical perspective.

Answer:

Listening to know the type of genre.

Explanation:

Usually, the period of a song is categorized as either a modern or old school song. For example, modern-day songs are often in the Hip-Hop and Rap genres. While songs in other periods (old school) are often in the Blues and Jazz genres.

You can tell the period a song is from based on what type of music it is.

Every age has had genres that defined the era such that they are synonymous with those times.

The song genre is therefore your best way to tell what period the song is from - unless of course, the lyrics mention the period.

For instance, the popular genres in different periods were:

1920s ⇒ Jazz, Blues and Dance 1940s ⇒ Jazz, Swing, Country 1960s ⇒ Folk, diggerent genres of Rock1970s ⇒ Disco, Dance, Rock, Punk 1980s ⇒ Pop, Metal, Hip-hop1990s ⇒ Grunge, Hip-Hop, Gangster rap, Pop

In conclusion, the type of music will give the best clue as to the period the song is from in absence of better chronological measures.

Find out more at https://brainly.com/question/14118225.

Why did the Spanish build mission and forts (presidios) in Texas?

Answers

Answer:

To spread religain

Explanation:

Which original plan inspired the creation of the Senate?

Answers

Answer: Edmund Randolph said that there should be Congress. He also said that Congress should be bicameral, meaning it has two branches. William Paterson also supposed something similar.

What was the 15th amendment to the constitution and how did it contribute to the new freedoms black men were experiencing?

Answers

Answer:

Image result for What was the 15th amendment to the constitution and how did it contribute to the new freedoms black men were experiencing?

The 15th Amendment granting African-American men the right to vote was adopted into the U.S. Constitution in 1870. Despite the amendment, by the late 1870s discriminatory practices were used to prevent blacks from exercising their right to vote, especially in the South.

Explanation:

Which map is now recognized as providing the best balance of size, shape, and direction? a.
globe
b.
Winkel projection
c.
Robinson projection
d.
Mercator projection

Answers

Answer:

d. ) Mercator projection

Explanation:

A Mercator projection is now recognized as providing the best balance of size, shape and direction.

Which term best describes the type of labor most enslaved workers performed in Georgia

Answers

Answer: skilled (D)

Explanation:

The longest and most severe oppression of Israel was that of the:

Answers

The answer is Philistines

Which year is older, or happened first?

A. 2020
B. 470
C. 5000 B.C.
D. 500 B.C.

Answers

Answer: 470 i’m guessing

Explanation:

Answer:

C.

Explanation:

Think of it as a number line.  Anything before the year 0 will be labelled as B.C. The higher the number (labelled as B.C.) the older it is. So 5000 B.C. happened before 500 B.C.

Which battle proved to the French that the Americans could win the Revolutionary War? (5 points) a Cowpens b Yorktown c Saratoga d Trenton

Answers

Answer:lemme see

Explanation:

Answer:

C. Saratoga

Explanation:

Other Questions
what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets why are Hispanics not a race in the u.s but only defined as ethnicity? Leann is learning about chemical reactions. She wants to create a model of a chemical reaction, so she is examining the information that she should include. What are the different components that she should include in her model? Choose the three that apply.A.the kinds of atoms that form during a reactionB.the kinds of molecules involved in the reactionC.the kinds of elements that make up a moleculeD.whether the molecules are products or reactantsE.whether the products have more mass than the reactants which part of the government according to the constitution, should be made up to two representatives per state? (Apex) A. the senate B. congress C. the Articles of confederation D. the House of representatives