*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer 1

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer 2

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC


Related Questions

28. Which of the following is most likely to cause the greatest disruption to an ecosystem?

Answers

Answer:

Emptying an aquarium containing non-native species into a local waterway will most likely to cause the greatest disruption to an ecosystem. A non-native species can be invasive and may disturb the already living native species in the waterway.

Explanation:

Answer:

Emptying an aquarium containing non-native species into a local waterway

Explanation:

Which of the following best describes what is represented by the arrows in the food web?
A
The photosynthetic rates of producers
B
The flow of energy
С
The movement of predators
D
The decomposition of matter

Answers

Answer:

B

Explanation:

Arrows show the flow

where in the chloroplasts is the chlorophyll located; thylakoid/grana or stroma?

Answers

it is located in the thylakoid

Give the symbols for the element that makes up each of the following:

______Carbohydrates.______ Lipids. _____DNA. _____Proteins.

Answers

Answer:

The correct answer is :

1. CHO

2. CHO

3. CHONP

4. CHON

Explanation:

Carbohydrates are composed of the carbon, hydrogen, oxygen in the ration of 1:2:1 which means hydrogen atoms are double than oxygen and carbon atoms. Carbohydrates are also known as sugars or polymer of sugars.

Lipids are composed of long chains of fatty acids made up of carbon, hydrogen, and oxygen molecules that are insoluble however ade up of organic molecules.

DNA or deoxyribose nucleic acid is the basic unit of cell and known as genetic material. It is made up of ribose sugar, a nitrogenous base, and phosphate backbone so elements that make these nutrients are Carbon, hydrogen, and oxygen with nitrogen and phosphorus.

Proteins are made up of amino acids that have carbon, hydrogen, oxygen, and nitrogen element in them.

The 4 macromolecules are namely Carbohydrates, Proteins, Nucleic acids, and Lipids. The composition of each macromolecule is defined by the elements present.  

The symbols for the element that makes up each macromolecule are listed below:

Carbohydrates-H, C, and O(Hydrogen, Carbon, and Oxygen) Lipids-H, C, and O(Hydrogen, Carbon, and Oxygen) DNA-O, H, N, C, and P(Oxygen, Hydrogen, Nitrogen, Carbon, and Phosphorus) Proteins-O, H, C, and N(Oxygen, Hydrogen, Carbon, and Nitrogen)  

Thus, the symbols of the element that make up Carbohydrates, Proteins, Nucleic acids, and Lipids are defined.  

Learn more about macromolecules here:

https://brainly.com/question/6849865

Which of the following is the classic hot and dry desert?
a. arid desert
b. coastal desert
C. cold desert
d. none of the above
Please select the best answer from the choices provided
B
ОООО
С
D

Answers

Answer:

A

Explanation:

Among the options given, the arid desert represents an example of the classic hot and dry desert. Thus, the correct option for this question is A.

What are the characteristics of the hot and dry deserts?

Hot and dry deserts have extremely hot climates and challenging environments. There is very little biodiversity in hot deserts because of the harsh climate. Few species are specialized enough to survive there. Apart from this, the climate is very dry with less than 250 mm of rainfall a year.

According to the context of this question, cold deserts have extremely low temperatures and snowfall. While coastal deserts occur in cool to warm areas along the coast. They have cool winters and long, warm summers. Coastal deserts are located on the west coasts of continents between 20° to 30° latitude.

Therefore, the arid desert represents an example of the classic hot and dry desert. Thus, the correct option for this question is A.

To learn more about Hot and dry deserts, refer to the link:

https://brainly.com/question/29325670

#SPJ5

help asap due in 10 minutes​

Answers

Answer:it's a producer bro

Explanation:

Which organs are part of the musculoskeletal system? Select all that apply.

bones
hair
muscles
skin
tendons
nails

Answers

muscles, tendons and bones

A, The largest part of the leg. B, Connects muscle to bone. C, Fills space between bones. D, Connects bone to bone. E, Skeletal part of the leg.

A:

B:

C:

D:

E:

Answers

Answer:

a:muscle

b:tendon

c:cartilage

d:ligament

E:bone

Explanation:

The largest part of the leg is muscle, tendon connects muscle to bone, cartilage fills space between bones.

What are bones?

Bone is a solid bodily tissue made up of cells encased in a lot of dense intercellular substance. Collagen plus calcium phosphate, the two main components of this substance, set bone apart from other hard tissues like chitin, enamel, or shell. The individual bones that constitute the human spine or the skeletons of many other vertebrates are composed of bone tissue.

The mechanical stress of soft tissues, like the muscles contracting as well as the expansion the lungs, requires structural support from bone. Bone also protects soft tissues and organs, like the blood-forming system, and serves as a protective place for specialized tissues.

The largest part of the leg: muscle

Connects muscle to bone: tendon

Fills space between bones: cartilage

Connects bone to bone: ligament

Skeletal part of the leg: bone

Therefore, the largest part of the leg is muscle, tendon connects muscle to bone, cartilage fills space between bones.

To know more about bone, here:

https://brainly.com/question/30902001

#SPJ3

true or false: 1. T F Cities are usually colder than their surrounding regions. 2. T F Climate has no effect on the formation of soil. 2.T F Mangroves are a keystone species. 3. T F The brackish water of estuaries does not support a diversity of marine life. 4. T F Large browsing animals are abundant in chaparral. (O​

Answers

Answer:true

It is true

Explanation:

Answer:

Yup it's True!

Explanation:

State the aim of the investigation.​

Answers

Answer:

It is confusing so here: An aim identifies the purpose of the investigation. It is a straightforward expression of what the researcher is trying to find out from conducting an investigation.

Explanation:


What is the purpose of cellular respiration?
A To get rid of carbon dioxide
B To get take in oxygen
To take in sugar
D) To convert food to energy

Answers

D) to convert food to energy

Cellular respiration is the mechanism of breakdown of food materials within the cell to release energy

Answer:

To convert food to energy

Explanation:

please come in comment

The lab setup shows four test tubes. Tube 1 contains water only. Tube 2 contains a live snail. Tube 3 contains a live green water plant. Tube 4 contains both a live green water plant and a live snail.

In this setup, which tubes contain at least one organism carrying on cellular respiration?
A) Tubes 1 and 2 only.
B) Tubes 2 and 4 only.
C) Tubes 3 and 4 only.
D) Tubes 2, 3, and 4 only.

Answers

Answer:

D

Explanation:

What role does cellular respiration play in the carbon cycle?
It removes CO2 from the atmosphere during glycolysis.
It removes CO2 from the atmosphere during the citric acid cycle.
It releases CO2 to the atmosphere during acetyl CoA formation.
lt releases CO2 to the atmosphere during electron transport.

Answers

It releases carbon dioxide into the environment during acetyl COA formation

Answer:

c

Explanation:

how is the igneous rock formed

Answers

Answer:

Igneous rocks are formed when magma solidifies and cools down.

through cooling and solidification of magma or lava

What could create the need for a secondary succession?
i need the answer

Answers

Answer:

Particularly common types of secondary succession include responses to natural disturbances such as fire, flood, and severe winds, and to human-caused disturbances such as logging and agriculture. In secondary succession, the soils and organisms need to be left unharmed so there is a way for the new material to rebuild.

Answer:

Because you never wait.

Explanation:

Because this is correct.

HELLLLPPP PLEASEEEEE!!!!
Which is an organelle that performs photosynthesis and is paired with its correct function?
A) Chloroplast-converts light energy into chemical energy.
B) Chloroplast-converts chemical energy into light energy.
C) Mitochondrion-converts cellular energy into glucose chemical energy.
D) Mitochondrion-converts energy found in glucose into energy for cells.

Answers

Answer:

A

Explanation:

Plants absorb the light and turn it into chemical energy with the help of chloroplasts

Chloroplast is the organelle in the plant cell which converts light energy into chemical energy. Chloroplast performs photosynthesis. Thus, the correct option is A.

What is Chloroplast?

A chloroplast is a type of membrane-bound organelle which is known as a plastid which conducts photosynthesis mostly in the plant cells and algal cells. Chloroplast are the organelles which convert the light energy into chemical energy in the form of carbohydrates (sugar). The photosynthetic pigment chlorophyll is present in the chloroplast which captures the energy from sunlight, converts it, and stores it in the energy-storage molecules such as ATP and NADPH while freeing up the oxygen molecule from water in the cells.

Chloroplast is the double membranous organelle which is present in the plant cells and certain algal cells. This organelle is absent in the animal cells. Thus, they cannot perform photosynthesis.

Therefore, the correct option is A.

Learn more about Chloroplast here:

https://brainly.com/question/11136550

#SPJ6

The largest organ in the body is the

Answers

Answer:

the skin

Explanation:

it's the largest organ

Answer:

Skin

Explanation:

Skin carry some 8pounds and 22square feet

action of pancreatic juice
a_chemical transformation
b_mechanical transformation ​

Answers

Answer:chemical

Explanation:

Which of the following is a symbiotic relationship where one partner benefits and the other does not benefit or lose from the relationship? ​

Answers

Answer:

Commensalism

Explanation:

Organisms may contain up to five levels of organization within their bodies. Which level of organization is best represented by the liver?
tissue
organ
organism
organ system

Answers

Answer:

I cann confirm, I just finished the test and the answer is tissue!

The level of organization is best represented by the liver is tissue. The correct option is a.

What is a tissue?

In biology, tissue is described as a collection of cells that share a common structure and serve a single purpose. French is where the word "tissue," which means "to weave," comes from.

Tissue is a collection of cells with a common structure and function that work as a single unit. The body's tissues give it shape and aid in energy storage and heat retention. Connective tissue, epithelial tissue, muscle tissue, and nervous tissue are the four different types of tissues.

The hierarchy of intricate biological systems and structures that, in a reductionistic manner, define life is known as biological organization. The conventional hierarchy goes from atoms to biospheres, as shown in the details below.

Therefore, the correct option is a. tissue.

To learn more about tissue, refer to the below link:

https://brainly.com/question/16801464

#SPJ2

The channels in cell membranes that help substances to move in and out
of cells during active transport are made of
A. protein.
B. chlorophyll.
C. cytoplasm
D. carbohydrates.

Answers

Answer: proteins

Explanation:

The 6 kingdom system of classification enables biologists to group organisms according to

Answers

Answer:

The correct answer is -a  common characteristic (in a logical manner)

Explanation:

The six kingdom classification is given by Woese et al 1977, the basis of this classification was the shared characteristic of organisms. These common characteristics include more than one character such as cell type ( prokaryotic or eukaryotic), type of nutrients (autotrophs, heterotrophs), type of reproduction, homologous or analogous organs, habitat, and many more.

All these traits or characters helped in grouping organisms in a logical manner and is one of the most acceptable classifications.

Thus, the correct answer is -a  common characteristic (in a logical manner)

true or false a homologous structure serves no funtion

Answers

Answer:

I think its true ..... ...

false. homologous structures have functions.
vestigial structures are the ones that serve no function.

Structure that organizes motion of the chromosomes?

Answers

Answer:

Structure that organizes motion of chromosomes. Cytoplasm. Material in cell; contains chemical wealth: sugars, amino acids, and proteins a cell uses to carry out everyday activites. Vacuole. Saclike structure (large in animal cell); stores water, salts, carbs, and proteins. Plays a role in disposing waste.

Explanation:

There are various structures that are found present in a cell. And these structures have peculiar functions they carry out in the cell. Chromosomes are found in the nucleus of a cell. During cell division there is the needed movement of the chromosomes.

The structure that organizes motion of the chromosomes is the centriole

The centriole is a structure found in the animal cells near the nucleus that aid in the movement of chromosomes through the action of the microtubule and spindle fibres. They help to assemble these microtubules and spindle fibres to aid movement of chromosomes.

Learn more: https://brainly.com/question/24552946

a pie chart is used when
a. comparing quantities between different groups
b. showing change over time
c. comparing quantity totals
d. comparing parts of a whole quantity

Answers

Answer:

c. comparing quantity totals

Answer:

c. comparing quantity totals

Explanation:

anyone know what this would be?​

Answers

Answer:

It would be true

Explanation:

predation in your own words!!

Answers

Answer:

Its an interaction where one organism, the predator, kills and eats another organism, its prey

Explanation:

the Attacking of something on others

List three ways you can reduce water pollution.

Answers

Pick up after pets, plant trees, reduce plastic usage

Answer: One way to reduce water pollution is to not pour any harmful chemicals down your sink. Also avoid plastic, this can be very harmful! The last way that I will state is to help clean up beaches and/or lakes. When you help clean up it will lessen the chances of trash slipping back into the water.

Read this sentence from "The Man in the Arena".

"There is little use for the being whose tepid soul knows nothing of, great and generous emotion, of the high pride, the stern belief, the lofty enthusiasm, of the men who quell the storm and ride the thunder."

How does the sentence develop Roosevelt's claim?
A.
It dismantles the power that the critics attempt to hold over those who are in the arena.
B.
It belittles the critics and the doers for their tepid souls.
C.
It supports the unification of the critics and the doers.
D.
It empowers the critics to keep their antics going and discourage the doers of good deeds.

Answers

It dismantles the power that the critics attempt to hold over those who are in the arena.

The answer is option A.

What is the man on the court saying?

My favorite quote, as well as LeBron James' favorite, quotes "Man in the Arena" from Teddy Roosevelt. It goes like this: He’s not a public critic; not someone who points out how a powerful person stumbles, or where the perpetrator could have done better.

What is the meaning of the man in the arena?

A person who is deeply involved in a situation that requires courage, skill, or stamina, unlike someone who sits on the sidelines and watches, is often referred to as a "field man".

Learn more about Roosevelt here: brainly.com/question/2066305

#SPJ2

What is the boundary that
separates a cell from the inside and outside environment?

Answers

cell membrane, The cell membrane forms a boundary that separates the cellular contents from the outside environment. The cell membrane is capable of receiving and recognizing chemical signals. The cell membrane forms a barrier that keeps all substances that might harm the cell from entering the cell. (Pls mark me as brainliest!)

Answer:

plasma membrane

The plasma membrane (often called the cell membrane) is a thin flexible barrier that separates the inside of the cell from the environment outside the cell and regulates what can pass in and out of the cell. Internally, the cell is divided into the cytoplasm and the nucleus.

Explanation:

HOPE IT HELP U MAKE ME A BRAINLIST PLEASE
Other Questions
What does the next consecutive odd number afteranother odd number mean? Thanks Summarize the political philology of jonh Locke. Read the passage below from Marigolds and answer the question.I had indeed lost my mind, for all the smoldering emotions of that summer swelled in me and burstthe great need for my mother who was never there, the hopelessness of our poverty and degradation, the bewilderment of being neither child nor woman and yet both at once, the fear unleashed by my fathers tears. And these feelings combined in one great impulse toward destruction.Based on the passage above, which of the following themes are evident in the story?-loss of innocence-good overcomes evil-value of family-love and sacrifice When a hair dryeris being used, one of the energy transformations that takes place is Amaterasu, the sun goddess, once shared the sky with her brother,Tsukuyomi, the god of the moon. Then, Tsukuyomi killed the goddessof food. Amaterasu grew to hate her brother and separated herselffrom him; thus, day and night became divided.Which common motif from mythology is most clearly shown in the story?A. Physical transformationB. Explanations of natureC. The hero's journeyO D. The dangers of arrogance What did many people base their views on during the Enlightenment? A:Faith B:emotions C:astrology D:Reason Oate's expedition suffered from ________ bad reputation.a.Cabeza de Vacasc.Hernando de Sotosb.Fray Marcos de Nizasd.Coronados Coral reefs are the most diverse of all marine ecosystems. They are home to almost one quarter of all ocean species. Coral reefs are also important to people, providing food, protection of shorelines, tourism jobs, and even medicines. However, this is a fragile ecosystem, threatened by human activity and environmental changes. Which of these threats is not caused by abiotic factors? A) Coral reefs are affected by overfishing. B) Coral reefs are affected by changing ocean chemistry. C) Coral reefs are affected by global warming due to increases in greenhouse gases. D) Coral reefs are affected by pollution due to runoff of chemicals into the ocean. Find the value of c so that (x+1) is a factor of the polymonial p(x)=5x^4+7x^3-2x^2-3x+c New immigrants to the United States during the late 19th century and early 20th century were from centralEurope.True or false? Payback period computation; even cash flows LO P1Compute the payback period for each of these two separate investments:a. A new operating system for an existing machine is expected to cost $520,000 and have a useful life of six years. The system yields an incremental after-tax income of $150,000 each year after deducting its straight-line depreciation. The predicted salvage value of the system is $10,000.b. A machine costs $380,000, has a $20,000 salvage value, is expected to last eight years, and will generate an after-tax income of $60,000 per year after straight-line depreciation.Payback periodChoose Numerator: / Choose Denominator: = Payback period / = Payback perioda. = b. = A line contains the points -1 , -4 and -6,11 what is the slope of a line that is parallel to this line What were explorers like Christopher Columbus looking for when they sailedacross the Atlantic? 1. find the distance between the points (-4,-6 ) and (8,5) to the nearest 100th of a unit. *(3 Points)16.2616.3216.28 As the landscape changed from brown to green, the army awakened and began to tremble with eagerness at the noise of the rumors. theme in How to Be Chinese Which choices represent the purpose for the Committees of Correspondence? PLEASE HELPWhich graphs display a directly proportional relationship? Check all that apply.On a coordinate plane, a line goes through points (0, 0) and (1, negative 3).On a coordinate plane, a line goes through points (0, 1) and (1, 2).On a coordinate plane, a line goes through points (0, 0) and (1, 3).On a coordinate plane, a line goes through points (0, 0) and (2, 2). HELP I SUCK AT MATH HELP ASAP PLZZZ!!! GIVING BRIANLIEST AND POINTS.Henry is starting a t-shirt printing business and plans on selling each shirt for $30, with his cost being $8 per shirt. The equipment will cost $1200.Henry orders 600 shirts and determines that the profit for his new business is modeled by the function p = 22x - 1200. What is the range of this function in this context? A) {0 p 500} B) {0 p 500} C) {-1,200 p 2,000} D) {-1,200 p 12,000} An earthworm lives and reproduces in the soil. It aerates the soil and adds organic material to it. The earthworm is a source of food for other organisms. All of these statements together best describe please answer quick (1) a habitat(2) autotrophic nutrition(3) an ecological niche(4) competition