Oceans formed when rainwater filled basins 3.8 billion years ago. ________ run into the ocean dissolving minerals like salt as they go. __________ leaves salt in the ocean, which is why the ocean is _________. Salinity has _______________, so the ocean is _______getting any more or less salty. Salinity makes water ____________ and contributes to currents.

Answers

Answer 1

Answer:

Physically erodes

Minerals

Dissolved

Crystals

Thicker

Minerals

Answer 2

Oceans formed when rainwater filled basins 3.8 billion years ago. Physical erosion runs into the ocean dissolving minerals like salt as they go. Minerals leave salt in the ocean, which is why the ocean is dissolved.

Salinity has crystals, so the ocean is thicker and getting more or less salty. Salinity makes water full of minerals and contributes to currents.

How oceans are formed?

The oceans formed billions of years ago due to the condensation of water into rain which significantly filled the basins that ultimately direct the formation of the oceans. Apart from this, the continuous degassing of the interior surface of the earth is also responsible for this fact.

According to the context of this question, the salinity of the oceans depends on the number of minerals dissolved in it which contributes to the development of currents.

To learn more about Oceans, refer to the link:

https://brainly.com/question/25154137

#SPJ2


Related Questions

What is the primary source of energy in a food change

Answers

Answer:

It is the sun in most ecosystems as the light energy is fixed during photosynthesis and then transferred to other organisms via the food chain.

Explanation:

are lipids that serve as chemical messengers.
a
RNAs
b
Enzymes
C Steroids
d Proteins
Check it

Answers

Answer:

C. Steroids

Explanation:

Some lipids such as steroid hormones serve as chemical messengers between cells, tissues, and organs, and others communicate signals between biochemical systems within a single cell.

Answer:

steroids

Explanation:

so c

which I true of the rock layers shown below​

Answers

Answer:

C

Explanation:

The fossil can get lifted due to water and other components

Joe Mama!!! Jk it’s C

(01.05 LC)
Which of the following is the process used by producers that allows energy to be stored in glucose?
A) Cellular respiration
B) Consumption
C) Decomposition
D) Photosynthesis

Answers

The correct answer is D.

Which organelle houses the genetic material DNA?

Answers

Answer:

Image result for Which organelle houses the genetic material DNA?

nucleus

The nucleus is a membrane-enclosed organelle, found in most eukaryotic cells, which stores the genetic material (DNA).

Explanation:

Nucleus is the organelle that houses the genetic material DNA.

What do you mean by organelle?

"An organelle is a subcellular structure that has one or more specific jobs to perform in the cell, much like an organ does in the body."

What do you mean by genetic material?

"Any material of plant, animal, microbial or other origin that carries genetic information and that passes it from one generation to the next is called genetic material."

What do you mean by DNA?

"DNA or deoxyribonucleic acid is a long molecule that contains our unique genetic code."

What is called a nucleus?

"A nucleus, as related to genomics, is the membrane-enclosed organelle within a cell that contains the chromosomes. An array of holes, or pores, in the nuclear membrane allows for the selective passage of certain molecules (such as proteins and nucleic acids) into and out of the nucleus."

To know more about organelle, genetic material and DNA here https://brainly.com/question/16653190

#SPJ2

HELP PLEASE

Each myofibril is made up of arrays of parallel filaments. The thickbands are called _____ and the thin bands are called _____.

Answers

Answer:

A band , I band

Explanation:

YOURE WELCOMEEE

What is the molecule depicted in the figure above and in which organelle would it most likely be created?



A. ATP, the mitochondria


B. ATP, the nucleus


C.ADP, the chloroplast


D. ADP, the ribosome

Answers

Answer:

The answer is A.

Explanation:

ATP, the mitochondria

The molecule depicted in the figure above is ATP and the cell organelle in which it would most likely be created is: the mitochondria.

Cell organelles can be defined as the internal organs that are typically responsible for the performance of various functions (tasks) within the body of a living organism such as an animal, plant, and humans, especially for the survival of the organism.  

Some examples of cell organelles found in the body of living organisms include the following:

Nucleus. Cytoplasm. Cell membrane. Chromosome.Endoplasmic reticulum (ER). Golgi apparatus (bodies).Vesicles.Mitochondria.

Mitochondria is commonly referred to as the "power house" of a cell because it is saddled with the responsibility of providing and transforming all of the energy required by living organisms in the form of adenosine triphosphate (ATP).

In conclusion, it is very important that energy (ATP) is provided by mitochondria for the survival and optimum performance of a living organism.

Read more: https://brainly.com/question/19559847

Why is using the presence of chromosomes inside of a cell NOT a reliable method to
determine if the cell is a prokaryote or a eukaryote?

Answers

Because both prokaryotic and eukaryotic cells have chromosomes (prokaryotes, and more specifically, bacteria, generally have just one chromosome, but there are some bacteria as well as archaea—which are also prokaryotes—that have multiple chromosomes).

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

The nucleus of a eukaryotic cell is bounded by internal membrane, therefore, it is distinctive.

In contrast, the nucleus of a prokaryotic cell lacks internal membrane, hence its nucleus is not distinctive.

Chromosomes are Deoxyribonucleic (DNA) molecules that carry genetic information of a cell or organism.

The chromosomes are present in both the eukaryotic and prokaryotic cells. Chromosomes present in the eukaryotic cells are called eukaryotic chromosomes while chromosomes present in the prokaryotic cells are called prokaryotic chromosomes.

Since the chromosomes are DNA molecules present in both the prokaryotic and eukaryotic cells, it is not a reliable method to determine if a cell is prokaryotic or eukaryotic

Learn more here: https://brainly.com/question/2088739

According to cell theory, which of the following are made of cells? Check all that apply.

- flowers
- rocks
- blood
- water
- bacteria
- sugar
- skin

Answers

Answer:

flowers

blood

bacteria

skin

According to cell theory flowers, blood, bacteria and skin all are made up of cells.

What is cell theory?

The cell theory is a scientific theory that was initially developed in the middle of the nineteenth century, which states that all living organisms are composed of cells, that cells are the fundamental structural/organizational unit of all organisms, and that all cells originate from pre-existing cells.

Knowing that all living things are cells helps us comprehend how they are born, grow, and die. That information helps us understand how new life is produced, why creatures take their forms, how cancer spreads, how diseases can be handled, and more. Cells help us grasp life and death: a living creature is alive, while a dead one is dead.

Therefore, flowers, blood, bacteria and skin all are living things made up of cells.

Learn more about cell theory, here:

https://brainly.com/question/1468725

#SPJ2

Search the NIH gene database for the term colorblindness. Use the results of the database search to explain how a father and mother who are not colorblind could have a son who is colorblind. Your model can be a pedigree chart, a Punnett square, or a diagram of chromosomes.

Answers

Answer/Explanation:

Red/green colorblindness is a recessive, X-linked condition. That means that the affected gene is on the X chromosome, and that the phenotype will only be present if there is no "healthy" gene, which is dominant to the mutated gene.

For two unaffected people to have an affected son, the mother must be a carrier. Remember, females have two X chromosomes and males have one. So if a female is a carrier of the colorblindness mutation, she will have one copy of the mutation and one normal copy of the gene, and will therefore be unaffected.

The punnet square (attached) shows that all their female children would be unaffected (have the B gene), but 1:2 male children would be colorblind, as their only copy of the gene is mutated (b).

Answer:

The person on top is awesome appreciate!!

Explanation:

got it right on edmmentum

You're enjoying playing with your neighbor's new kittens. You notice than some of them look identical to the mama cat, while others looks different from the mom and from each other. You remember from your science class that traits are inherited from parents. All BUT ONE of these traits is inherited.

Answers

Answer:

The answer is WEIGHT

Explanation:

Why do you think the size of a white dwarft affects its visual luminosity?

Answers

The bigger the size the more easier to see from a distance and the smaller the harder to see from a distance

Answer:

White Dwarfs are extremely difficult to detect as they are quite small compared to a Star. If the area is small the Luminosity is low, which would make it harder to see the white dwarfs due to the low amount of its luminosity.

Explanation:

Help !!!!!!!!!!!!!!!!!!!!!

Answers

Answer: I would say D or the last answer

Explanation:

When and how were the first trans fats made with vegetable oil?

Answers

Answer:

Artificial trans fat dates back to the early 1900s when German chemist Wilhelm Normann found that liquid vegetable or fish oils could be treated with hydrogen gas to make them solid or semi-solid.

Which of the following college courses would be necessary when obtaining a degree in risk management?
Advanced Decision analysis
Pharmacology
Microbiology
Basic anatomy

Answers

Answer:

A. Advanced Decision analysis

Explanation:

Risk management can be defined as the process of identifying, evaluating, analyzing and controlling potential threats or risks present in a business as an obstacle to its capital, revenues and profits. This ultimately implies that, risk management involves prioritizing course of action or potential threats in order to mitigate the risk that are likely to arise from such business decisions.

Hence, the college course which would be necessary when obtaining a degree in risk management is Advanced Decision analysis because it will help you to measure, analyze and build decisions such as cluster analysis towards risk management and analysis.

Answer:

Advanced decision analysis

Explanation:

I took the quiz on edge

i need help asap please
15 points

Answers

Answer:yes that is right you got it

Explanation:

Answer:

its D

Explanation:

photosynthesis happens with thy sun

plz help I will mark you brainlist plz ​

Answers

Answer:

1. Acid

2.  Acid

3. Acid

4. Base

5. Acid

6. Bases

7. acid

8. base

9. acid ( could be both)  

10. acid

*Anybody correct me if I'm wrong*

Explanation:

The Big Bang Theory is an example of which kind of theory of creation of the
universe?
Expansion
Steady State
Unchanging
Moving

Answers

Expansion is the correct answer
The answer is expansion

When an organism consumes other organisms for food they are?

Answers

Answer:

Consumer

Explanation:

Producer An organism that can make its own food

Consumer An organism that obtains energy by feeding on other organisms

herbivores consumers that eat only plants

carnivores consumers that eat only animals

A consumer because they eat other animals

Some one please help me!!!

Answers

Answer:

time

Explanation:

Answer:

revolution

Explanation:

why producing 1 kg of beef requires much more water than growing 1 kg of potatoes?​

Answers

Answer:

Meat production requires a much higher amount of water than vegetables. IME state that to produce 1kg of meat requires between 5,000 and 20,000 litres of water whereas to produce 1kg of wheat ...

Explanation:

Answer:

compared to beef vegetables require less water like potatoes it takes 287 litres of water

What properties of carbon explain carbon’s ability to form different large and complex structures?

Answers

Carbon is four valence electrons they bond to the other carbon atoms

Which has been observed in the study of embryology?

A.Species whose embryos have similar traits rarely have a common ancestor.
B.Species whose embryos have similar traits always have similar body forms as adults.
C.All traits present in early embryos remain throughout development.
D.Some traits in certain embryos disappear as the embryo develops.

Answers

Answer:

D. Some traits in certain embryos disappear as the embryo develops

Explanation:

I don't know how I would explain it, but I can list some of the things that disappear such as...  Gill slits, and tails. Hope this helped :D

Answer:

D. Some traits in certain embryos disappear as the embryo develops.

Explanation:

Embryology is the study of embryos. Embryos of different animals such as mammals, birds, fish, reptiles etc. look alike that is they are very similar. Many traits of one type of animal appear in the embryo of another type of animal.

why are index fossils useful to geologist

a.they tell the relative age of the rock in which they occur

b. they tell the ages of many different rock layers

c.they tell the age of the rock at one location only

d. they tell the absolute age of the rock in which they occur

Answers

Answer:

Explanation:

Index fossils (also known as guide fossils or indicator fossils) are fossils used to define and identify geologic periods (or faunal stages). Index fossils must have a short vertical range, wide geographic distribution and rapid evolutionary trends.

Index fossil, any animal or plant preserved in the rock record of the Earth that is characteristic of a particular span of geologic time or environment. A useful index fossil must be distinctive or easily recognizable, abundant, and have a wide geographic distribution and a short range through time. Index fossils are the basis for defining boundaries in the geologic time scale and for the correlation of strata. In marine strata, index fossils that are commonly used include the single-celled Protista with hard body parts and larger forms such as ammonoids. In terrestrial sediments of the Cenozoic Era, which began about 65.5 million years ago, mammals are widely used to date deposits. All of these animal forms have hard body parts, such as shells, bones, and teeth, and evolved rapidly.

does fab laundry detergent contain enzymes

Answers

Answer:

yes

Explanation:

almost all detergent has enzymes to help clean

describes natural selection?

Answers

Simply, natural selection is that the genetically strongest organisms will be the ones that are able to survive and reproduce, which eliminates weak characteristics, and keeps the strong ones. Survival of the fittest.

which organelle in the cell maintains homeostasis

Answers

Biology- Cells ( probably not) but worth a try ;)

Would the construction of this master-planned community impact the carrying capacity of the state’s ecosystem?

Answers

Answer:

Are you against or with?

Explanation:

,.;1q23wt4y5eu6ri7ertyur

Which of the following statements is correct? *


Protons are found in the nucleus of an atom

Neutrons are negatively charged

Protons are negatively charged

Electrons are found in the nucleus of an atom

Answers

The correct statement is: Protons are found in the nucleus of an atom.

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC

Answers

Answer:

which are the letters with hightlight yellow?

Other Questions
What is the value of x in the proportion below?57=x21 Describe the unique set of circumstances this generation is experiencing while approaching adulthood.(for gen z) 1. A car accelerates uniformly from 12 m/s to 39 m/s in 12 seconds. What is the car's average acceleration2. A butterfly is flying at 4 m/s. It accelerates uniformly at 1.2 m/s for 6 seconds. How far does the butterfly travel during the period of acceleration? Can someone help on the whole page please... really need help Doyle's narrator frequently addresses the reader directly as you. Why? What do these lines reveal about the writer's imagined AUDIENCE? Brian Doyle "Four Basketball Stories. A fictional world often has more than one ___________, or the state of things that actually exists.A.themeB.realityC.ideaD.plot 1. When the Roman Empire was divided, the western section became known as the Byzantine Empire. ________ 2. The Pax Romana was a 200-year period of peace in the Roman Empire. ________ 3. Germanic tribes, including the Visigoths and Vandals, attacked Rome and helped bring about the empire's downfall. ________ 4. Christian missionaries became less important in the church after the fall of the Western Roman Empire. ________ 5. Romans spread the Latin language throughout Europe and Africa as they gained political power in these areas. If the relationship is proportional, what is the missing value from the table? How many bases does one molecule of tRNA read at one time? consider the equation x/3 +7 =13 what is a equvalent equation using the multipucation property of equlity 20 POINTS!!!!!!! PLEASE HELP ASAP!!!!!!!!!!!!! i need help with this q9 The Zagat Restaurant Survey provides food, decor, and service ratings for some of the top restaurants across the United States. For restaurants located in Boston, the average price of a dinner, including one drink and tip, was . You are leaving on a business trip to Boston and will eat dinner at three of these restaurants. Your company will reimburse you for a maximum of per dinner. Business associates familiar with these restaurants have told you that the meal cost at one-third of these restaurants will exceed . Suppose that you randomly select three of these restaurants for dinner. a. What is the probability that none of the meals will exceed the cost covered by your company (to 4 decimals) What is Washington saying in this quote? He can do anything he wants because he is in a new public office. He knows that he will be leading America as it faces new challenges. He must follow the examples of other presidents. The splashing of the water indicated that there were fishes iin the pond. What type of figure of speech ? 0.6399 round to the nearest tenth Read the excerpt then in at least 150 words, identify the theme that is illustrated in this excerpt from Animal Farm and explain how it is developed in the story.Animal Farm"I do not believe that Snowball was a traitor at the beginning," [Boxer] said finally. "What he has done since is different. But I believe that at the Battle of the Cowshed he was a good comrade."will give 25 points and brainliest if done today"Our Leader, Comrade Napoleon," announced Squealer, speaking very slowly and firmly, "has stated categoricallycategorically, comradethat Snowball was Jones's agent from the very beginningyes, and from long before the Rebellion was ever thought of.""Ah, that is different!" said Boxer. "If Comrade Napoleon says it, it must be right." The swimming pool is open when the high temperature is higher than 20C. Laney tried to swim on Monday and Thursday the pool was open on Monday but it was closed on Thursday the high temperature it was 30C on Monday but decreased at a constant rate in the next three days. What is an any quality to determine the rate of temperature decrease in degrees Celsius per day from monday to thursday Find the area and perimeter of a rectangle if the length is (x+7) and the width is (x+3). To show continuous data such as the amount of rainfall over a period of time, we should use what type of graph? line line bar bar pie pie histogram