Part of a critique that points out the main objective of a work

Answers

Answer 1
To critique a piece of writing is to do the following:

describe: give the reader a sense of the writer’s overall purpose and intent
analyze: examine how the structure and language of the text convey its meaning
interpret: state the significance or importance of each part of the text
assess: make a judgment of the work’s worth or value
FORMATTING A CRITIQUE
Here are two structures for critiques, one for nonfiction and one for fiction/literature.

The Critique Format for Nonfiction
Introduction

name of author and work
general overview of subject and summary of author's argument
focusing (or thesis) sentence indicating how you will divide the whole work for discussion or the particular elements you will discuss
Body

objective description of a major point in the work
detailed analysis of how the work conveys an idea or concept
interpretation of the concept
repetition of description, analysis, interpretation if more than one major concept is covered
Conclusion

overall interpretation
relationship of particular interpretations to subject as a whole
critical assessment of the value, worth, or meaning of the work, both negative and positive
The Critique Format for Fiction/Literature
Introduction

name of author and work
brief summary/description of work as a whole
focusing sentence indicating what element you plan to examine
general indication of overall significance of work
Body

literal description of the first major element or portion of the work
detailed analysis
interpretation
literal description of second major element
detailed analysis
interpretation (including, if necessary, the relationship to the first major point)
and so on
Conclusion

overall interpretation of the elements studied
consideration of those elements within the context of the work as a whole
critical assessment of the value, worth, meaning, or significance of the work, both positive and negative
You may not be asked in every critique to assess a work, only to analyze and interpret it. If you are asked for a personal response, remember that your assessment should not be the expression of an unsupported personal opinion. Your interpretations and your conclusions must be based on evidence from the text and follow from the ideas you have dealt with in the paper.

Remember also that a critique may express a positive as well as a negative assessment. Don't confuse critique with criticize in the popular sense of the word, meaning “to point out faults.”

Related Questions

Can someone help?
"Well, clinging to the side like that is not going to get you any further," Mac replied.
What does the word clinging suggest about Rashmi?

A) She is very physical.
B) She looks desperate.
C) She remains hopeful.
D) She seems in control.

Answers

B. She looks desperate

The part of speech helps determine
~how to use a word
~the job of the word in a sentence
~what the author meant
~the purpose of the writing
Please help

Answers

Answer:

B

Explanation:

it tells what word works it in

Answer:

how to use a word, the job of the word in a sentence

Explanation:

Possessive Pronouns
My Their it's
Your Mine ours
His Yours theirs
Her Hers our

We bought the house last year. It is ____​

Answers

The correct answer is ours.

What does the idiom “tipped off his rocker” mean?

Answers

Answer:

if you say that someone is off their rocker it means that person is behaving in a strange matter or a very silly way

Answer:

It could mean a person has gone astray from sanity.

The Flight of Icarus Compare and Contrast Paragraph.
write a paragraph about "The Flight of Icarus".

Answers

The story of Icarus is one of those legends of Greek mythology that fascinates audiences especially because of the character’s desire to go beyond human boundaries as well as for the tragic consequences this brought about.
The myth of Daedalus and Icarus tells the story of a father and a son who used wings to escape from the island of Crete. Icarus has become better-known as the flyer who fell from the sky when the wax that joined his wings was melted by the heat of the sun.
The legend of the mythological Icarus is closely related to a number of other narrations centered on Crete, the place where Dedalus worked as a craftsman and built a maze to keep the feared Minotaur under control.
The tragic fall of Icarus begins with his father, in fact, he suffered and paid for Daedalus deeds.

Why might people be too afraid to act in a situation where help is needed?


i need this for today

Answers

(Sorry if this doesn't help or is hard to understand-)

Explanation:

Every person is different and have a mind of their own, so their reaction will be different from others depending in the situation. Each and every one of them have a fear of something, even if they don't want to admit it, something is always bothering them at the back of their minds.

And if one of their fears (such as; embarrassment, failure, abandonment, or death) is present in the situation at hand, they will freeze up and not know what to do. The human mind is something strange and it can be difficult to understand how someone, or yourself, feels about something and cause them, or you, not know what else you could do to help.

Fear can cause someone to not do something they desperately want or need to do, especially if the events are moving to fast for them to understand and makes them panic, sometimes even leading them to worry too much if it's their fault that they couldn't help.

What is the theme of The Spider and the Fly by Mary Howitt

Answers

Answer:

The theme of "The Spider and the Fly" is that people should not allow themselves to be manipulated by others who prey on their vanity. In the poem, the spider first tries to inveigle the fly into entering the spider's house by telling the fly how comfortable his parlor is and how welcoming he will be to the fly.

Choose the word that best replaces the underlined word in the sentence.

What elements of our society have contributed to this insane trend?
a.
factors
c.
degrees
b.
building blocks
d.
things


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

It is unclear what the underlined word is supposed to be, but if it is "elements" then the answer would be A. factors.

I assume that the word is supposed to be elements

The man walked down three flights of stairs to access the subterranean railway.

What is the best definition of subterranean?


rapid

beneath the ground

interconnected

well traveled

Answers

Answer:

B

Explanation:

It describes a man walking downward to reach the railway, also sub means below and terranean means ground

Beneath the ground: is the best definition of subterranean. Thus, option B is the correct option.

What is the meaning of subterranean?

An adjective that depicts anything just below the surface is subterranean, such as the subterranean resentment you conceal behind a smile and good words for the actor who landed the role you sought. You keep "on the down low" your intents and subterranean sentiments. In actuality, subterranean items are actually underground and down low. A subterranean worm resides below the surface of the earth.

A subterranean lair is a hidden hiding place dug under the ground, or it might be your basement. The Latin subterraneous, from sub meaning "beneath" and terra meaning "earth," is whence the word subterraneous originates.

Example: A subterranean river or tunnel is under the ground. The city has many subterranean passages.

Learn more about subterranean here:

https://brainly.com/question/20621640

#SPJ3



9- "The War Of The Worlds" narrator has a name, people called him Jiff.


True or false

Answers

false it was  Richard Burton

The War Of The Worlds narrator is not called Jiff.

Can gossip and community storytelling be both good and bad? in Spunk
By Zora Neale Hurston
1926

Answers

Answer:

start with what you know

Explanation:

In Paragraph 37 of Jack
London's "To Build a Fire,"
why does the man stop
running?
A. He trips and falls into the river.
B. He is too tired to run and decides to die
in his sleep.
C. He slows down so his dog can catch up
to him.

Answers

Answer: B. He is too tired to run and decides to die  in his sleep.

Explanation:

In ''To Build a Fire'' a man is traveling in the Yukon in very cold weather with a dog. He attempts to build a fire multiple times but fails each time as the cold and snow snuff it out.

When he predicts that he was nearing death as the cold got worse, he decided to start running in order to get blood circulating around his body but it is too cold and he is too tired so his endurance fails him and he stops running. He now accepts that his death and meets it with perceived dignity by deciding to fall asleep and die from there.

1 How does Jurgis learn about what happened in the canning department
at Durham?
A. By working in the department for several months
B. By reading accounts in the newspapers
C. By talking to workers in that department
O D. By hearing stories from his wife Marija

Answers

A is the answer To your question

How old is Anne at the end of Act 2, Scene 3 in the diary of Anne Frank?

Answers

Answer:

15

Explanation:

This is for tonight can someone help me pls!!!!!!!!

DONT PUT THE LINK THAT EVERYONE IT IS PUTTING

Answers

Answer:

what chapter

Explanation:

pls help
Read the definition. fair n. 1. a gathering of sellers 2. a place to display work, goods, or animals adj. 1. without bias or prejudice 2. pale in color Which sentence correctly uses the word fair according to the first adjective definition? At the book fair, I purchased a well-read and obviously much-loved copy of Jane Eyre. Ned Dodson presented his prized hog at the county fair last Saturday. I expected a fair and impartial reading of the court case, but the judge clearly favored the plaintiff, who just happened to be his golfing buddy. My fair, freckly cousin slathered on a thick layer of sunscreen before heading to the beach.

Answers

Answer:

pale in color!

Explanation:

"My fair, freckly cousin slathered on a thick layer of sunscreen before heading to the beach."

Answer:

I expected a fair and impartial reading of the court case, but the judge clearly favored the plaintiff, who just happened to be his golfing buddy.

Explanation:

I took the K12 test, i got all of them correct.

what the words 'inspired to see NO CHILD WITHOUT' written in a larger,bold front?​

Answers

Answer:

probs to get the readers attention

Explanation:

what does this events suggest about the turtles capacity to defend itself

Answers

I don’t know but please let me know :)

Active readers eliminate distractions and ask questions as they read.

True Or False?

Answers

Answer:

true

Explanation:

if you ask questions while you read it helps you understand it better or something like that

What is Life what if the meaning of life

Answers

Answer:

Your life purpose consists of the central motivating aims of your life—the reasons you get up in the morning. Purpose can guide life decisions, influence behavior, shape goals, offer a sense of direction, and create meaning.

Explanation:

Answer:

42

Explanation:

Can I add pictures into these things for people to answer? Im lazy, no offense.

Answers

Answer:

Yes!

Explanation:

Comedians use racial stereotypes all the time as the basis for jokes. Comedians such as Chris Rock and George Lopez use humor to point out the senselessness of our attitudes toward race. Are these jokes always racist, or do they help people better understand important issues in our multicultural society? Now think about what you see in your own life. Do you hear jokes about race at school?​

Answers

Answer:

yes

Explanation:

very sad..... its pretty hard to be funny when your topic of comedy is about race

HELP ASAP I NEED IT TURNT IN TODAY WILL GIVE BRRAINLEST

Answers

Answer:

C.quotations from people who have seen the art

Bless me ultima Chapters 12-13
Which of the following best explains what Antonio discovers about his brother Andrew?

A. Antonio discovers that Andrew is in league with Tenorio.

B. Antonio learns that Andrew is a regular client at the brothel.

C. Antonio learns that Andrew has a drug problem.

D. Antonio discovers that Andrew steals from the market where he works.

Answers

It is = c deeedjdjdjfjfjfhfhbdkd

(PLEASE HELP I BEG YOU!!!!!!) "There will come soft rains" what is the importance of paragraphs 10, 11, and 12?

Answers

Ten o’clock. The sun came out from behind the rain. The house

stood alone in a city of rubble and ashes. This was the one house left

standing. At night the ruined city gave off a radioactive glow which

could be seen for miles.

Ten-fifteen. The garden sprinklers whirled up in golden founts,

filling the soft morning air with scatterings of brightness. The water

pelted windowpanes, running down the charred west side where the

house had been burned evenly free of its white paint. The entire west

face of the house was black, save for five places. Here the silhouette1

in paint of a man mowing a lawn. Here, as in a photograph, a woman

bent to pick flowers. Still farther over, their images burned on wood

in one titanic instant, a small boy, hands flung into the air; higher up,

the image of a thrown ball, and opposite him a girl, hand raised to

catch a ball which never came down.

The five spots of paint—the man, the woman, the children, the

ball—remained. The rest was a thin charcoaled layer.

The gentle sprinkler rain filled the garden with falling li

Answer -

The Importance of pargraphs 10, 11, and 12 is that much like how our own alarms ring in a gentle voice to awake us at the start of our day; only the lonely house’s voice echoed across the halls with each passing hour. Upon reaching the first few paragraphs, the narrator reveals the house to have a built in A.I that is able to control every square inch of the house based on the schedule. (Bradbury page 1) But after the first few schedules, there still wasn’t any response from anyone within the house. At eight-thirty the eggs were shriveled and the toast was like stone. (Bradbury page 1 paragraph 11). It has already been over an hour since the first alarm, the warm fresh breakfast still remained untouched. This house was empty, yet despite it being empty, the house is still running it’s daily schedule as it is meant to do.

Brainliest will be appreciated as well.

<
→ Poll the Class: Is the society surviving or thriving? Be prepared to
defend your answer.
A. Surviving
d
B. Thriving

Answers

Answer: at this point in time we are surviving, due to this pandemic we are speedily working to fight off this virus, for us to thrive, first we must survive. The survival of society depends on those within society. We are surviving a world wide pandemic, much less thriving as we were prior to the outbreak.

Hope this helps :)

GUYS THIS IS MY LAST QUESTION AND I DONT KNOW WHAT IT IS. PLS HELP I WILL GIVE BRAINLIEST. I JUST NEED THIS FINAL ONE! AT LEAST COME LOOK!

5. The novel The Alchemist expressed numerous themes. Which of these phrases is NOT one of those themes?

A) One must learn to accept one's own personal legend
B) Managing chemical imbalances is the key to happiness.
C) Perseverance is essential for finding one's purpose in life.
D) Learning to have faith is a key part of learning how to live.

Answers

The theme that cannot be found in the Alchemist is B. Managing chemical imbalances is the key to happiness.

What is a theme?

It should be noted that a theme simply means the main idea in a passage. It's simply the underlying message in an article, story, etc.

It should be noted that some of the themes in the Alchemist include learning to accept one's own personal legend, learning to have faith is a key part of learning how to live, etc.

Learn more about themes on:

https://brainly.com/question/11600913

Why does Mattie tell Taylor she’s asking the wrong question when it comes to turtle

Answers

Answer:

Because Taylor is wondering if he can give Turtle the best possible life, but that is impossible. In that case Mattie says the right question is not whether Matie can give Turtle a good life, but whether she is willing to try.

Explanation:

You have not submitted the text to which this question is related. However, by looking at the characters' names and the relationship between them, presented in the question above, we can see that this question is about "The Bean Trees" that tells the story of Taylor, who decides to abandon her local city and embark on a journey of self-discovery. On this journey, she ends up adopting Turtle, a Cherokee boy.

Taylor wants to protect Turtle and give him the best possible life and the most efficient education, but she wonders if she can do it. In this context, Mattie tells her that this question is incorrect, because no one is able to give the best possible life to a person. For Mattie, the correct question Taylor should ask is if she is willing to try to give Turtle the best possible life.

Please help! I’ll MARK you as BRAINLIST
- please rewrite the this sentence below in a basic easy way to understand.
— Well being is very wide ranged construct with mental, physical and social components.
-
Check grammars!

Answers

Answer:

wll being has mental, physical, and social components.

hurry
A diagram showing a beam that is pulled backward and secured to the ground using a rope. The beam is arched and shows tension. Above is a sketch of one of da Vinci’s weapons. What kind of weapon does it look like? a. Cannon c. Missile b. Automated Rifle d. Catapult Please select the best answer from the choices provided A B C D

Answers

Answer:

The answer is letter D the catapult.

Answer:

D. Catapult.

Explanation:

Other Questions
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Un coche inicia un viaje de 450 km a las ocho de la maana con una velocidad media de 90 km/h. A qu hora llegar a su destino? ASAP ONE MORE BRAINLIEST In complete Spanish sentences, answer all of the following questions on the discussion board that deal with what future profession might be good for you. 1) Como es tu personalidad? 2) Que classes te gustan? 3) Que idiomas ( languages) hablas? Which machine do you think will last longer, the traditional battery and motor, or the free energy machine? Please help me guys!!!:) 20 points for correct answer what is 18/5 written as a mixed number please helpppp I'll mark you brainliest PLEASE HELP IM VERY CONFUSED What is the volume of this figure Please help me where is point b on the number line? Compare -|56| to -56 1. Three fluids are poured from a beaker onto a lab table. Fluid A hits the table in 10 seconds, fluid B in 12 seconds, fluid C in 4 seconds, and fluid Din 15 seconds. Which fluid has the highest viscosity?O a fluid AO b. fluid BO c. fluid cO d. fluid D Which of the following is the correct definition for the term phrasal adverb?A. One or more adjectives in sequence that modify the same nounB. A phrase that functions as a unit to modify a nounC. Two or more words that function together as an adverbD. A single word that qualifies a single part of speech Pyramids depicting the number of organisms or biomass may be inverted, upright, or even diamond-shaped.Energy pyramids, however, are always upright. Why? 6In some parts of Alaska, the sun sleeps for two straight months. This is an example of whatfigurative language device? *(1 Point)O Simile.MetaphorO PersonificationHyperbole (A few)_______ apartamentosUnas LasLosUnos