Organize the levels of classification listed below in descending order.

a. Order
b. Genus
c. Phylum
d. Species
e. Class
f. Domain
g. Kingdom
h. Family

Answers

Answer 1

Answer:

f. Domain

g. Kingdom

c. Phylum

e. Class

a. Order

h. Family

b. Genus

d. Species


Related Questions

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the ________ muscle.

Answers

Answer:

The muscle that originates on the sacrum and transverse process of each vertebra and inserts on the spinous process of the third or fourth more superior vertebra is the Longissimus muscle

Explanation:

The Longissimus is a group made of three muscles: longissimus capitis, longissimus cervicis and longissimus thoracis. It has the length of the vertebral column.

It is placed in the back, and as the statement says, it originates on the sacrum and transverse of each vertebra. Each of them originates at the transverse elements and insert in the costal ones.

Recall what you know about crossing over, independent assortment, and random joining of sex cells during sexual reproduction. Now, go back to the claims in Step 2a. Do you support these claims? If so, do you support the totality of the claims or just parts of the claims? Based on your prior knowledge, make a claim about the factors that cause inherited genetic variations within populations. Also make a claim about the effects of mutations. Write your claim in your notebook. ASAP!!!!

Answers

Answer:

Crossing over is a process in which exchange of segments occur.

Explanation:

Crossing over is a process in which two non-sister chromatids of homologous chromosomes exchange the segments of genetic material with each other during meiosis. Due to this process, variation occurs in an organism.

Independent assortment is a process in which different alleles are sorted to different gametes which occurs independently and does not effect one another. This process occurs in metaphase of meiosis l.

Joining of sex cells is a process in which sex cells of male and female join together formed a zygote which turn into a new organism. These sex cells are formed during meiosis which are haploid in nature.

Mutation and crossing over are the factors that cause inherited genetic variations within populations.

Sudden change occurs in the genes of an organism due to the exposure of the cell to radiation or chemicals.

Which statement best describes how Watson and Crick's model used other scientists work to create a model of DNA?
They used Chargaff's rule to determine that it contains ribose sugar
O They used Franklin's photo to determine that DNA was a double helix.
They used Levene's work to determine the number of base pairs in each strand.
O They used Nirenberg and Matthei's studies to determine that DNA is made of nucleotides.

Answers

Answer:

b.

Explanation:

They used Franklin's photo to determine that DNA was a double helix.

The best statement that describes how Watson and Crick's model used other scientists' work to create a model of DNA can be seen in the second Option.

They used Franklin's photo to determine that DNA was a double helix.

               The early 1950s saw the development of the renowned model of the DNA double helix by American scientist James Watson and British physicist Francis Crick. They were the explorers to pass the finishing line in this scientific race.

               Rather than doing fresh tests and experiments in the lab, Watson and Crick primarily gathered and evaluated existing data, combining it in novel and illuminating ways.

               Franklin was a specialist in X-ray crystallography, a sophisticated approach for identifying molecular structures. When an X-ray beam strikes the crystallized form of a molecule, e.g the DNA, part of the rays are redirected and diverted by the atoms in the crystal, creating a diffraction pattern that unveils data information regarding the structure of the molecule.

               Franklin's crystallography provided crucial hints to Watson and Crick on the structure of the DNA model. Some of them originated from Franklin's extraordinarily clear and stunning X-ray diffraction photo of DNA.

               According to the work of Phoebus Levene, Levene only posits that the DNA was formed of subunits called nucleotides.

               Erwin Chargaff speaks volumes on the determination of the composition of ribose sugar bases.

               Therefore, we can conclude that Watson and Crick knew about all these Phoebus Levene and Erwin Chargaff postulates and experiments but it was Franklin's work on X-ray diffraction photos of DNA that gave them a crucial hint to create a model for the DNA.

Learn more about the DNA here:

https://brainly.com/question/264225?referrer=searchResults

Cilia in cells along the trachea ad nasal passage secrete blank which traps dirt and particles from the air

Answers

Answer:

Yes it secretes blank to trap and particles from the air

During osmosis Group of answer choices pure solvent and a solution both diffuse at the same time through a membrane.

Answers

During osmosis A) pure solvent diffuses through a membrane but solutes do not. B) pure solutes diffuse through a membrane but solvent does not. C) pure solvent and a solution both diffuse at the same time through a membrane. D) gases diffuse through a membrane into a solution and build up pressure.

Answer:

Explanation:A.

The net movements of solvent from the region of higher water potential (solvent) to a region of lower water potential(solute) through  a semipermeable membrane is called osmosis. It is a peocess where the solute dissolved in the solvent and the resulting solution pass the selective permeable membrane,A selective permeable is  the type which allows water,gases, and  non polar molecules to pass through, but restrict polar and other large molecules  through its walls.

Generally during osmosis,the water molecules and solute molecules interacts.These interaction ,due to dipole dipole effects of the water molecules, reduced the pressure of water on the solute in solution .Consequently, the water molecule of the pure water (the  solvent )exerts more pressure on the weaker solution i,e higher water potential

Hence,this pressure forces water molecules across the semi permeable membrane,from higher water potential to lower water potential.It is the major biological process of plants and animals.

Assume that white color is dominant over yellow color in squash. If pollen from the anthers of a heterozygous white-fruited plant is placed on the pistil of a yellow-fruited plant, show using ratios the genotypes and phenotypes you would expect the seeds from this cross to produce. 1. Genotypes 1/2 Ww 1/2 Ww 1:1 ratio | Phenotypes All white 1:0 ratico
2. Genotypes 1/2 wW 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio
3. Genotypes- 3/4 Ww 1/4 ww 1:1 ratio | Phenotypes 3/4 white 1/4 yellow- 1:1 ratio
4. Genotypes-1/2 ww 1/2 ww = 1:1 ratio l Phenotypes-1/2 white 1/2 yellow-1:1 ratio

Answers

Answer:

2. Genotypes 1/2 Ww 1/2 ww 1:1 ratio | Phenotypes 1/2 white 1/2 yellow 1:1 ratio

Explanation:

This question involves a single gene coding for fruit color in squash. The allele for white color (W) is dominant over the allele for yellow color (w).

If a heterozygous white-fruited plant (Ww) is crossed with a yellow-fruited plant (ww), the following gamete combinations will be produced by each parent:

Ww- W and w

ww- w and w

Using these gametes in a punnet square (see attached image), offsprings with genotypes: Ww and ww will be produced in the ratio 1:1

(1/2) Ww will be phenotypically white-fruited

(1/2) ww will be phenotypically yellow-fruited

Hence, the seed offsprings of this cross will possess:

Genotypes 1/2 Ww, 1/2 ww in 1:1 ratio

Phenotypes 1/2 white, 1/2 yellow in 1:1 ratio

what is a protron needed for

Answers

Answer:

Function in the atom

Explanation:

The protons inside an atom's nucleus help bind the nucleus together. They also attract the negatively charged electrons, and keep them in orbit around the nucleus. The number of protons in an atom's nucleus determines which chemical element it is.

Shelly, an eight-year-old child from a low-income family, is displaying symptoms such as growth failure, diarrhea, and pneumonia. Which of the following is Shelly most likely suffering from?
a. Iron deficiency
b. Folate deficiency
c. Iodine deficiency
d. Vitamin A deficiency
e. Zinc deficiency

Answers

Answer:

The correct answer is e.

Explanation:

Zinc is an essential intracellular trace element most abundant in the human body, which participates in important structural and catalytic regulatory functions, it is an integral part of many tissues, being essential for the synthesis of biomolecules such as DNA and proteins, as well as for degradation of the same. The deficiencies of any nutrient may be due to a decrease in its intake, an increase in the body's needs and therefore, its requirements, or a decrease in the bioavailability of the nutrient due to the way in which it is found in food. Zinc deficiency causes multisystemic, sometimes fatal, manifestations if not detected and corrected early. Symptoms of severe zinc deficiency are slowing or disruption of growth and development, delayed sexual maturation, characteristic skin rashes, chronic and severe diarrhea, impaired immune system, poor wound healing, loss of appetite, decreased sensitivity to the touch, night blindness, inflammation, opacity of the corneas and behavioral problems.

explain why a father with blood group AB cannot donate for a child with blood group O when he marries a woman with blood group O​

Answers

The odds are astronomical for a father with AB(IV) to have an O(I) child. The only possible way for this phenomenon to occur is if there was a nondisjunction in the ovogenesis for the 9th chromosome and the father also had a nondisjunction for the same chromosome(A sperm cell with no 9th chromosome fertilized an ovum with two 9 chromosomes).

A person with AB cannot donate to a person with O because the receiver has antibodies(alpha and beta) that bind to the antigens on the AB blood cells, causing death.

in which process is oxygen absorbed by an organism

Answers

Answer:

the process of breathing (inhalation)

Answer:

Respiration

Explanation:

Ap ex

what is an example of facilitated diffusion

Answers

Answer:

Fructose

glucose

some of the Aminoacids

Which type of organism developed first?

Answers

al

answer: algae

explanation: because the were the first ones to adapt with water and land...

describe how a cell acquires the O2 the cell needs for its metabolic processes and how a cell gets rid of the CO2 that is doesn't need and can actually be harmful to the cell?

Answers

Answer:

Cells absorb oxygen and release CO2 via the bloodstream. Please find below detailed explanation

Explanation:

Oxygen and carbondioxide (CO2) are the major gaseous substances involved in celluar respiration. Aerobic celluar respiration, which is the process by which cells obtain energy, requires oxygen to occur. The oxygen initially gets breathed in as a constituent of air, which later passes through air sacs and gets attached to hemoglobin in red blood cells. Hemoglobin transports oxygen throughout the cells of the body.

After the process of celluar respiration is done, carbondioxide (CO2) is released back into the bloodstream, which carries it to the lungs. The CO2 is released when we breathe out.

Identify the parts of the sun labeled A,B,C,D, and E

Answers

Answer:

Part A: Core of the Sun

Part B: The radioactive zone

Part C: The convective zone

Part D: The photosphere

Part E: Corona      <---   :D

Explanation:

If I am wrong, I am sorry because I am only a middle schooler and I searched it up and only read some articles. I hope this helps!

A Maximum-Minimum thermometer has two stems which record the highest and lowest temperatures during a period of time. A small metallic piece in each stem indicates the temperature. A. 55o C, 35o C, 45o C B. 45o C, 25o C, 35o C C. 55o C, 25o C, 35o C D. 45o C, 25o C, 30o C 4. M

Answers

Answer:

The correct option is A: 55° C, 35° C, 45° C

Explanation:

The Six's thermometer is a device to record maximum and minimum values of temperature within a given period of time. It is a glass tube in a U shaped manner that contains mercury, which is dependent on the expansion of alcohol in order to register a maximum reading. It is made use of for the purpose of meteorology, horticulture etc.

The metallic piece in each stem indicates the temperature of 45°C, 25°C, 35°C. That is option B.

A maximum-minimum thermometer is an instrument used to measure both the minimum and maximum temperature of a given area for a period of time.

The maximum-minimum thermometer is used in the following fields:

Horticulture: This is useful in the sustainable production of cultivated food and ornamental plants as temperature of the area in use needs to be monitored.

Meteorology: This is useful in this field to monitor the temperature of different locations.

The range for a maximum-minimum thermometer is -30°C to 50°C.

Therefore, the metallic piece in each stem will indicate the temperature of 45°C, 25°C, 35°C which is within the range.

Learn more about thermometers here:

https://brainly.com/question/25034625

botanical name for fals yam​

Answers

Answer:

Icacina senegalensis.

Hope it helps you:)

Answer:

[tex]\boxed{\mathrm{Icacina \:\: oliviformis}}[/tex]

Explanation:

False yam is a root crop found in the Northern part of Ghana.

The botanical name for False yam is Icacina oliviformis.

10 male reproductive organs

Answers

-penis
-scrotum
-testes
-epididymis
-vas deferens
-prostate
-seminal vesicles
-erectile tissue
-perineum
-testosterone

Where does the Krebs cycle take place?

Answers

Answer:

takes place in the matrix mitochondria in cells it is also known as the Krebs cycle or the TCA cycle this process is essential part aerobic respiration

Explanation:

Answer:

takes place in the matrix mitochondria in cells it is also known as the Krebs cycle or the TCA cycle this process is essential part aerobic respiration

Explanation:

What are the different alleles available for the cross shown in this Punnett square? a and a A and a A and A

Answers

Answer:

A and a

Explanation:

Answer:

b

Explanation:

You go to the circus and see the tiger show. When the trainer cracks his whip, the tiger jumps through the hoop. This is an example of

a. operant conditioning with a positive reenforcement

b. operant conditioning with negative reenforcement

c. operant conditioning with punishment

d. none of the above​

Answers

Answer:

C

Explanation:

the trainer has already threatened and hit the tiger before.

thus, when he cracks the whip, the tiger is afraid and will "volunteeringly" jump through the hoop.

the defination of operant conditioning with punishment is any change in a human or animal's surroundings which, occurring after a given behavior or response, reduces the likelihood of that behavior occurring again in the future.

where do scientist obtain primers to be used in pcr and in this technique

Answers

Answer:

Scientist obtain the primers from the DNA polymerases that preform the synthesis which must have an existing strand of nucleotides already in order to attach new DNA nucleotides. The existing strand of new DNA nucleotides is the primers

Explanation:

In order to happen DNA synthesis of a wanted portion of DNA in laboratory,

Scientist obtain the primers from the DNA polymerases that preform the synthesis which must have an existing strand of nucleotides already in order to attach new DNA nucleotides. The existing strand of new DNA nucleotides is the primer. To that existing strand of nucleotides we call primer. In a lab, scientists produce DNA primers through specific sequences that bind to other sequences of a single-thread DNA molecule and these are the primers commonly used to perform PCR.

Describe the events by which depolarization of a smooth muscle cell results in contraction and explain why smooth muscle contractions are slow and sustained.

Answers

Answer:

The depolarization of the smooth muscle cell membranes triggers the potential for contraction action, since the endoplasmic reticulum releases calcium in the intraplasmic zone, causing myosin and actin to unite, generating a sweeping movement and bringing the z lines of the sarcomero.

Smooth muscle contractions are more sustained over time by the distribution and type of muscle fiber, as they are more tapered.

Explanation:

The smooth muscle is that muscle that controls non-voluntary contractions, that is, controlled by the somatic nervous system, and is not related to locomotion but rather to involuntary movements such as intestinal motility, vascular contraction, etc.

The sliding of myosin and actin filaments over one another causes smooth muscle contraction. The hydrolysis of ATP provides the energy for.

Smooth muscle cell:

Smooth muscle lacks the calcium-binding protein troponin, which is found in cardiac and skeletal muscle. Smooth muscle fibers, unlike skeletal muscle fibers, usually contract slowly and synchronously. The electrical connection of smooth muscle by gap junctions causes the smooth muscle fibers to synchronize.

When the communication from the motor neuron stops, the sarcolemma and T-tubules repolarize, and the voltage-gated calcium receptors in the sarcoplasmic reticulum shut. Ca++ ions are subsequently returned to the sarcoplasmic reticulum, causing tropomyosin to re-cover the actin strands' binding sites. When a muscle runs out of ATP and becomes exhausted, it might also stop contracting.

Find our more information about 'Smooth muscle cell'.

https://brainly.com/question/24029616?referrer=searchResults

Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC
A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code.
B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein.
C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein.
D) Both B and C are possible outcomes.

Answers

Answer:

Option A

Explanation:

DNA sequence: GTCACCGGTCTATACATAAGC.

If the bases of codon 5 under a mutation of C to T, the outcome would be?

Bases of the sense codon 5 is TAC, since codons of the sense strand is the same as that of the mRNA except with the replacement of uracil in place of thymine. This codon TAC codes for tyrosine.

If a mutation occurs changing C to T, then the bases would be TAT coding also for tyrosine too due to the nature of redundancy of the genetic code. Thus, there would be no change to the protein sequence although a change would occur in the DNA sequence.

Redundancy of the genetic code indicate that more than one codon can code for an amino acid as there are 64 codons and 20 amino acids.

What is the allele frequency?

Answers

Allel frequency, or gene frequency, is the relative frequency of an allele at a particular locus in a population, expressed as a fraction or percentage. Specifically, it is the fraction of all chromosomes in the population that carry that allele

Answer:

Explanation:

Allele frequency is the how often or what's the percentage of a particular allele in a population. Allele is referred to as version of a gene that is located on the chromosome.

For example, a gene causing death in rats might have alleles, W and w. Each would be a separate allele and the frequency would be how often or what's the percentage of W or w that is present in the population.

Suppose we are trying to find frequency of W or w allele in a population then the formula is

Allele Frequency = [# of copies of certain allele (either W or w)] / [Total number of W and w alleles]

Now suppose we have 4 WW and 2 ww in a population.

First we count up W allele then we have (4 * 2)= 8 W (we multiplied by 2 because each organism has WW, 4 WW is short of of writing WW , WW, WW, WW)Same concept for 2ww, we have total w = 2 * 2 = 4w

Total alleles = W + w = 8 +4 =12

Allele Frequency for W = 8 / 12 = 66.67%

Allle Frequency for w = 4 / 12 = 33.33%

Hope this helps!

Which correctly describes malignant tumors?

Answers

Answer:

Malignant means that the tumor is made of cancer cells, and it can invade nearby tissues. Some cancer cells can move into the bloodstream or lymph nodes, where they can spread to other tissues within the body—this is called metastasis.

Malignant tumors is a cancer cells
Cancer cells are cells which when it divides it divides more than the needed cell as it causes didorder

the white wallaby in this image has a mutition thatgives it a white colorng. how could this coloring affect its survival in its environment

Answers

Answer:

When changes happen in an environment. Many things can and will happen. If there was a gene mutation for the color of beetles, then that would affect their survival because the old color could have helped them hide and be camouflage. (however you spell it) If that is changed it could make them more out in the open, so predators could get them easier. Which would result in less beetles and more predators. Some examples are like the white wallaby, because of its environment it changes color to blend in and survive.

Explanation:

Posted on Brainly before.

When environmental changes occur. Many things are possible and will occur. The survival of beetles would be impacted if there was a gene mutation that changed their color because their previous color may have helped them blend in.

What white wallaby has a mutation that gives it a coloring?

The population of white wallabies will become more vulnerable to predators as a result of a mutation that alters their color pattern, and as a result.

There will be a modest drop in the overall number of white wallabies in the environment. In other words, the mutation decreases their chances of surviving.

The young, known as joeys, are nurtured in a pouch by all wallabies, which are marsupials. Their tails, which are not prehensile or grasping like those of kangaroos, are long, strong, and useful for balance.

Long jumps can be made by wallabies using their robust hind legs. The feet of rock wallabies are uniquely adapted to help them grip the rocky environment in which they inhabit.

Therefore, As its name implies, Nail-tail Wallabies have a pointy growth at the end of their tails.

Learn more about wallaby here:

https://brainly.com/question/6779278

#SPJ2

Why do hurricanes lose strength once they reach the land?
O A. Hurricanes can't replenish their water from the ground.
B. Hurricanes gain strength from the warmth of the ocean water.
C. Hurricanes lose strength when they reach a warm front on land.
D. Friction with the ground stops hurricane spinning.

Answers

Answer: b

Explanation: cause hurricanes gain strength from water

Hurricanes lose strength once they reach the land because hurricanes gain strength from the warmth of the ocean water. The correct answer is option B.

A hurricane is a large, rotating storm that forms over tropical or subtropical waters. Hurricanes are characterized by strong winds, heavy rain, and storm surges, which can cause significant damage and loss of life.

Hurricanes gain strength from the warmth of the ocean water. This is why hurricanes tend to lose strength once they reach land. When a hurricane is over the ocean, it draws its energy from the warm water, which causes the air to rise and creates a low-pressure area. This low-pressure area then draws in more warm, moist air from the surrounding area, which fuels the hurricane and causes it to intensify.

Once a hurricane moves over land, it loses its source of warm water and can no longer draw in the moisture it needs to maintain its strength. This causes the hurricane to gradually weaken and dissipate.

Since, hurricanes gain strength from the warmth of the ocean water, it loses its source of warm water and eventually its strength. Option B is the correct answer.

Learn more about hurricanes here:

https://brainly.com/question/33034641

#SPJ6

Define feeding of living things ​

Answers

Explanation:

the process by which the organism obtsin their their food is called feeding of living thing.

Answer:

Explanation:

Feeding is the process by which organisms, typically animals, obtain food. Terminology often uses either the suffixes -vore, -vory, -vorous from Latin vorare, meaning "to devour", or -phage, -phagy, -phagous from Greek φαγεῖν (phagein), meaning "to eat".

One example of scientist taking different approaches that lead to the same result is

Answers

The given question is incomplete, the complete question is:

One example of scientists taking different approaches that lead to the same result is

A). two scientists testing different hypotheses about the same observation.

B). two scientists repeating a third scientist’s experiment as published.

C). two scientists working on one experiment at the same time in different labs.

D). two scientists performing one experiment at different times in the same lab.

Answer:

The correct answer is statement A, that is, two scientists testing different hypotheses about the same observation.

Explanation:

The correct answer is statement A, as examining different hypotheses regarding the same observation may give a similar result. A proposed explanation or supposition made based on the confined proof as an initiation point for further investigation is known as a hypothesis.  

In statement B, the scientists are not considering distinct approaches, however, they are both performing an experiment published earlier. In statement C, scientists have considered a similar approach and are separated spatially. In statement D, the scientists are also considering a similar approach, however, are distinguished temporally.  

Polaris is ______. (choose the three correct answers). called the north star. no choices fit this sentence always directly over the north pole. a star that is often the brightest start in Ursa Minor.

Answers

Answer:

called the north star, always directly over the north pole and a star that is often the brightest start in Ursa minor..

Explanation:

Polaris commonly the North Star or Pole Star and is the brightest star in the constellation of Ursa Minor. It is very close to the north celestial pole, making it the current northern pole star.

hope this answer correct (^^) ....

Other Questions
The true average diameter of ball bearings of a certain type is supposed to be 0.5 in. A one-sample t test will be carried out to see whether this is the case. What conclusion is appropriate in each of the following situations? (a) n 15 t 1.66 a 0.05 A. Reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in B. Reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in C. Do not reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in D. Do not reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in (b) n 15 t 1.66 a 0.05 Reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in Reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in Do not reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in Do not reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in (c) n 26, t 2.55 a 0.01 A. Reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in B. Reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in C. Do not reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in D. Do not reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in (d) n 26, t 3.95 A. Reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in B. Reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in C. Do not reject the null hypothesis. There is not sufficient evidence that the true diameter differs from 0.5 in D. Do not reject the null hypothesis. There is sufficient evidence that the true diameter differs from 0.5 in The 1854 Ostend Manifesto a. prohibited enslaved labor in the Hawaiian Islands. b. was directed at limiting England's influence in the Caribbean. c. enraged southern enslavers. d. was part of an attempt by the United States to acquire Cuba. e. saw several European powers denounce the American enslaved labor system. Use Kepler's third law to determine how many days it takes a spacecraft to travel in an elliptical orbit from a point 6 965 km from the Earth's center to the Moon, 385 000 km from the Earth's center. MATH HELP ASAP BRAINLIEST!!!! The path followed by a roller coaster as it climbs up and descends down from a peak can be modeled by a quadratic function, where h(x) is the height, in feet, and x is the horizontal distance, also in feet. The path begins and ends at the same height, covers a total horizontal distance of 100 feet, and reaches a maximum height of 250 feet. Which of the functions could be used to model this situation? A. h(x)=-0.1x^2-50x+250 B. h(x)=-0.1(x-50)^2+250 C. h(x)=-0.1(x-100)^2+250 D. h(x)=-0.1x^2+100x+250 It began to rain just as the party goers _____.were leavingare leavinglefthave left y + 2 = -3 (x - 4) Complete the missing value in the solution to the equation. (____, -2) ASL: When counting by tens, sign the first digit and face your palm down follow it up with a zero keep your eyes on your hand sign at chest height Royal Lawncare Company produces and sells two packaged productsWeedban and Greengrow. Revenue and cost information relating to the products follow: Product Weedban Greengrow Selling price per unit $ 9.00 $ 39.00 Variable expenses per unit $ 2.70 $ 14.00 Traceable fixed expenses per year $ 131,000 $ 33,000 Last year the company produced and sold 40,500 units of Weedban and 18,500 units of Greengrow. Its annual common fixed expenses are $101,000. Required: Prepare a contribution format income statement segmented by product lines. these are the poems Poem 1: Fire and Ice by Robert Frost Poem 2: This Is Just to Say by William Carlos Williams 1st paragraph: talk about the similarities of both authors 2nd paragraph: talk about the differences between both authors I need a good and full response for the paragraphs :) Claire is cycling at a speed of 12 miles per hour. Han is cycling at a speed of 8 miles per hour. If they start at the same position, chosen at zero, and bike in straight opposite directions, what will the distance between them be after 45 minutes? The route that the sensation of taste follows is a: Primary axons pass along cranial nerves VII and IX. b: Primary neurons synapse in the nucleus solitarius. c: Secondary neurons synapse in the thalamus. d: Tertiary neurons travel to the primary gustatory cortex. Determine the quotient. Write your answer in scientific notation.(8.4 * 10%) + (1.2 x 102) 4 1/2 +1 3/5 (in the simplest form) in 50 gram portion of cereal 8 grams of it are sugar which of the following represents the present of the 50 grams that is sugara)4b)8c)16d)24 What does the Declaration of Independence say about rights? Given here is the price list of vegetables shown at a Mother Dairy vegetable Booth. Mrs. Khanna brought the following vegetables: potatoes [tex]2 \frac{1}{2} [/tex] onions [tex]3 \: kg[/tex] Peas [tex]1 \frac{1}{2} kg[/tex] Carrots[tex]1 \frac{1}{2} kg[/tex]She Gave a 500 - Rupee note to the man at the counter. How Much balance did she get? How do Run-DMC and the Beastie Boys make more direct connections to rock than some of their rap successors? find the area of the quadrilateral ABCD in which ab=5cm,bc=4.5cm,cd=3.5cm,da=4cm and ac=6.5cm What is the approximate circumference of the circle shown below?