it takes you 30 minutes to walk an average velocity of 2.om/s south to school. What is your displacement?

Answers

Answer 1

Answer:

3600 m SOUTH

Explanation:

avg velocity= (change displacement)/(change in time)

2.0 m/s= x/ (1800 s)

displacement= (2.0 m/s * 1800s)= 3600 m SOUTH

.......

sign explanation

2.0 m/s south= -2.0 m/s (downwards direction)

-2.0 m/s= x/ (1800 s)

x= -3600 m


Related Questions

A plane starts out at rest. 100 seconds later, its velocity is 300 m/s. What
vas its average acceleration during this time?

Answers

Answer:

3 m/s^2

Explanation:

avg. acceleration= (change velocity)/ time

[v(final)-v(initial)]/(t2-t1)

[(300 m/s)-(0 m/s)]/(100s-0)

(300 m/s)/(100s)

= 3 m/s^2

a stone thrown horizontally from the top of a vertical wall with a velocity of 15m/s,hits the horizontal ground at a point 45m from the base of the wall. calculate the height of the wall. g =10m/s​

Answers

Answer:

The height of the wall is 45 m

Explanation:

Horizontal Motion

When an object is thrown horizontally with an initial speed v from a height h, the maximum horizontal distance traveled by the object, also called the range can be calculated as follows:

[tex]\displaystyle d=v\cdot\sqrt{\frac {2h}{g}}[/tex]

If we know the range and want to calculate the height it was thrown from, we solve the equation for h:

[tex]\displaystyle h=\frac{d^2g}{2v^2}[/tex]

We'll use the approximate value of g=10\ m/s^2.

The stone was thrown from the top of a wall with a speed of v=15 m/s and it hits the ground d=45 m away from the base of the wall. Calculating:

[tex]\displaystyle h=\frac{45^2\cdot 10}{2\cdot 15^2}[/tex]

[tex]\displaystyle h=\frac{2025\cdot 10}{2\cdot 225}[/tex]

[tex]\displaystyle h=\frac{20250}{450}[/tex]

h = 45 m

The height of the wall is 45 m

1. How is the attractive electrostatic force between a proton and an electron indicated in Coulomb's law?
the sum of the charges indicates a positive force

the product of the charges indicates a positive force

the product of the charges indicates a negative force

the sum of the charges indicates a negative force

2. One particle has a negative charge, while another particle is neutral. Which statement describes the electrostatic force between these two particles?
There would be no electrostatic force because the sum of the two charges is 0.

The electrostatic force is attractive due to the particle with negative charge.

There would be no electrostatic force because the product of the two charges is 0.

The electrostatic force is repulsive due to the particle with negative charge.

3. How would the electrostatic force change if Coulomb's law included a negative sign?
Like charges would repel, and opposite charges would attract.

It would not make a difference in the electrostatic force.

It would depend on the magnitude of the charges.

Like charges would attract, and opposite charges would repel.

What is the value and the direction of an electric field at a distance of 2.5 m from a +1 nC charge?

approximately 145 V/m directed away from the positive charge

approximately 145 V/m directed toward the positive charge

approximately 1.45 V/m directed away from the positive charge

approximately 1.45 V/m directed toward the positive charge

Answers

Answer:

The product of the charges indicates a negative force

There would be no electrostatic force because the product of the two charges wld be zero

Like chargers wld attract, and opposite charges wld repel

Approximately 1.45 V/m directed away from the positive charge

Explanation:

According to Coulomb's law the electrostatic force is directly proportional to the product of the charges and inversely proportional to the distance separating them.

According to Coulomb's law;

F =[tex]Kq1q2/r^2\\[/tex]

Where;

K = constant of Coulomb's law

q1 and q2 are the respective magnitudes of the charges

r = distance separating the charges

Hence,according to Coulomb's law, the product of the charges indicates a negative force.

According to Coulomb's law, for a negative charge, and a neutral particle, there would be no electrostatic force because the product of the two charges is 0.  If Coulomb's law included a negative sign then Like charges would attract, and opposite charges would repel.

The electric field is given by the formula;

[tex]E = kq/r^2\\k= 9 * 10^9 Nm^2C-2\\q =1 * 10^-9 C\\r = 2.5 m\\E = 9 * 10^9 Nm^2C-2 * 1 * 10^-9 C/( 2.5 m)^2\\E = 1.45 V/m[/tex]

The direction of the electric field is  1.45 V/m directed away from the positive charge.

Learn more: https://brainly.com/question/11969651

If an object starts from rest, what is its initial velocity?

Answers

Answer:

if an object starts from rest it's initial velocity is zero

15 percent input work is lost due to friction,then what is the efficiency of machine?​

Answers

Answer:

{ (x/y )*100 } - 0.15 y

Explanation:

The efficiency of a machine is the percent of output work divided by input work minus work lost from friction and heat.

Assume work output = x

Assume work input percent as =y

Work lost through friction is given as : 15% input work = 0.15 y

Then efficiency of the machine will be :{ (x/y )*100 }- 0.15 y

Use real values for x and y to find the correct efficiency of the machine.

In a complete description of a force vector, which is usually not necessary?
O A. magnitude
O B. direction
OC. type
O D. units

Answers

It might be A magnitude is a big thing in force.

In the complete description of a force vector, type is usually not necessary. Thus, the correct option is C.

What is Force vector?

A force vector is a representation which has both the magnitude and direction of the force. Such a vector is typically represented through an arrow in the direction of the force applied and with a length which is proportional to the magnitude of the force.

If a force is applied on an object, this causes movement of the object in a given direction and the wind applies a force on it at an angle, and the new motion will be as that of a force which was applied in that direction.

Therefore, the correct option is C.

Learn more about Force here:

https://brainly.com/question/13191643

#SPJ6

An Object moving at a velocity of 30 m/s slows to a stop in 7 seconds. What was its acceleration

Answers

Answer:

The answer is 4.29 m/s²

Explanation:

The acceleration of an object given it's velocity and time taken acting on it can be found by using the formula

[tex]acceleration = \frac{velocity}{time} \\ [/tex]

From the question

velocity = 30 m/s

time = 7 s

We have

[tex]acceleration = \frac{30}{7} \\ = 4.285714...[/tex]

We have the final answer as

4.29 m/s²

Hope this helps you

A sled with no initial velocity accelerates at a rate of 3.2 m/s^2 down a hill. How long does it take the sled
to go 12 m to the bottom?

Answers

s = 1/2 a t ^2
12= 4.9 t^2
t = square root (2.45) = 1.56 seconds

How do you find the range of a data set?
A. Subtract the smallest value from the largest value
B. Add the largest value to the smallest value
C. Add all the data values together
D. Subtract the smallest value from the average value
SUBMIT

Answers

The answer is A.

The answer is A.

The answer is A.

when a solid turns to a gas, does it have to go through the liquid state first

Answers

Answer:

Sublimation

Explanation: When a solid goes straight to a gas it's called sublimation.

Answer:

Yes

Explanation:

At a given temperature, most chemical compounds and elements can possess one of the three different states of matter at different pressures. In these cases, the transition from the solid to the gaseous state requires an intermediate liquid state.

what is the difference between work and power. will mark brainliest

Answers

Answer:

Work is defined as the process of energy transfer to the motion of an object through the application of force. This is usually represented as the product of force and displacement. The SI unit of work is Joule.

Explanation:

Power is defined as the amount of energy transferred in unit time. The SI unit of power is the watt. One watt is equal to one joule per second. Power is a scalar quantity.

I believe

Work is the method of the conversion of energy by the application of force to the motion of an object. Power is the unit-time sum of energy transmitted.

When you must add three vectors together, what is not true this process? You must only give a magnitude of the resultant vector It does not matter what order you add the vectors You can move the vectors parallel to each other You must connect the head of each vector with the tail of the next vector

Answers

The addition of any numbers of vector provide the magnitude as well as the direction of the resultant vector, hence the mentioned first option is not true.

The addition of vector required to connect the head of the one vector with the tail of the other vector and any vector can be moved in the plane parallet to the previous location, so, the mentioned second and third options are true.

What happens to the acceleration of a car that travels down a ramp and eventually stops?

Answers

Answer:The speed stops because the car loses energy and fuel.

Explanation:

Explain what the core muscles do and why it's important to have a strong set of core muscles.

Answers

Answer:

Since your spine runs by your core, having a strong core will help protect and stabilize your spine, and you're also are able to control movements such as walking or standing better with a strong core.

Change in speed = 14 m/s, time taken = 2 seconds. Calculate the acceleration.

Answers

7 meters/second^2

Acceleration = change in velocity/change in time

14/2 = 7

The north pole of a bar magnet is moved close to the north pole of a second bar magnet. What prediction best describes how the first magnet responds when it is released? It will move toward the second magnet because like poles repel. It will move toward the second magnet because like poles attract. It will move away from the second magnet because like poles repel. It will move away from the second magnet because like poles attract.

Answers

Answer:

C. It will move away from the second magnet because like poles repel.

Explanation:

Answer:

C

Explanation:

PLS HELP
what’s acceleration of car if it accelerates from 5.0 m/s to 18.0 m/s in 5.4 s ? (2.4 m/s^2) ?

Answers

Acceleration: change of velocity / change of time
Acceleration: (18-5) / 5.4
So equal to 2.4 m/s^2

Scientific research involves ____ observations that are also repeatable.
A. Interpreting B. Verifying C. Asking
please answer soon

Answers

The answer is A. Interpreting

Select the correct answer.
Which phase in the cell cycle consists of the cell readying itself for its division?
A.
Prophase
B.
Interphase
C.
Anaphase
D.
Metaphase

Answers

Answer:

A

Explanation:

The phase of cell cycle consists of the cell readying itself for its division is called prophase of the cycle. It is the first phase in mitosis at which a cell duplicate into two daughter cells.

What is cell cycle?

Cell cycle is a biological process by which a cell divide into two genetically identical daughters cells.  Prophase is the initial stage of cell division in both mitosis and meiosis. When the cell reaches prophase, DNA replication has already started after interphase.

The chromatin reticulum condenses and the nucleolus vanishes during prophase, which are the key events.  Other phases are interphase, anaphase etc. and the last stage is called the telophase.

Cell cycle is a very important biological process by which organisms are producing their offspring. This process differ in each level of organism where for all the starting phase is called prophase.

Find more on cell cycle:

https://brainly.com/question/15876101

#SPJ2

Write a paragraph describing the series of events that occur in the operation of a complex machine that you have used recently and Identify the simple machines that make up parts of the complex machine.

Answers

Complex machine i dont but i need to answer a question so i can ask a question so that is why i am answering for u

y’all I would rlly appreciate if y’all gave me the answers to all my questions. My cousin has over 200 assignments she hasn’t done so I’m trying to help her and tbh I don’t know this stuff bc I’ve never done it in school.

Answers

Answer:

BB×bb cross is the answer

What does the blood pick up? ​

Answers

Oxygen

hope this helps:)

Answer:

 

Explanation:

the cells need oxygen for metabolism, which also creates carbon dioxide as a waste product. The red blood cells then pick up the carbon dioxide and transport it back to the lung. There we exhale it when we breathe out. Red blood cells can also pick up or release hydrogen and nitrogen.

While riding in a hot air balloon, which is steadily descending at a speed of 2.44 m/s, you accidentally drop your cell phone.
(a) After 4.00 s, what is the speed of the cell phone?
V = 41.64
m/s
(b) How far is the cell phone below the balloon after this time?

Answers

Answer:

Explanation:

Ff

What are some examples of an element? How do you know they are an element?
HELP PLZ ITS DUE SOON

Answers

An element is a substance that is made entirely from one type of atom. For example, the element hydrogen is made from atoms containing a single proton and a single electron. If you change the number of protons an atom has, you change the type of element it is.

Calculate the speed of a bus that travels a distance of 55 miles in 0.75 hours.

Answers

speed = distance / time = 55 / 0.75 = 73.3 miles per hour.

Explain why the nucleus is very dense BRAINLIEST

Answers

Size and Mass of the Nucleus
Electrons have virtually no mass, but protons and neutrons have a lot of mass for their size. As a result, the nucleus has virtually all the mass of an atom. Given its great mass and tiny size, the nucleus is very dense.

Suppose that a particular artillery piece has a range of R=9240 yards. Find the range in miles

Answers

Answer:

5.25[mile]

Explanation:

We must remember that the yard is a measure of length of the imperial system and that a Mile is also a unit of length of that system.

Therefore we must use a conversion factor that relates the yard to the mile.

[tex]9240 [yard]*[\frac{0,000568182miles}{1yard} ]=5.25[miles][/tex]

A rubber band is shot parallel

Answers

Huh what are you asking

The table shows experimental data of the magnitude of four forces exerted on a 2kg object as it slides across a horizontal surface. Which of the following could represent the magnitude of the net force that is exerted on the object? Select two answers.


Answers

Answer:

6N and 10N

Explanation:

The forces acting along the horizontal axis arw the horizontal force applied and the frictional force.

Frictional force is a force that opposes the horizontal force (moving force)

First we need to get the sum of force along the horizontal as shown

\sum Fx = Horizontal force - frictional force

\sum Fx = 8N - 2N

\sum Fx = 6N

Hence one of the magnitude of the net force exerted on the object is 6N

For the forces along the vertical component;

The forces are the weight, force of gravity(acting downward) and the normal force acting upward

Given

Weight = mass × acceleration die to gravity

Weight = 2×10 = 20N

Normal force = 10N

\sum Fy = (weight)-normal force

\sum Fy = (20)-10

\sum Fy = 20-10 = 10N

Hence the other net force acting on the object is 10N

The required options are 6N and 10N

Eric is walking forwards at 0.5 m/s and then hears a black
bear charging from behind. He continues to move forward
and increases his speed to 10 m/s within 3 seconds. What was
Eric's acceleration?
0 3.2 m/s
O 3.2 m/s^2
0 -3.2 m/s^2
O 10 m/s^2
O Other:​

Answers

Answer:

3.2 m/s^2

Explanation:

current velocity minus intitial velocity, divided by time: a=(v2-v1)/t

Other Questions
A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ???