Laura bought some tacos for her and her friend to split. She paid a total of $7.08 for 12 tacos. What was the cost of each taco

Answers

Answer 1

Answer:

its 0.59

Step-by-step explanation:

Because if you divide 7.08 and 12 then you get the answer.


Related Questions

Find the area.I will mark the BRAINIEST

Answers

Answer: C. 64 ft

Step-by-step explanation:

please help with question down below!

Answers

the area of one base is 121 cm^2 so if you multiply that by 6 the final answer should be 726 cm^2

63/8 as a mixed number

Answers

Answer:

7 7/8

Step-by-step explanation:

someone please help me!

Answers

Answer:

x = 13

Explanation

The graph represents the number of bike paths planned for the cities of Nashville and Houston. The number of paths to be built in Houston is modeled by y = 4(2)x, and the number planned for Nashville is modeled by y = 4x. According to the graph, which statement is true about this situation? A) The number of paths planned for Nashville is increasing exponentially. B) The number of paths planned for Houston is represented by the green line. C) The number of paths planned for Nashville is represented by the green line. D) The number of paths planned for Nashville will more than likely exceed the paths in Houston as the value of x increases.

Answers

Answer:

C

Step-by-step explanation:

Answer:

C. The number of paths planned for Nashville is represented by the green line.

Step-by-step explanation:

Nashville is y=4x, so if you graph that in desmos, you will see the line for Nashville is the same as the green line in the question.

Two- one foot rulers laid end to end on reach how many inches?

Answers

24.

1 ruler is 12 inches.

2 rulers is 24 becuase

12 + 12 is 24.

If 1/5 = 2/3, then ?/5 = 3/3. Show your work and explain your reasoning.

Answers

Answer:

3/10

Step-by-step explanation:

If 1/5 = 2/3 then 1/10 = 1/3

So given that information, 3/10 = 3/3

Hope this helps!

can you pls help!!!!??!?!?!,!

Answers

What angle do u need to know?

Plss help ! I will give you brainliest

Answers

Answer:

16 + -16 -4 ( 20 ) - 6)

Step-by-step explanation:

here is answer

Answer:

16 + -16 -4 ( 20 ) - 6)

Step-by-step explanation:

Please mark me brainliest

select all of the expressions that are equivalent to 4(5x+2y)

Answers

Answer:

Where are the expressions?

Step-by-step explanation:

Answer:

Step-by-step explanation:

Which minor scale has 3 flats

Answers

Answer:

C Minor

Step-by-step explanation:

Felix puts 6000 into saving bonds that pay a simple interest rate of 4.4 how much money will the bonds be worth at the end of 6 years

Answers

Answer:

$7,584

Step-by-step explanation:

The computation of the amount worth at the end of 6 years is shown below:

As we know that

SImple interest = Principal amount × rate of interest × time period

= $6,000 × 4.4% × 6

= $1,584

Now the amount at the end of 6 years is

= Principal amount + simple interest

= $6,000 + $1,584

= $7,584

Hence, the amount would be $7,584

the number of miles to the nest service station and the number of kilometers

Answers

Answer:

<3  

Step-by-step explanation:

is a linear relationship as the are 1.6 Km in 1 mile .

The radius of a circle is 4 feet. What is the length of a 90° arc? HELP ME PLEASE

Answers

Answer:

6.3feet

Step-by-step explanation:

Given data

Radius= 4feet

The expression for the circumference of a circle is

C= 2πr

Substitute

C=2*3.142*4

C=25.136 feet

Also, a 90° arc is 1/4 of the circumference of a circle

Hence the length of the 90° arc is

=25.136/4

=6.284 feet

=6.3feet

Salma made 378 for 18 hours of work.
At the same rate, how much would she make for 5 hours of work?
Please help me answer this question!

Answers

Answer:

Sorry, I can't help you with that :( I hope someone else can tho!

Step-by-step explanation:

The area of the rectangle below is 18 square units and the length is 3 3/4 .What is the width of the rectangle?

Answers

Answer:4.8

Step-by-step explanation:18/3.75=4.8

If Greg Has 15 Jars of Cookies, and there are 143 cookies IN TOTAL how many cookies are left over after EQUALLY distributing them.

WILL GIVE BRAINLIEST!!!!!!

Answers

Answer:

8 cookies left over

Step-by-step explanation:

use long division.

divide 143 by 15.the remainder is 8

The diagram below shows some 1-inch cubes placed in a box.
5 in.
1 in.
4
in.
I
-8 in.
How many more 1-inch cubes are needed to completely fill the box?

Answers

Answer:

Step-by-step explanation:

i need help plz help me

Answers

Answer:

B. 6 x 1.05

Step-by-step explanation:

Answer:

do 6 * 1.05 and that will be your answer if any other questions please

Hey! Please help me with this kahn question
thanks!

Answers

Answer:

[tex]z^{11}[/tex]

Step-by-step explanation:

add 5 and 6 because they have the same base z

find the solution to the system of equations

Answers

Answer:

(-2,0)

Step-by-step explanation:

The solution is where the two graphs intersect.

Multiply.
-0.2(24)=

-100(-9.287)

Answers

Answer:

-0.2(24)= -4.8

-100(-9.287)= -9.287

Jaspar has a lemonade stand. One glass of lemonade has 4950 milligrams of sugar. One weekend, he sells 87 glasses of lemonade. How many grams of sugar does Jasper use that weekend?

Answers

Answer:430650

Step-by-step explanation: all you do is multiply 87 x 4950.

List all the transformations for the following equation.

Answers

Answer:

flipped over the x-axis

horizontal shift left 7 units

vertical shift down 6 units

Step-by-step explanation:

A restaurant sells large and small bowls of soup. A 150-ounce pot of soup can make 10 large bowls. A small bowl of soup is 3/5 the size of a large bowl. How many small bowls of soup can be served from a 108 once pot of soup

Answers

12 small bowls of soup can be served from a 108 ounce pot of soup

150-ounce pot of soup can make 10 large bowls. Hence:

Number of ounce in each large bowl = (150 / 10) = 15 ounce per bowl

For 108 ounce pot of soup:

Number of bowls = 108 ounce / (15 ounce per bowl) = 7.2 large bowls

1 small bowl =  (3/5) large bowl

7.2 large bowl = 7.2 large bowl / (3/5 large bowl per small bowl) = 12 small bowls

Therefore, 12 small bowls of soup can be served from a 108 ounce pot of soup.

Find out more at: https://brainly.com/question/21105092

A school club is raising money for a trip, and needs to reach $10,000. Their fundraising progress is modeled by the function

f(x) = 435 + 1200x, where x is measured in weeks.


What is the meaning of the coefficient 1200?

Answers

Answer:

maybe the amount of money by each student

Which temperature is warmer, -2 degrees Celsius, or -5 degrees Celsius?
-2
-5

Answers

Answer:

-2 is warmer the -5 degrees

Answer:

-2 Celsius

Step-by-step explanation:

The negative degrees in Celsius work the same way as Fahrenheit

The closer the number is to 0 the warmer the temperature is... -2 is closer to 0 than -5

Helppp do any understand rhis ?

Answers

110+45= 155
180-155=25
x=25

Answer:

x= 25 degrees

Step-by-step explanation:

A triangle has a total of 180 degrees.

110 degrees + 45 degrees = 155 degrees

180 degrees - 155 degrees = 25 degrees

Question 3 of 10
What is the formula for finding the break-even point?
A. Break even point =
(0.125)(# of points)
monthly savings
B. Break even point =
(0.01)(# of points) (P)
monthly savings
C. Break even point =
(0.125)(# of points) (P)
monthly savings
D. Break even point =
(0.01) (# of points)
monthly savings
SUB

Answers

Answer: B. Break even point=(0.01)(# of points)(P) / monthly savings

Step-by-step explanation: took the quiz.

The formula for finding the break-even point is: Break-even point = Fixed costs ÷ (Unit price - Variable costs per unit).

What is break-even point?

The break-even point is the point at which a company's total revenue from sales equals its total costs, resulting in a profit of zero. There is no profit or loss at the break-even point.

The formula for finding the break-even point is:

Break-even point = Fixed costs ÷ (Unit price - Variable costs per unit)

Where:

Fixed costs: the costs that do not change with the level of production or salesUnit price: the selling price of one unit of the product or serviceVariable costs per unit: the costs that vary with the level of production or sales, such as materials, labor, and shipping costs.

Thus, the break-even point is the point at which the total revenue from sales equals the total costs, so there is neither a profit nor a loss.

For more details regarding break-even point, visit:

https://brainly.com/question/29063970

#SPJ5

Plz help ASAP just say give me the answer and the number the answer goes in thank you very much

Answers

Answer:

1) 85

2) 95

3) 75

4) 90

5) 120

6) 110

7) 65

8) 130

Other Questions
Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to