Michael Devereux v. United Parcel Service, Inc. - 2011 Tenn. LEXIS 19 (Tenn. Sup. Ct.)
Facts:
Michael Devereux, who is the employee, was a “shifter” for United Parcel Service, Inc., who is the employer. His job involved moving semi-trailers to and from the loading dock of Employer’s package-sorting facility in Whites Creek, Tennessee. He began working for Employer on a part-time basis in 1977, while still in high school. He was terminated in 2006. Mr. Devereux sustained a compensable injury to his left knee in March 2005.
Decision and reasoning

Answers

Answer 1

Devereux's termination was not wrongful as he failed to provide adequate medical evidence showing he could perform job duties with reasonable accommodations.

The Tennessee Supreme Court concluded in Michael Devereux v. United Parcel Service, Inc. that when the employer fired Devereux from his job, neither the Americans with Disabilities Act nor the Tennessee Workers' Compensation Act was broken. Despite having a compensable left knee injury in March 2005, Devereux failed to offer sufficient medical proof that he could carry out his job obligations with acceptable modifications.

As a consequence, it was determined that the employer's choice to terminate his employment was legal. Devereux's lengthy work with the company, which began on a part-time basis in 1977, was insufficient to trump the decision to let him go in this instance.

Learn more about accommodations:

https://brainly.com/question/30793782

#SPJ1


Related Questions

Which of the following is
true about the structure of
state governments?
A. State law can go against the federal government.
B. State law cannot override federal law.
C. State law will never affect the people.

Answers

B. State law cannot override federal law is true about structure of state governments.

State governments in the United States are institutional bodies that perform government tasks at a lower level than the federal government. Each government in the United States has legislative, executive, and judicial jurisdiction over a specific geographic territory.

The United States consists of 50 states: nine of the Thirteen Colonies that were already part of the United States when the Constitution went into effect in 1789, four that ratified the Constitution after its inception, and 37 that have been admitted since by Congress as authorized by Article IV, Section 3 of the Constitution.

State governments, which are structured in accordance with state legislation (including state constitutions and state statutes), follow the same structural paradigm as the federal government, with three branches of government—executive, legislative, and judiciary.

To know more about state government :

https://brainly.com/question/12299619

#SPJ1

I need help with thus test on driving

Answers

The correct answer to the question about distracted driving is: d. Other drivers must react more quickly.

How to explain the information

When a driver is distracted, they may react slower to changes in traffic conditions, such as a car suddenly stopping or a pedestrian crossing the road. This can require other drivers on the road to react more quickly in order to avoid a collision.

Regarding the question about the drop in traffic fatalities per mile traveled in the US between 1970 and 1990, the generally accepted reason is: c. Seat belt use increased.

Learn more about driving on

https://brainly.com/question/1071840

#SPJ1

What are some financial stressors in your life?

Answers

I think this is a personal question?
Give it some thought

Joe, 17 year old teen, dented someone's parked car on accident. He sees cameras on the owners car and possible house and out of gulit left a note with his name and number on it apologizing. The owner of the car finally called and was nice about the situation but wants to discuss how it should be fixed. Joe discussed this with his parents next. They were furious, saying that it was a bad idea and that he should've driven off and left nothing. They don't think they can afford the dent as they don’t have collision insurance. His parents said to never contact the owner of the car again. Joe, not knowing this parents didn't have that type of insurance nor not knowing what to do, he just sits in frustration and confusion.

What should he do?

What should his parents do?

How could this situation in general be solved?

What would happen if Joe didn't try to contact the owner of the car ever again?

(PLEASE ANSWER IN FULL DETAIL)​

Answers

Answer:

Joe did the right thing by leaving a note with his name and number on it to take responsibility for the accident. It shows maturity and responsibility, and it is the ethical thing to do. Even though his parents may have been angry about the situation, leaving the scene of the accident without taking responsibility could have resulted in legal consequences and could have caused more problems in the future.

In this situation, Joe should communicate with the car owner and discuss how the dent can be fixed. He can offer to pay for the damages out of his own pocket, or suggest getting a few quotes from different body shops to compare prices. If the owner agrees to accept payment from Joe, he should get a written agreement or receipt of payment to avoid any legal disputes in the future.

Joe's parents should support him in taking responsibility for his actions and help him find a solution to the problem. They can work together with Joe to find a solution that works for everyone involved, and help him negotiate with the car owner to reach a fair resolution.

In general, situations like this can be solved through open communication and taking responsibility for one's actions. By communicating honestly and openly with the other party involved, it is often possible to find a solution that works for everyone.

If Joe didn't try to contact the owner of the car ever again, it could result in legal consequences. Leaving the scene of an accident without taking responsibility is a serious offense, and could result in criminal charges or a civil lawsuit. It is always best to take responsibility for one's actions and try to find a solution to the problem.

Real estate salespersons' business cards must clearly indicate that they are:

Answers

Real estate salespersons' business cards must clearly indicate that they are licensed real estate salespersons.

Why is this done ?

This is typically done by including the phrase "Licensed Real Estate Salesperson" or a similar designation on the card, along with the individual's name, contact information, and brokerage affiliation.

In some states or countries, there may be specific regulations regarding the exact language or format that must be used on a real estate salesperson's business card. It is important for real estate salespersons to follow these regulations to ensure that they are in compliance with local laws and regulations.

Find out more on real estate at https://brainly.com/question/14775665

#SPJ1

what statute of limitations falsifying business records?

Answers

The statute of limitations for falsifying business records varies depending on the jurisdiction and the severity of the offense.

In general, it can range from one to seven years. It is important to note that falsifying business records is a serious crime and can result in significant penalties, including fines and imprisonment. It is always best to consult with a legal professional for specific guidance on the statute of limitations and other legal matters related to falsifying business records.For example, in New York State, falsifying business records is a Class A misdemeanor, and the statute of limitations is two years from the commission of the offense (New York Penal Law § 30.10(2)(c)).

In California, falsifying business records is a wobbler offense that can be charged as either a felony or misdemeanor, and the statute of limitations for both is three years from the date of the offense (California Penal Code § 802).It's important to note that the statute of limitations may be extended in certain circumstances, such as if the defendant is absent from the jurisdiction or if new evidence comes to light. It's best to consult with a lawyer familiar with the relevant laws in your jurisdiction for specific guidance on this matter.

Learn more about limitations falsifying here:https://brainly.com/question/28435088

#SPJ11

A person is driving and hears a Police siren behind them. They do not know what they have done wrong. What should they do?

Answers

If a person is driving and hears a police siren behind them, they should pull over to the right side of the road and stop the vehicle as soon as it is safe to do so. They should remain calm and wait for the police officer to approach them. It is important to follow the officer's instructions and be respectful. If the person is unsure why they were pulled over, they can ask the officer for clarification. It is important to remember that the police officer is there to ensure everyone's safety, and cooperation can help resolve the situation quickly and smoothly.

The correct and safe thing to do is not panic but pull over, the police officer will most likely tell you what you did but if it’s about something more serious you have the right to remain silent

If private security agents are subject to prosecution in the U. S. Courts, why would the U. S. Want to hire any of these


private security forces?

Answers

Private security agents are subject to prosecution in U.S. courts because they are required to comply with the same laws and regulations as everyone else. However, there may be situations where the U.S. government chooses to hire private security forces for certain tasks or missions.

There are several reasons why the U.S. government might choose to hire private security forces. One reason is that private security forces may have specialized skills or expertise that the government lacks or cannot easily access. For example, private security forces may have experience in providing security in hostile environments or conducting sensitive intelligence operations.

Another reason is that private security forces may be more cost-effective than using government resources. Private security forces are typically hired on a contractual basis, which allows the government to avoid the long-term costs associated with maintaining a standing military or law enforcement force.

To know more about  Court System here

https://brainly.com/question/29615892

#SPJ4

Explain the substantive and procedural protections afforded by the Fourth, Fifth, and Sixth Amendments for defendants charged with crimes today

Answers

Here is an overview of the substantive and procedural protections provided by the Fourth, Fifth, and Sixth Amendments of the U.S. Constitution:

Fourth Amendment: The Fourth Amendment provides protection against unreasonable searches and seizures by the government. This means that law enforcement officials need a warrant or probable cause to search an individual's person, property, or vehicle. This amendment ensures that individuals have a right to privacy and freedom from intrusion by the government.

Fifth Amendment: The Fifth Amendment provides several protections for those charged with a crime. These include the right to remain silent, protection against double jeopardy (being charged for the same crime twice), the right to a grand jury, and due process of law. The Fifth Amendment also prohibits the government from forcing individuals to incriminate themselves, and it requires that the government provide just compensation if property is taken for public use.

Sixth Amendment: The Sixth Amendment ensures that individuals have a fair trial. It provides the right to a speedy and public trial, the right to an impartial jury, the right to have an attorney present, the right to confront witnesses, and the right to call witnesses to testify on their behalf.

Additionally, the Sixth Amendment guarantees that criminal defendants have access to a variety of procedural safeguards, such as a presumption of innocence and proof beyond a reasonable doubt.

Together, these amendments provide important protections for individuals charged with crimes, ensuring that they receive fair treatment under the law and are protected from abuses by the government.
Final answer:

The Fourth, Fifth, and Sixth Amendments provide substantive and procedural protections for defendants charged with crimes today.

Explanation:

The Fourth, Fifth, and Sixth Amendments of the United States Constitution provide substantive and procedural protections for defendants charged with crimes today.

The Fourth Amendment protects against unreasonable searches and seizures. This means that law enforcement must have a warrant based on probable cause in order to search a person, their property, or their belongings.

The Fifth Amendment protects against self-incrimination and double jeopardy. It guarantees the right to remain silent and protects individuals from being tried for the same crime twice.

The Sixth Amendment guarantees several rights for defendants, including the right to a fair trial, the right to confront witnesses, the right to have a lawyer present, and the right to a speedy and public trial.

Learn more about Protections under the Fourth, Fifth, and Sixth Amendments here:

https://brainly.com/question/31534315

#SPJ2

The practice of elicitation refers to obtaining information through which of the following means?

A. Stating incorrect facts and observing the subject's reaction.
B. Asking a series of indirect questions.
C. Making the subject feel relaxed and comfortable.
D. Creating a situation in which the subject perceives that they may be in danger.

Answers

Answer:

B. Asking a series of indirect questions.

Explanation:

The practice of elicitation refers to obtaining information through asking a series of indirect questions.

Option A refers to a technique called deception, where incorrect facts are stated to observe the subject's reaction. Option C refers to building rapport, which can help to establish trust and encourage the subject to share information voluntarily. Option D refers to the use of intimidation or coercion, which is not a recommended or ethical method for obtaining information.

Identify the functions of court systems related to sancturary cities in the resources provided?
senate bill 4 was all that was provided.

Answers

Senate Bill 4 (SB4) is a state-wide law in Texas that is designed to bar sanctuary cities from existing.

This law seeks to do this by requiring local law enforcement officials to cooperate with federal immigration enforcement efforts and to allow the federal government to enforce immigration laws in local jurisdictions. It also requires local officials to act on behalf of federal immigration agents when asked.

This law is intended to deter illegal immigration and punish local governments that choose to ignore federal immigration laws. By including stiff penalties for noncompliance and by allowing the state to pursue legal action against local officials who fail to comply, SB4 is intended to serve as a deterrent to sanctuary city policies. In addition, SB4 also provides a mechanism for the state to monitor and enforce compliance with the law. This includes the ability to take legal action against sanctuary cities if they fail to comply.

To know more about Senate Bill , click here:

https://brainly.com/question/11494587

#SPJ4

Describe the American judicial systems (civil, criminal, and juvenile), their jurisdiction, development and structure.
Analyze the function and dynamics of the courtroom work group.
Identify judicial processes from pretrial to appeal.
Describe the significant Constitutional Amendments, doctrines, and other sources of law in the American judicial system.
Discuss constitutional freedoms and rights of citizens and explain how an ethical criminal justice system and participatory citizenship protects those freedoms and rights
Demonstrate knowledge of the three major areas of America’s criminal justice system (Police, Courts, & Corrections)
Analyze a criminal case and understand its relevance to protected freedoms and rights.
Demonstrate knowledge of fundamental elements of criminal law.
The concept of the courtroom workgroup was introduced in 1977. It was a radical departure from the public’s view of justice in the courts. In this project, students will complete a 5-page research paper that analyzes the effects of the courtroom work group on the criminal justice system.
The structure of your paper should have a good introduction that presents the topic of the paper and a good thesis statement.
The paper will describe and identify the American judicial system and specifically identify the participants and their roles.
The paper will discuss the traditional role of the courts in light of the Constitutional amendments and laws that grant power to the courts and the traditional theory of justice through the courts.
The paper will define the courtroom workgroup, its participants, and analyze the goals of the group.
The paper will compare and contrast the workgroup goals to the traditional goals of justice through the courts and discuss whether justice is truly being served through the machinations of the workgroup.
The paper has a strong conclusion, summarizing the paper and giving an opinion regarding the overall theme.

Answers

The American judicial system is divided into three main categories: civil, criminal, and juvenile.

How does the American judicial system work?

The civil judicial system deals primarily with legal disputes arising between several persons, groups, or companies. These controversies could embody contracts, assets, torts, as well as other qualified issues.

Conversely, the criminal judicial system encompasses offenses against the state or community. This might include activities such as robbery, homicide, aggression, and even narcotics peddling. Both federal and state tribunals fall under the rubric of criminal courts.

Additionally, the juvenile judicial system is specially tailored to manage cases that connect to juveniles being charged with a crime or in need of guidance and security. Faculties of the juvenile justice arena vary from state to state; yet normally cover individuals younger than 18 years of age.

Countless leading principles, historically and juridically, have epitomized the maturation of the United States' judiciary. A structure for government courthouses was ingrained within the US Constitution whereas state constitutions established what became known as state tribunals.

Find out more on the juvenile judicial system at https://brainly.com/question/28945484

#SPJ1

What branch of government do regulatory agencies fall under?.

Answers

Regulatory agencies are part of the executive branch of government. These agencies are responsible for enforcing laws and regulations related to specific industries or areas of governance, such as the environment, public health, and workplace safety. Regulatory agencies are often created by Congress to address specific issues or concerns, and are given a degree of autonomy to carry out their duties. While regulatory agencies are part of the executive branch, they are typically independent of direct control by the President or other executive officials, and are instead overseen by a board or commission. Some examples of regulatory agencies include the Environmental Protection Agency (EPA), the Food and Drug Administration (FDA), and the Occupational Safety and Health Administration (OSHA).

members of congress fill all of the following roles except that of:
a. cabinet members
b. legislature
c. committee member
d. servant of the constitution

Answers

Members of congress fill all of the following roles except that of Cabinet members. The correct option is a.

The Cabinet is made up of appointed leaders of executive departments who offer the President policy advice. On the other hand members of Congress are elected officials who work in the legislative branch of government and are in charge of passing laws and standing up for their constituents.

As part of their duties in the government, members of Congress participate in committee work and have a responsibility to uphold the Constitution. Congressmen are the Constitution's servants. They swear under penalty of perjury to uphold and protect the US Constitution from all enemies both domestic and foreign. The correct option is a.

Learn more about Cabinet members at:

brainly.com/question/11131513

#SPJ4

T/F The United States Court System is very simplistic and easy to follow due to federalism?

Answers

The statement The United States Court System is very simplistic and easy to follow due to federalism is false as  The United States Court System is complex and not necessarily easy to follow due to federalism

The court system is made up of federal and state courts, with multiple levels of courts in each system. Each level of court has different responsibilities and jurisdictions, making the system intricate and challenging to navigate. Additionally, federalism creates the possibility for different interpretations of the law by different state courts, which can create further complexity.

The United States Court System is a complex system consisting of both federal and state courts. The federal court system is made up of the Supreme Court, 13 circuit courts of appeals, and 94 district courts. The state court system varies from state to state, but generally includes trial courts, appellate courts, and a state supreme court. The court system is responsible for interpreting and applying the law, resolving disputes, and ensuring justice is served. The court system plays a crucial role in the American legal system, and its decisions have far-reaching consequences.

To know more about  United States Court System here

https://brainly.com/question/29615892

#SPJ4

What is methodology in research paper

Answers

Introduction:

Methodology is a crucial aspect of any research paper. It involves the systematic and logical approach taken by a researcher in the collection, analysis, and interpretation of data to address the research question or objective. The methodology section of a research paper is a critical part that outlines the methods, techniques, and procedures used to gather and analyze data and how the findings were interpreted to answer the research question. The purpose of this paper is to discuss the importance of methodology in research and how to develop a strong methodology section in a research paper.

Importance of Methodology in Research:

Methodology is essential in research as it helps to establish the credibility and reliability of the research findings. It ensures that the research is conducted in a systematic and logical way, which minimizes bias and errors in the results. Additionally, a strong methodology section enables other researchers to replicate the study and verify the findings, contributing to the advancement of knowledge in the field.

Developing a Strong Methodology Section:

A strong methodology section should provide a detailed description of the methods, techniques, and procedures used to collect and analyze data. It should begin by explaining the research design, which outlines the overall strategy that the researcher used to answer the research question. The research design can be qualitative, quantitative, or mixed methods, and it should be chosen based on the research question, data collection methods, and data analysis procedures.

The next part of the methodology section should describe the population and sampling methods used in the study. The population is the entire group of individuals that the researcher is interested in studying, while the sample is a smaller subset of the population that is used to represent the entire population. The sampling method used should be appropriate for the research design and research question, and it should ensure that the sample is representative of the population.

The data collection methods used in the study should also be described in detail. The data collection methods can be primary or secondary, and they can involve qualitative or quantitative techniques. The researcher should explain how the data was collected, the tools used to collect the data, and any ethical considerations that were taken into account.

The data analysis procedures used to analyze the data should also be described in detail. The analysis procedures can be descriptive or inferential, and they should be appropriate for the research question and data collection methods. The researcher should explain how the data was analyzed, the statistical tests used, and how the findings were interpreted to answer the research question.

Conclusion:

In conclusion, methodology is a crucial aspect of any research paper. It involves the systematic and logical approach taken by a researcher in the collection, analysis, and interpretation of data to address the research question or objective. A strong methodology section is essential in establishing the credibility and reliability of the research findings, enabling other researchers to replicate the study and verify the findings, contributing to the advancement of knowledge in the field. Developing a strong methodology section involves providing a detailed description of the research design, population and sampling, data collection methods, data analysis procedures, and ethical considerations.

Which of the following statements is true about the Patients' Bill of Rights?
The Patients' Bill of Rights is the fifteenth amendment to the U.S. Constitution.
No one universal government statute exists.
The Patients' Bill of Rights is part of HITECH.
The American Hospital Association has a Patients' Bill of Rights that became federal law.

Answers

Answer:

The American Hospital Association has a Patients' Bill of Rights that became federal law.

Explanation:

To protect your private information and medical information

neil broke his leg and spent several days in the hospital. his insurance provider paid his hospital bills directly rather than paying neil. what principle of insurance does this demonstrate?​

Answers

The principle of insurance demonstrated by Neil's insurance provider paying his hospital bills directly, rather than paying Neil, is known as "Indemnity." The principle of indemnity is one of the fundamental principles in insurance, which ensures that the insured is restored to the same financial position they were in before the loss occurred without gaining profit or suffering a loss.

In Neil's case, when he broke his leg and spent several days in the hospital, he incurred medical expenses. His insurance provider, following the principle of indemnity, paid the hospital bills directly to ensure that Neil was not financially burdened by the cost of his medical treatment. This direct payment helps maintain the integrity of the insurance system, prevents any possibility of fraud or misuse of funds, and ensures that Neil is compensated only for the actual loss he suffered.

To summarize, the principle of indemnity is demonstrated by Neil's insurance provider paying his hospital bills directly, which helps maintain the fairness and effectiveness of the insurance system by ensuring that the insured party is restored to their original financial position without gaining or losing money.

To learn more about the principle of indemnity, visit: https://brainly.com/question/11431424

#SPJ11

What was the Court's position on redrawing congressional districts to promote minority interests?

Answers

The Court has generally recognized the need to protect minority voting rights in redrawing congressional districts. This recognition stems from the Voting Rights Act of 1965, which aims to prevent racial discrimination in voting practices.

However, the Court has also set limits on the extent to which redistricting can be done to promote minority interests.
In a series of cases, such as Shaw v. Reno (1993) and Miller v. Johnson (1995), the Court has held that redistricting based predominantly on racial considerations is unconstitutional under the Equal Protection Clause of the 14th Amendment unless it can be justified as a narrowly tailored remedy for past racial discrimination.

In other words, while promoting minority interests in congressional districts is an important goal, the Court has made it clear that this goal cannot be pursued at the expense of other constitutional principles, such as equal protection under the law.

To sum up, the Court's position on redrawing congressional districts to promote minority interests is that it is permissible, but only to the extent that it does not infringe upon other constitutional rights and is a narrowly tailored remedy to address past racial discrimination.

To learn more about  congressional districts, visit: https://brainly.com/question/27644952

#SPJ11

Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.

Answers

The celebrated Mount Lemmon Fire District v. Guido was a momentous United States Supreme Court case which was determined on October 11th, 2018 regarding the comprehension of the venerable Age Discrimination in Employment Act (ADEA).

Mount Lemmon Fire District v. Guido (October 11, 2018) decision and reasoning for the decision.

Two firefighters, John Guido and Dennis Rankin, who were both more than 40-years old, formalized an action against this particular governmental division of the state of Arizona asserting that they had been dismissed due to their age unlawfully in negation of the established ADEA.

However, the District ardently contended that it ought not be subject to the ADEA's edicts since it employed fewer than 20 personnel.

Read more on Mount Lemmon Fire District v. Guido here https://brainly.com/question/26174453

#SPJ1

Analysis of legal signs of genocide. distinguish between genocide and crimes against humanity

Answers

The legal signs of genocide, as defined by the United Nations Genocide Convention, include the intentional and systematic destruction of a national, ethnic, racial, or religious group. This can manifest in a variety of ways, including killing members of the group, causing serious bodily or mental harm to members of the group, imposing measures intended to prevent births within the group, and forcibly transferring children of the group to another group.

Crimes against humanity, on the other hand, refer to a broader category of atrocities committed against a civilian population. This can include acts such as murder, enslavement, torture, sexual violence, and forced displacement. Unlike genocide, crimes against humanity do not require an intent to destroy a specific group but rather are defined by the widespread and systematic nature of the attacks.

In summary, while both genocide and crimes against humanity involve serious violations of human rights and international law, genocide is distinguished by its specific targeting of a particular group for destruction, whereas crimes against humanity are defined by their widespread and systematic nature.

To know more about What is genocide- https://brainly.com/question/23582099

#SPJ11

The legal signs of genocide involve intentionally and systematically destroying a particular racial, ethnic, religious, or national group. According to the United Nations Genocide Convention, genocide includes acts such as killing, causing serious bodily or mental harm, inflicting conditions designed to bring about the group's physical destruction, imposing measures to prevent births, and forcibly transferring children to another group.

Crimes against humanity, on the other hand, encompass a broader range of acts committed as part of a widespread or systematic attack against a civilian population. These acts include murder, extermination, enslavement, deportation, imprisonment, torture, sexual violence, persecution, enforced disappearances, and other inhumane acts. While genocide targets explicitly a particular group intending to destroy it, crimes against humanity can be committed against any civilian population without the requirement of a specific intent to annihilate a particular group.

To distinguish between genocide and crimes against humanity, consider the following steps:
1. Identify the acts committed and the targeted population.
2. Determine if there is a specific intent to destroy a particular group (genocide) or if the acts are part of a widespread or systematic attack against a civilian population (crimes against humanity).
3. Analyze the legal signs of genocide, such as the systematic nature of the acts and the specific methods used to destroy the group.
4. Compare the acts and intentions to the definitions of genocide and crimes against humanity under international law.

In conclusion, the main difference between genocide and crimes against humanity lies in the specific intent to destroy a particular group in the case of genocide. In contrast, crimes against humanity involve a broader range of acts against any civilian population. By analyzing the legal signs and the intentions behind the actions, it is possible to distinguish between these two grave international crimes.

To learn more about genocide, visit: https://brainly.com/question/4266491

#SPJ11

On Halloween night, John and several of his friends decided to pull some pranks at their high school and damaged some of the classrooms. The next morning, school security officers reviewed the security videotapes to see who had done the damage. What will the students be charged with?

Answers

Answer:

The students may be charged with vandalism or malicious mischief, which involves damaging or defacing property without the owner's consent. Depending on the severity of the damage, the charges could be a misdemeanor or a felony. In addition to criminal charges, the students could also face disciplinary action from their school, including suspension or expulsion. It is important to note that vandalism is a serious crime and can have long-lasting consequences for the individuals involved.

Explanation:

How is poverty related to other social problems, such as discrimination, immigration and crime?

Answers

Answer:

Explanation:

Children growing up in poverty are less likely to graduate high school or go to college, and they are more likely to commit street crime. People living in poverty might also migrate in hopes for a better life, some people even do it illegally. They also might be discriminated to ,since they don't have the privilege to wear the best clothes or be the most hygienic. They are also more likely to have several kinds of family problems, including divorce and family conflict

Under the save our homes amendment in florida annual homestead assessment increases are limited to what maximum percentage

Answers

Under the Save Our Homes Amendment in Florida, annual homestead assessment increases are limited to a maximum percentage of 3%. This means that the assessed value of homestead property cannot increase by more than 3% per year, even if the actual market value of the property increases by a higher percentage.

The Save Our Homes Amendment in Florida is a constitutional amendment that was approved by voters in 1992. This amendment provides property tax relief for homeowners in the state by capping the amount that property assessments can increase annually. Specifically, the amendment limits annual increases in the assessed value of homestead property to the lower of 3% or the increase in the Consumer Price Index (CPI). Additionally, the amendment allows homeowners to transfer some or all of their accumulated homestead exemption savings to a new property if they move within the state. Overall, the Save Our Homes Amendment has helped to provide stability and predictability in property tax assessments for Florida homeowners.

Learn more about annual homestead assessment: https://brainly.com/question/30896341.

#SPJ11

in which types of court martial will a private have a right to military counsel

Answers

In the United States military justice system, a private accused of an offense in a court-martial has the right to be represented by military counsel, also known as a military defense lawyer or military defense counsel, in all types of court-martial.

The three types of court-martial are:

Summary Court-Martial: This is the lowest level of court-martial and is typically used for minor offenses. In a summary court-martial, the accused has the right to be represented by military counsel if one is available.

Special Court-Martial: This is a mid-level court-martial and is typically used for more serious offenses. In a special court-martial, the accused has the right to be represented by military counsel.

General Court-Martial: This is the highest level of court-martial and is typically used for the most serious offenses. In a general court-martial, the accused has the right to be represented by military counsel.

In all types of court-martial, the accused has the right to be represented by a military defense counsel, regardless of their rank or position within the military. The military defense counsel is provided by the military and is a trained lawyer who is familiar with military law and court-martial procedures.

Based on Memorandum DM-CI-2020-00085 entitled Guidelines for Work


Immersion Implementation during Crisis Situation, enumerate the schemes wherein


the Work Immersion activities in all tracks can be performed. What scheme is most


appropriate in Pasig City? Why?

Answers

Work immersion activities are designed to provide students with hands on experience in a workplace environment, allowing them to apply the knowledge and skills they have learned in the classroom. There are several schemes that can be used to implement work immersion activities, including the following:

In-house immersion - this involves the student doing the immersion in the same institution where he or she is studying. This can be in the form of laboratory work or on-the-job training within the institution.

Industry immersion - this involves the student doing the immersion in an industry partner of the institution. This can be in the form of apprenticeship, practicum or internship programs.

Community immersion - this involves the student doing the immersion in the community. This can be in the form of service learning or community-based activities.

To learn more about  Memorandum  here

https://brainly.com/question/28393741

#SPJ4

Explain how the New York State Pension System Work

Answers

Your pension is determined by your years of credited service, retirement age, and final average salary (FAS).

FAS is the average of your earnings throughout the last 36 months of service when you earned the most. Typically, this is the last three years of employment.

The New York State Common Retirement Fund is a public pension plan for New York State government employees. It is the third largest public pension plan in the country, with $207.4 billion in assets as of 2018.

The New York State Comptroller's office oversees these assets, which are held on behalf of nearly one million members of the New York State and Local Retirement Systems (NYSLRS). Its one-year return was 11.35% as of March 31, 2018, however its 10-year return was 6.4%.

To know more about pension:

https://brainly.com/question/31215595

#SPJ1

It is a general rule that a foetus is not a legal subject (does not have rights, duties, and capacities). the south african law applies the nasciturus fiction as a legal exception to this rule. discuss the application of the nasciturus fiction as a legal exception in the light of exparte bodel steenkamp 1962 (3) sa 954 (o). write a legal article to discuss this statement and also refer to other applicable case law and other sources of law in the subject.

Answers

A legal theory in South African law known as the nasciturus fiction,  that recognizes the fetus as a legal subject for particular purposes. It is based on the notion that a fetus in utero is assumed to have been born for all purposes provided that it is subsequently born alive and advantageous to it.

As opposed to being a rule of law, the nasciturus fiction is a legal presumption that can be disproved by evidence. Exparte Bodel Steenkamp, a case where the unborn child had a right to inherit from its mother's estate, is one instance where this is acknowledged in South African case law.

The nasciturus fiction is also acknowledged in South African legal statutes, such as the Intestate Succession Act, which states that a child born alive after the death of an intestate person who was conceived before their death is entitled to inherit from their estate. An example of how the nasciturus fiction has been used in South African law is the case of Exparte Bodel Steenkamp 1962 (3) SA 954 (O).

Learn more about Succession Act at:

brainly.com/question/12408045

#SPJ4

What is the STR found within the DNA sequence? TCATGCGATGATGATGATGATCGCT


A. CAT


B. GCG


C. ACG


D. GAT

Answers

The STR (short tandem repeat) found within the DNA sequence is "GAT", which is repeated five times in a row. The correct option is D.

In the given DNA sequence "TCATGCGATGATGATGATGATCGCT" The term "STR" stands for "Short Tandem Repeat" which is a nucleotide sequence that repeats. A section of DNA known as an STR is made up of a few nucleotides that are repeated in tandem. The repeated sequence in the given sequence "GAT" appears five times in a row. In forensic science repeating sequences are frequently used to identify people.

It is a particular area of DNA where a short nucleotide sequence repeats several times in a row. Individuals can differ in the number of repeats, which is used as a distinctive genetic marker for identification. The analysis of STRs is used in DNA profiling and genetic fingerprinting to ascertain an individual's genetic make up. The correct option is D.

Learn more about Short Tandem Repeat at:

brainly.com/question/29661522

#SPJ4

1. Review the following quote and summarize the meaning into your own words using concepts and details from the lesson. Make sure to include why environmental laws and protections are needed and what they aim to accomplish.



Man’s attitude toward nature is today critically important simply because we have now acquired a fateful power to alter and destroy nature. But man is a part of nature, and his war against nature is inevitably a war against himself.



- Rachel Carson (1907-1964)





2. Choose and research three federal laws or environmental events from the list below.



Rank your choices in order of importance using your research and opinion.



Explain each event or law chosen for your list.



For your #1 choice also include an explanation of why you chose it for the top of your list. Selected Modern Environmental Events



1962: Silent Spring published by Rachel Carson



1964: Wilderness Act



1969: Cuyahoga River in Ohio caught fire



1970: National Environmental Policy Act (NEPA)



1970: First Earth Day (April 22)



1970: Environmental Protection Agency founded



1970: Clean Air Act



1972: Clean Water Act



1973: Endangered Species Act



1979: Three Mile Island Nuclear Accident



1980: CERCLA (Superfund)



1989: The Montreal Protocol



1989: Exxon Valdez Disaster



2010: BP oil spill in the Gulf (Deepwater Horizon)

Answers

Rachel Carson’s quote highlights the importance of environmental protection. Environmental laws and protections are needed because humans have acquired the power to alter and destroy nature. However, humans are a part of nature, and their war against nature is inevitably a war against themselves.

Some important federal laws or environmental events related to environmental protection include the National Environmental Policy Act (NEPA), Clean Air Act, Clean Water Act, Endangered Species Act, and Superfund.

The NEPA was enacted in 1970 and requires federal agencies to consider the environmental impact of their actions before making decisions. The Clean Air Act was enacted in 1970 and regulates air emissions from stationary and mobile sources. The Clean Water Act was enacted in 1972 and regulates discharges of pollutants into the waters of the United States. The Endangered Species Act was enacted in 1973 and provides for the conservation of threatened and endangered species. The Superfund was enacted in 1980 and provides for the cleanup of hazardous waste sites.

Learn more about NEPA: https://brainly.com/question/28564221.

#SPJ11

Other Questions
if the t-bill rate is 7%, what are the alphas of the two stocks? (negative values should be indicated by a minus sign. do not round intermediate calculations. round your answers to 2 decimal places.) 3) Graph polygon G(-3,-2) R(-4,4) E(0,1) A(1, -2) T(-1, -3) and its image GREAT=R (GREAT) Cause then you'd only get one answer to study. Now back to thea collection of facts,Numbers, measurements and things like that. conclusionestimatedata A model airplane flew the distance of 330 feet in 15 seconds. Select ALL the unit rates that are equivalent to the speed of the model airplane. Which theme is evident in the passage?A. One must appreciate good onstage acting at the theater. B. People tend to shy away from things that are unfamiliar. C. People experience different phases in their lifetime. D. One must accept that there is suffering in human life Match the rhetorical device to its definition.MatchTermChiasmusSynecdocheAntithesisIronyDefinitionA) The expression of ones meaning by using language that normally signifies theoppositeB) The juxtaposition of opposing or contrasting ideasC) A figure of speech in which a part is made to represent the whole or visa versaD) An inverted relationship between the syntactic elements of parallel phrases Identify the gap/s in existing academicliterature/research on celebrity endorsement advertisement inAustralia. EASY QUESTIONS (50) POINTS (answer ALL please)Experiment: Use the Gizmo to find the carrying capacity with Ample, Moderate, and Little land. List the carrying capacities below. Ample: Moderate: Little: Analyze: How did the amount of space available to the rabbits affect how many individuals the environment could support? Two circles, C1 and C2, intersect at point A and B. Passes through the center O of circle C2. The point P lies on circle C2 so that the line PAT is target to circle Ci and point A. Let APB =. In STU, t = 3. 4 cm, u = 6. 9 cm and S=21. Find the area of STU, to the nearest 10th of a square centimeter. For problems 3,4, and 5, Consider an egg that has a mass of 0. 15 kg being held at the top of a flight of stairs. 3. If an egg has 11 J at the top of the stairs, what is the height of the stairs? 4. If the egg is dropped from that height, what is the Kinetic energy right before the egg hits the ground?5. If the egg is dropped down to the ground from that height, what is the velocity of the egg right before the egg hits the ground? Solve the following system of equations. The attempt to interfere with a persons autonomy by preventing one from making a rational, fully informed and voluntary choice and acting instead on misleading information or emotional appeals" is the definition of a. price gouging. b. deceptive advertising. c. product liability. d. business ethics. Supervisor: "Given the parameters of the budget, will you be able to provide rewardsfor the team?"Yes, I will be sure to apply all of the cost-cutting measures laid out in the budget.Yes, I believe I can still afford all the rewards even with the limitations of the budget.Yes, because there are no limits I will be able to reward all of my team members.Yes, the exceptionally flexible budget will allow me to reward all of my team members.Yes, I will be able to provide rewards within the time constraints discussed in the budget.NEXT What can the reader conclude from the interaction between the pitiching coach and cameron varga 2) With which of management's assertions with respect to implementing internal controls is the auditor primarily concerned?A) efficiency of operationsB) reliability of financial reportingC) effectiveness of operationsD) compliance with applicable laws and regulations What was the average amount of books read per student according to the histogram below? In a survey conducted by a retail store, 58% of the sample respondents said they prefer to shop at places with loyalty cards. 96If the margin of error is 3. 4%, the expected population proportion that prefers to shop at places with loyalty cards is betweenand%. Let z be a random variable with a standard normal distribution. Find the indicated probability. (Enter a number. Round your answer to four decimal places. )P(z 1. 41) = How was the old seaman different from other ordinary seamen