Origina
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTT
mRNA:
AAS:
Mutation 1
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCT
mRNA :
AAS:
Mutation 2
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAGTTCATTTCTTCTT
mRNA:
AAS:
Mutation 3
DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTTTTCTT
mRNA:
AAS:

OriginaDNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGAATTCATTTCTTCTTmRNA:AAS:Mutation 1DNA: CGGACACTGCTCTCCCAAGAGTATCAGTCCTCTTTAGAAGACCTGTAACTCATTTCTTCTmRNA

Answers

Answer 1

Answer:

y is there so much letters?


Related Questions

What is the ecological relationship between the monk seal and the jacks/sharks?

Answers

Answer:

predator and prey

Explanation:

the shark eats the seals in the wild

Answer:

Great white sharks and seals have a predatory relationship where the shark is the predator and the seals are the prey

Both of these populations are part of a larger marine ecosystem where relationships between organisms vary from symbiotic to competitive, parasitic or mutually beneficial

which particles cannot pas through the cell membrane

Answers

Answer:

glucose, charged particles

Explanation:

if you start with one double-stranded dna molecule and you perform six cycles of pcr, how many double-stranded copies of the dna will you have?

Answers

Answer:64

Explanation:

The DNA stands for deoxyribose nucleic acid. The DNA has all the genetic information stored in it that will transfer to the next generation. The DNA is made from the following:-

Deoxy sugarPhosphate groupNitrogenous base

The PCR stands for the polymerase chain reaction. This process its amplify the DNA content and multiply it. The PCR has three steps which are:-

Denaturation.AmplificationAnnealing

According to the question, the DNA amplifies its content by 6 times and the amount of DNA will be 64.

For more information, refer to the link:-

pls help 4-7 35 point ​

Answers

Answer:

sorry i havent learn about this yet

4. The main difference between natural selection and genetic drift is that the natural selection is a process where more adaptive species are selected in response to the environmental challenges whereas genetic drift is a random selection.

the biceps brachii–radius arrangement represents a __________-class lever system.

Answers

Answer:

third

Explanation:

which statement concerning ATP and activity within the cell is correct?

Answers

ATP stands for Adenosine Di Phosphate.ATP is known as power currency of cell It's found in MitochondriaMitochondria is known as power house of cell.

20 points
Cells are classified as prokaryote and eukaryote. If a cell has no nucleus
and no membrane bound organelles, as mitochondria and chloroplasts,
then it is classified as *
A.Eukaryote
B.Prokaryote
C.Endosymbiosis
D.both a and b

Answers

Answer:

B. Prokaryote

Explanation:

Because it does not have a well defined nucleus and bound organelles

Answer:

B

Explanation:

A prokaryotic cell is a simple, single-celled (unicellular) organism that lacks a nucleus, or any other membrane-bound organelle.In prokaryotes, the DNA (chromosome) is in contact with the cellular cytoplasm and is not in a housed membrane-bound nucleus. ... Throughout the course of evolution, organelles such as mitochondria and chloroplasts (a form of plastid) may have arisen from engulfed prokaryotes.

Which term names the types of elements usually found in meteorites?

Answers

Answer: minerals—pyroxenes, olivines, and feldspars—dominate the stony meteorites. Metals—kamacite and taenite—along with small amounts of schreibersite and cohenite dominate iron meteorites. The following list is a short guide to selected minerals found in meteorites.

Explanation:

Answer:

metals

Explanation:

i took the test

carnivores such as a lion are able to kill their prey because of powerful jaw muscles. we humans do not need this power in our jaw muscles. which muscle is more powerful in the carnivore than the human?

Answers

The masseter muscle is more powerful in the carnivore than in humans as they functions vary.

The masseter muscle is present in carnivores such as lion, tiger etc. This jaw muscle help these animals to kill preys as it exerts a biting force of about 25kg when used on them.

They are important muscles for chewing. The muscle is positioned in a  superficial quadrangular manner as a result of it originating from the zygomatic arch and they are also primarily responsible for the elevation and the protraction of the mandibles.

Read more on https://brainly.com/question/25150430

How do cells in an embryo become different types of cells?

Answers

Answer:

The zygote divides into multiple cells in a process known as cleavage, triggering the beginning of embryonic differentiation. During cleavage, the zygote divides but maintains its size in the process. ... Cells in these three layers will give rise to different parts of the organism. The endoderm eventually becomes the gut.

Explanation:

The zygote divides into multiple cells in a process known as cleavage, triggering the beginning of embryonic differentiation. During cleavage, the zygote divides but maintains its size in the process. ... Cells in these three layers will give rise to different parts of the organism. The endoderm eventually becomes the gut.

Help please! Q: Location Three: Select three events that you predict will be observed. If I explore two continental plates at a transform boundary, then I will observe:

A: earthquakes

B: faults

C: ocean formation

D: mountains

E: volcanoes

F: island chains

G: seafloor spreading

Answers

Answer:

Earthquakes, Faults, and Island chains.

Explanation:

There are three types of plate boundary such as Constructive, destructive and transform plate boundary. The primary landform in the Transform boundary are faults which is caused by the Earthquakes. Many transform boundary landforms are in the ocean floor which is responsible for the island formation. Fault is found due to the two process such as Ridge push and ridge pull. Transform boundary neither creates and nor destroys any land in the region.

Why is knowledge and skills important in animal care and breeding? Explain in 3 to 5 sentences.

Answers

Answer:

to be thorough and pay attention to detail.

the ability to use your initiative.

to be flexible and open to change.

patience and the ability to remain calm in stressful situations.

the ability to work well with others.

the ability to accept criticism and work well under pressure.

To be successful as an animal breeder, you should have knowledge of the animal breeding process

a passion for animal breeding,

and knowledge of the potential risks of animal breeding.

Ultimately, a top-notch animal breeder should be an effective communicator, have good organizational skills, and be physically fit.


Kids' behaviors are influenced by which of the following: (Check all that apply)
hormones
social influences
genes
parental influence

Answers

Answer:

parental influence

Ok Its coorrect hope

All of the options  hormones, social influences, genes and parental influence can influence a child's behavior.

What influences child's behavior?

Hormones can play a role in mood and emotional regulation, which can affect behavior. Social influences, such as the behavior of peers and cultural expectations, can also influence a child's behavior. Genes can also play a role in determining certain characteristics and behaviors.

Finally, parental influence, including the way that parents model behavior and teach and discipline their children, can also affect a child's behavior.

Learn more about child's behavior, here:

https://brainly.com/question/29455765

#SPJ2

Which event is an example of condensation?
A. A puddle dries when exposed to the Sun.
B. A lake becomes a skating rink in the winter.
C. Fog forms in a valley.
D. A spilled drop of rubbing alcohol disappears.

Answers

Answer:Fog forms in a valley

Explanation:School

what is the hollow space within the diaphysis of a long bone called?

Answers

Answer:

The hollow region in the diaphysis is called the medullary cavity, which is filled with yellow marrow. The walls of the diaphysis are composed of dense and hard compact bone. ... The outer surface of the bone is covered with a fibrous membrane called the periosteum(peri- = “around” or “surrounding”).

Explanation:

Describe the roles of the liver and the pancreas in the digestion of fats.

Answers

Answer:for the liver this is to produce bile and for the pancreas is to produce pancreatic juices

Explanation:bile helps in the absorption in the ileum and pancreatic juices contain amylase,lypase and peptide

What Is an example of importance for living organisms?
(don¨t answer that unless you want to)

Is it me or is every freaking thing we post, it gets deleted?
like dam.n what we do? were just living.
anyways, how are y´all doing?

Answers

Answer:

Ikr it's not fair anyways I would answer your question but I'm a little slow lol

Answer:

All living organisms require water for survival.

For example, all oxygen-dependent organisms need water to aid in the respiration process. Water has many uses for organisms.

Explanation:

Organisms need water because..

Cellular processes need water for their functioning.Substances dissolve in water for reactions to take place within the cells.Water helps in digestion of food and its absorption in the blood.It helps to maintain body temperature

Here are the sites I used if you would like more information

https://www.studyadda.com/ncert-solution/9th-science-natural-resources/291/27116

https://sciencing.com/water-important-living-organisms-6498727.html#:~:text=All%20living%20organisms%20require%20water,has%20many%20uses%20for%20organisms.

Which of the following best describes a benefit of one type of nonrenewable energy?

Natural gas does not produce greenhouse gases as other energy sources do.
Coal deposits are found on nearly every continent and mining coal poses few risks.
Nuclear power increases water vapor in the atmosphere.
Petroleum is relatively inexpensive compared to other forms of energy.

Answers

Answer:

" Natural gas does not produce greenhouse gases as other energy sources do."

Explanation:

The answer, "Coal deposits are found on nearly every continent and mining coal poses few risks." shows only how it can be a better option, but does not show how it can benefit.

The answer, "Petroleum is relatively inexpensive compared to other forms of energy." only shows how it can be a better option, but does not show how it can benefit.

The answer, "Nuclear power increases water vapor in the atmosphere." does not clearly state how this benefits us.

-kiniwih426

Answer:

Petroleum is relatively inexpensive compared to other forms of energy.

Explanation:

Because:

"Natural gas does not produce greenhouse gases as other energy sources do." natural gas does produce greenhouse gases, including carbon dioxide and water vapor, the natural gas mostly releases the greenhouse gas.

"Coal deposits are found on nearly every continent and mining coal poses few risks." coal is inexpensive, but could be damaging to the habitats around the coal mining.

"Nuclear power increases water vapor in the atmosphere." nuclear powder doesn't really increase water vapor, but makes water vapor.

"Petroleum is relatively inexpensive compared to other forms of energy." it is inexpensive if compared to other fossil fuels. (aka, the most inexpensive)

I am able to fill a glass of water to the top and it does not overflow…which property of water allows this to happen

Answers

Answer: surface tension

Explanation:

Answer:

When we fill the glass with water, we notice right away that it can go over the brim of the glass without spilling. This is because of surface tension. Surface tension holds the water together and acts against what would normally cause the water to fall – gravity – because each molecule of water is attracted to the other water molecules around it.

Explanation:

extra facts Water molecules are attracted to each other and is why you can fill a glass and as it gets to the top it will stay together to a certain point. However that stick together ability is pretty mild so when gravitational forces take effect the bonds are broken and it flows down the sides of the glass. Unfortunately, the attraction between the water molecules is only so strong. As we add coins, the amount of water spilling over the edges is getting larger and larger until the water just can’t take it anymore! Gravity is pulling on too many of the molecules for their attraction to keep them up, and the water spills down the side of the glass.What to Do. Place the glass on the saucer and fill the glass of water all the way to the brim. You’ll notice that the water hangs slightly over the top of the glass but doesn’t spill out just yet. Now, add the coins one at a time to the glass of water, dropping them in rim-first (not face down).

A close, interdependent relationship between two organisms is called . There are three main types of symbiotic relationships. In , both organisms benefit from the relationship. When one organism benefits but the other is harmed, their relationship is called . Occasionally, two organisms have a relationship where one organism benefits and the other is neither hurt nor helped. This type of relationship is called .

Answers

Answer:

A close, interdependent relationship between two organisms is called SYMBIOSIS . There are three main types of symbiotic relationships. In MUTUALISM, both organisms benefit from the relationship. When one organism benefits but the other is harmed, their relationship is called PARASITISM. Occasionally, two organisms have a relationship where one organism benefits and the other is neither hurt nor helped. This type of relationship is called COMMENSALISM.

The type of relationship where one organism benefits and the other is neither hurt nor helped is called commensalism.

What is commensalism?

In biology, commensalism is a connection between members of two different species in which one species uses the other for food or other purposes without causing the other any damage or gaining anything in return.

The commensal, or species that gains from the connection may take resources from the host species, which is unharmed, or find refuge, support, or means of movement. Frequently, a bigger host and a smaller commensal are in a commensal relationship.

The commensal species may exhibit significant morphological adaptation, whilst the host organism is virtually unaffected by the contact. Contrasting this connection with mutualism, which benefits both species,

A well-known illustration of a commensal is the remora (family Echineidae), a fish that travels in close proximity to sharks and other fish. Remoras have developed a flat, oval-sucking disc structure on top of their heads that cling to the bodies of their victims.

Remoras and pilot fishes both eat the leftover food from their hosts. Bird species like the magnificent egret (Ardea alba), which feeds on insects discovered by grazing animals or on soil creatures stirred up by plows, are other instances of commensals.

Therefore, this type of relationship is called commensalism.

Read more about commensalism, here

https://brainly.com/question/14224704

#SPJ2

the origin of a new plant species by hybridization, coupled with accidents during cell division, is an example of

Answers

Answer:

An accadental invention?????

Explanation:

What are the options

The skeletal system stores minerals and maintains mineral
a purity
b structure
C homeostasis
D surfaces

Answers

Answer:

C homeostasis

Explanation:

Homeostasis good luck

How is starch produced in plants??

Answers

glucose molecules are compounded together and make a bigger molecule (polysaccharide)

Over the years, bacteria have become less sensitive to antibiotics used for medicinal and sanitation purposes. This lack of sensitivity is termed antibiotic resistance. How is antibiotic resistance an adaptation?

A.
Antibiotic resistance has caused antibiotics to become more specialized, thus adapting the antibiotics to particular bacteria species.
B.
The trait giving bacteria antibiotic resistance has reproductively isolated groups of bacteria.
C.
The trait giving bacteria antibiotic resistance has become common, giving bacteria with the trait a selective advantage.
D.
Antibiotic resistance makes it more difficult for bacteria to infect hosts, thus is a selective advantage for the host.
Reset Submit

Answers

A as the bacteria grows its resistance based on the amount of people using that specific antibiotic and allowing the bacteria to adapt.

The following are the results of a genotype being "foiled" for a dihybrid cross: BS, Bs, bS, bs.

Determine the parents' genotype
A. BbSS
B. BBss
C. BsSs
D. BBSS

Answers

Answer:

C.

Explanation:

Some metamorphic rocks experience extreme pressure and form layered bands or are said to be _______________________, while others without bands are said to be ____________________

Answers

Answer:

Some metamorphic rocks experience extreme pressure and form layered bands or are said to be gneissic foliation, while others without bands are said to be non-layered

a mixed nerve consists of both __________ and ___________.

Answers

Afferent and efferent axons

Hope that helped :)

1. State one possible negative effect of a warming trend on Earth. Specify how this effect will
have a negative impact on the living environment.

Answers

Answer:

One stated possible negative effect of a warming trend on earth is that the polar ice caps could melt.

Explanation:

Specification on how this will have a negative impact on the living environment is that it will cause sea levels to rise this is negative because: tsunamis will become more severe and damaging to land. Rain storms will have severe floods then what we have now.

Hope this helps.    

6. explain the relationship between enzymatic active sites & the
catalytic cycle of an enzyme

Answers

Answer: To catalyze a reaction, an enzyme will grab on (bind) to one or more reactant molecules. These molecules are the enzyme's substrates. ... The part of the enzyme where the substrate binds is called the active site (since that's where the catalytic “action” happens). A substrate enters the active site of the enzyme.

Explanation: Hope this helps.

to allow movement of the tendons within the carpal tunnel zone, each tendon is encased in a __________.

Answers

To allow movement of the tendons within the carpal tunnel zone, each tendon is encased in a sheath.

The sheath is a fibrous but at the same time serous element that is composed of a viscous liquid called the synovium, which is designed in order to allow the tendons to move with the bones.

The function of the sheaths is to allow a correct sliding between the tendon where it meets the bone through which it passes.

The importance of sheaths for the biomechanics of movements is that if they were not located in the tendons, these tissues would wear out very easily, thus causing injuries such as tenosynovitis.

The best known synovial sheaths are those of the flexor apparatus of the hand, that is to say to the internal and external digitocarpal, in the fibrous band of the foot, and in the long tendon of the biceps muscle.

Therefore, we can conclude that to allow movement of the tendons within the carpal tunnel zone, each tendon is encased in a sheath.

Learn more here: https://brainly.com/question/13464872

Other Questions
Help ASAP Im lost on this question which technolgy is nasa devloping that will help astronaughts reach mars? pls help! what were three ways the freedmens bureau helped freed slaves? help. What expression would you use- 1- when greeting a friend. 2- when introducing yourself. 3- to respond to someone's introduction. 4- when you have to leave. 5- to excuse yourself. How is the electromagnetic spectrum organized from right to left? Directions: Read this short story below then answer the two questions at the bottom.( I will take a picture of the story bc it wont let me type it here) 1. How did Yousef and his family become U.S. citizens? 2. What almost happened to Yousef and his family at the airport? crows are migrating and travel 35 km on a bearing of 047. Then then fly 15 km of a bearing of 105. How far , and on wha Help!!!!!factor 3^2+15x-42 what condition might result from an excess of aquaporins? Please please help me with this question please now and show your steps Which factor increases as the effiency of a machine increases Please help with story idea! (I will give brainliest, I just want ideas)I have a story idea where a group of maybe 8 year olds or so sneaks out one night to find some sort of artifact> I'm trying to figure out what that should do. Why do they want it? The story is going to start in a small town where everyone knows eachother, and this one group of kids try to go find this thing - I'm thinking the story will be somewhat like the Monkey's paw, with the three wishes, but I don't know. Does anyone have any ideas? This is supposed to be a horror story for class, but it doesnt have to be too scary, and it has to answer the question What are humans most afraid of? Sa tingin mo, tama ba ang ginawa ni teodoro patino na isiwalat ang samahang kkk? Ipaliwang. which u.s. state is named for the english queen henrietta maria? i need an explanation what....wajfasjf explain step by step please and thanks Write 2-3 complete sentences to describe the lifestyle in United States 11. Henry's growth as a character is best shown through which of the following lines from The Red Badge of Courage?These happenings had occupied an incredibly short time, yet the youth felt that in them he had been made aged... and the most startling thing was to learn suddenly that he was very insignificant.""And at last his eyes seemed to open to some new ways. He found that he could look back upon the brass and bombast of his earlier gospels and see them truly.""From his home his youthful eyes had looked upon the war in his own country with distrust."there was much food for thought in the manner in which he replied." Helpppp plzzzzzzzzzzzzz Evaluate -5x+8 when x=3 The value of the expression is