Is the Healthy Eating Pyramid for everyone?

Answers

Answer 1

It's critical to keep in mind that every physique is unique. Each of us has unique genetic and cultural characteristics. We wouldn't all look alike by the end of the calendar year, even if we all started to eat the same foods and exercising the same amount.

Does the food pyramid represent a healthy diet?

Many experts contend that using a pyramid or other similar image to represent sound dietary advice is neither the best nor the most effective approach. It also makes a lot more sense to break categories down into those we should eat more of, eat in moderation, or attempt to avoid.

What inspired the creation of the healthy eating pyramid?

Obtain more. Based on the "more to less" idea pioneered in Sweden in the 1970s, Nutrition Australia first presented the Healthy Eating Gradient in 1980. It was created as a basic conceptual model that individuals may use to learn about healthy nutrition.

To know more about healthy diet visit:

https://brainly.com/question/25365932

#SPJ4


Related Questions

There is a food truck that sells pad thai burritos near Jelani’s school. This combination of Thai and Tex Mex flavors is an example of what type of cuisine?

Select one:
a. haute
b. fusion
c. nouvelle
d. vegan

Answers

Answer:

b

Explanation:

To suit their tastes, Texas' Mexican eateries began incorporating more Texan-preferred ingredients, giving rise to what we now refer to as “Tex-Mex.” Thus, option B is correct.

What is Tex Mex flavors?

Examples of Tex-Mex food include nachos, fajitas, and anything made with meat, black beans, canned vegetables, wheat flour, or yellow cheese.

What many Americans mistakenly refer to as Mexican food is actually Tex-Mex. As the name suggests, Tex-Mex combines elements of Mexican and American cooking.

Given that Texas is so close to the Mexican border, it makes sense that this particular dish first gained popularity there.

Therefore, combination of Thai and Tex Mex flavors is an example of fusion of cuisine.

Learn more about Tex Mex flavors here:

https://brainly.com/question/7024463

#SPJ2

an example of phobia that deals or fear of flying. A. acrophobia B. aerophobia C. astraphobia D. claustrophobia

Answers

Answer:

[tex]\huge \fbox \pink {A}\huge \fbox \green {n}\huge \fbox \blue {s}\huge \fbox \red {w}\huge \fbox \purple {e}\huge \fbox \orange {r}[/tex]

[tex]{\boxed{\boxed{\tt { Aerophobia}}}} \ [/tex]

✏ Aerophobia is the phobia that deals with the fear of flying.

ʰᵒᵖᵉ ⁱᵗ ʰᵉˡᵖˢ

[tex] \huge\blue{ \mid{ \underline{ \overline{ \tt ꧁❣ ʀᴀɪɴʙᴏᴡˢᵃˡᵗ2²2² ࿐ }} \mid}}[/tex]

What do the femoral condyles meet with on the tibia?​

Answers

It wouldn’t let me post the answer so I took a screenshot.

On a coordinate plane, line A B goe through (negative 2, 4) and (0, negative 4). Point Z i at (0, 2). Which point i on the line that pae through point Z and i perpendicular to line AB?

Answers

Point Z, (0,2), is the y-intercept point i on the line that pass through point Z and i perpendicular to line AB.

A two-dimensional surface produced by two number lines is known as a coordinate plane. When a horizontal line (the X-axis) and a vertical line (the Y-axis) connect at the origin, it is formed. The numbers on the a coordinate grid are used to find points. A coordinate plane can be used to plot points, lines, as well as other objects. It functions as a map, providing accurate directions from one spot to another.

The Roman number I represents the first quarter (+, +), sometimes known as such positive coordinates quadrant.

The Roman number II represents the second quadrant (-, +).

The Roman number III represents the third quarter (-, -).

The Roman number IV represents the fourth quarter (+, -).

Any point's coordinates are included in brackets.

To know more about the Coordinate plane, here

https://brainly.com/question/15344425

#SPJ4

Monitoring cancer trends in the U.S. population over time is a major application of:
A. registries.
B. the U.S. Census Bureau.
C. reportable and notifiable diseases.
D. vital events data.

Answers

B. the U.S. Bureau

explanation: Birth statistics include statistics on live births but not fetal deaths. Monitoring cancer trends in the U.S. population over time is a major application of: a. the U.S. Census Bureau.

D) One important use for data from vital events is to look at how the U.S. population has changed over time in terms of cancer.

How significant are vital statistics?

Continuous data on births and maternal and fetal deaths are provided by vital statistics, which are compiled by states and transmitted to the CDC's NCHS 1 2.

What kind of analysis of survival data takes into account only cancer-related deaths?

Survival (and mortality) specific to cancer In cancer-specific survival analysis, the outcome of interest is only the number of deaths attributed to a particular cancer. Typically, follow-up begins on the date of the cancer diagnosis and continues until death, loss to follow-up, or the conclusion of the study.

To learn more about vital events here:

https://brainly.com/question/14493785

#SPJ1

Average salary for behavioural interventions in ns

Answers

Behavior Interventionist Jobs in Nova Scotia: $17-$22/hr Average Salary for Behavior Interventions.

What are the wages for behavior interventionists in BC?

In British Columbia, Canada, the average salary for a behavioral interventionist is $69,970 per year and $34 per hour. A behavioral interventionist can expect to make between $50,658 and $83,894 per year on average.

Work any behavioral interventions?

Numerous illnesses have been effectively treated with behavioral treatment. It is thought to be quite powerful. A little more than 75% of patients who start cognitive behavioral therapy see some improvement.

To know more about Behavior Interventionist visit:-

https://brainly.com/question/3474229

#SPJ1

the increased activity of the amygdala is a reason that young children experience _____.

Answers

Answer: Believed intellectual growth occurs in a social context.

Explanation:

The increased activity of the amygdala is a reason that children during their play years experience... Believed intellectual growth occurs in a social context. Children learn because of guided participation from parents, teachers, and peers.

why do we need patience ??​

Answers

Answer:

we need patience to do our work in a good manner and to make our work successful .

hope it is helpful to you

Answer:

Some of these benefits of practicing patience include: Helping you focus on longer term outcomes and goals, rather than short term pleasure. Helping you with making good choices, rather than making impulsive decision. Forcing you to show empathy and kindness towards others. Some of these benefits of practicing patience include: Helping you focus on longer term outcomes and goals, rather than short term pleasure. Helping you with making good choices, rather than making impulsive decision. Forcing you to show empathy and kindness towards others.

What are the four levels at which the process of gene expression may be regulated?

Answers

Gene expression can be regulated at four levels: transcriptional, post-transcriptional, translational, and post-translational regulation.

The four levels at which gene expression may be regulated are:

Transcriptional regulation: control of the rate of transcription of DNA into RNAPost-transcriptional regulation: control of the stability, transport, and translation of RNATranslational regulation: control of the rate of protein synthesisPost-translational regulation: control of the activity, stability, and degradation of proteins.

Gene expression is the process by which the genetic information stored in DNA is used to produce functional molecules such as proteins. The process of gene expression can be regulated at four different levels to control the production of proteins. Transcriptional regulation controls the rate of transcription of DNA into RNA.

To learn more about gene expression at

https://brainly.com/question/15159232?referrer=searchResults

#SPJ4

Why did people of Nepal want a new Constitution?​

Answers

Answer:

the people of nepal wanted constitution because in nepal before 2003, there was monarchy and people were trying get a new government

because they wanted a better life

Why is it important to create a goal that is measurable brainly?

Answers

To pinpoint the point at which a goal has been accomplished, it is critical to develop quantifiable goals. A quantifiable objective can also increase motivation since it makes it possible to monitor one's progress toward the goal.

Why is it crucial that objectives be measurable?

It's crucial to set quantifiable objectives so you can monitor your progress and maintain motivation. You can stay focused, fulfil deadlines, and experience the thrill of coming closer to your objective by regularly evaluating your progress.

A measurable objective is essential since it enables you to monitor your progress and maintain motivation. The aim is measureable if there is data or criteria that can be quantified.

Learn more about measurable objective refer

https://brainly.com/question/16888436

#SPJ4

Is the human population growing too fast, or not fast enough?

Answers

Answer: Human Population is Growing Too Fast

Explanation: Human Population is Growing Too Fast Ajay Mahat, Environment Reporter September 27, 2021 Sooner or later we won’t have enough food and shelter for people because the population is growing so fast. We either need to find a way to keep them or try to limit their population.

What is the difference between principle of overload and principle of progression?

Answers

Overload is the amount of load or resistance that places a larger stress, or load, on the body than it is used to in order to improve fitness, whereas progression is the method by which an individual should increase the load.

The progression principle states that when your body adjusts to your exercise programme, you must challenge yourself in order to continue experiencing growth. That challenge might be anything from increasing your time, intensity, weight, sets, reps, or anything else.

The second key factor is overload, which means that in order to improve any aspect of physical fitness, the individual must continually increase the demands placed on the corresponding biological systems. Heavier objects, for example, must be raised gradually to increase strength.

The development of a training variable simply involves making training increasingly difficult in some sense, but not always heavy. Progressive overload is a product of prior training in which performance improves as fitness improves.

To learn more about principles of overload and progression, here

https://brainly.com/question/12536161

#SPJ4

Housing is a subject that every person faces during their lifetime. Based on the advantages and challenges of both renting and buying, which option would you choose? Why money were not a problem, would you change your choice? Why or why not?​

Answers

Answer:

i would rent a house. but if money was not a probley and i knew i really like were the house was at and i not plan to move anytime soon then i would  buy  

Explanation:

Which term refers to a person’s pattern of attitudes, emotions, characteristics, and behavior?

A. socialization
B. sociobiology
C. personality
D. self

Answers

Answer:

C. Personality

Explanation:

Personality refers to a person’s pattern of attitudes, emotions, characteristics, and behavior.

Personality character or the way you deal with the world. Famous people can be referred to as personalities.

Therefore, the correct answer is c. personality.

How can living an active lifestyle help your personal life?

Answers

It distracts you from negative thoughts and helps you be optimistic? Keeps you busy in general

Why is it important use a positive working practices

Answers

Answer:

To support and meet the needs of the people

Explanation:

It only happens by good communication and passing information correctly.

Hope this helps:)

What are the five healthy habits for a healthy community?

Answers

The five healthy habits for a healthy community are:

eating a nutritious diet.receiving regular exercise.Quit smoking.maintaining a healthy weight.Limiting alcohol consumption.

The pillars of healthy life include good nutrition, frequent exercise, and appropriate sleep. A healthy lifestyle keeps you fit, active, and less prone to disease. According to the World Health Organization, healthy living is a style of life that allows you to enjoy more elements of your life. Good diet, frequent exercise, avoiding hazardous habits, making educated and responsible health decisions, and getting medical aid when necessary all contribute to a healthy body.

Adopting new, healthier habits may help you prevent serious health problems like obesity and diabetes. New habits, such as eating properly and exercising frequently, may also help with weight control and energy levels. If you stick with these changes for a long time, they may become part of your usual routine.

To learn more about healthy habits, here

https://brainly.com/question/2536045

#SPJ4

What are 3 types of heat stroke?

Answers

The 3 types of heat strokes are

Heat crampsHeat exhaustionHeat stroke

Heat stroke is the most deadly heat-related illness. It happens when the body's temperature can no longer be controlled: the body's temperature rises fast, perspiration stops, and the body is unable to cool down. Heat stroke causes the body temperature to swiftly rise to 106°F or higher. Heatstroke is a potentially lethal disease induced by excessive body heat.

Heat exhaustion is characterised by profuse sweating and a rapid pulse as a result of your body overheating. It is one of three heat-related diseases, with heat cramps being the mildest and heatstroke being the most serious.

Heat cramps are painful, involuntary muscle spasms that occur after heavy physical activity in hot conditions. The spasms might be more intense and linger longer than regular midnight leg cramps. Heat cramps are typically induced by electrolyte and fluid loss.

To learn more about heat strokes, here

https://brainly.com/question/2107818

#SPJ4

When you are selecting the type of fish to eat, which of the following should you consider?

Answers

The species of fish chosen for grilled, baked, or broiled dishes contain higher levels of EPA and DHA.

Why is it crucial that we choose the fish we eat with care?

Some fish varieties are preferable to others because they are less likely to contain contaminants like mercury. For children, women who are pregnant or nursing, or those who have medical conditions, a doctor can provide personalized advice regarding the consumption of mercury-containing fish.

Try to consume fish at least twice a week, preferably fish that is high in omega-3 fatty acids. It seems that doing so lowers the risk of heart disease, especially sudden cardiac death.

To know more about omega-3 fatty acids visit:

https://brainly.com/question/30115324

#SPJ1

What are the three types of gene regulation?

Answers

The three types of gene regulation are transcriptional regulation, post-transcriptional regulation, and post-translational regulation which controls the initiation and rate of transcription, stability, and transport of RNA, and modifications of proteins respectively.

There are three main types of gene regulation: transcriptional regulation, post-transcriptional regulation, and post-translational regulation.

Transcriptional regulation: This type of regulation controls the initiation and rate of transcription, the process by which the genetic information in DNA is copied into RNA. It involves the binding of regulatory proteins, such as transcription factors, to specific sequences near the promoter of the gene.Post-transcriptional regulation: This type of regulation takes place after transcription has occurred and is responsible for controlling the stability and transport of RNA molecules. It can involve processes such as alternative splicing, RNA editing, and RNA decay.Post-translational regulation: This type of regulation occurs after translation, the process of converting the information in RNA into a functional protein. It can involve modifications such as phosphorylation, ubiquitination, and proteolysis, which can alter the activity, localization, or stability of the protein.

To learn more about regulatory genes at

https://brainly.com/question/14097714?referrer=searchResults

#SPJ4

What are the benefits of recreational activities in yourself?

Answers

Engaging in recreational activities can bring about many benefits for individuals. By participating in leisure activities, individuals are able to take part in diverse experiences, learn valuable new skills and broaden their horizons.

Moreover, taking part in recreational activities can improve one's physical health and wellbeing. Through participation, people can strengthen their cardiovascular systems as well as increase muscle strength and flexibility.

Recreation also provides stress management techniques and distraction from everyday annoyances and worries. In addition, engaging in leisure activities is an effective way to boost creativity and foster deeper relationships with family members or friends while practicing useful social skills including teamwork, leadership and decision-making.

To learn more about physical health visit:

https://brainly.com/question/13513890

#SPJ4

What can you do to advocate as an individual and as a student?

Answers

As an individual, you may advocate, and as a student, you can make decisions that are in the best interests of students.

The student-advocate principal considers what is best for each individual student. This characteristic will be mirrored in his or her perspective on issues such as student discipline. Every student is provided with the opportunity to engage in school activities and study in order to realise his or her full potential. The chief student advocate truly wants to help a kid satisfy his or her specific needs and interests.

Student advocates must listen to the student's side of the story, learn about the student's specific talents and interests know kids by name, and use good listening skills. The principal tries to see things through the student's eyes and is sympathetic to the student's sentiments. The principal recognizes the complexities of the issues that influence a student's performance and success and supports & defends actions that are in the greatest advantage of all students.

To know more about the Student advocate, here

https://brainly.com/question/30039016

#SPJ4

What is physical health defined as?

Answers

Answer:the condition of your body, taking into consideration everything from the absence of disease to fitness level.

Explanation:

What is the most important way to slow bacterial growth in food?

Answers

The most important way to slow bacterial growth in food is to control time and temperature.

Bacteria grow most rapidly between 40°F and 140°F (4.4°C and 60°C), doubling in number in as little as 20 minutes. This range of temperatures is often called the "Danger Zone." To slow bacterial growth in food, it is important to control the time and temperature at which food is stored, prepared, and served. This includes keeping hot foods hot and cold foods cold. Foods should be heated to an internal temperature of at least 165°F (74°C) and chilled to 40°F (4.4°C) or below as quickly as possible. Proper food handling practices like washing hands, separating raw meats from other foods, and using clean utensils also play an important role in controlling bacterial growth.

To know more about bacterial growth click below:

https://brainly.com/question/14461247#

#SPJ4

I am a new middle school student. I am totally freaked out about taking tests this year! What types of tests do they give in middle school? What advice could you give me so that I rock them?

Thanks,

Newbie



Write back to Newbie. Be sure to:

Describe at least 2 types of tests explained in this unit
Give at least 1 tips on how Newbie should prep for each type of test you described
Minimum 4 sentences
Write complete sentences that are grammatically correct
Use correct capitalization and punctuation

Answers

I just started high school and the only thing I wish I did was make good study habits they give you a test on exactly what you learned and will most likely give a a study guide if it’s optional do it it helps so much

Which mental characteristic develops over the course of adolescence?

reduced memory skills

improved reasoning skills

weaker decision-making

stronger impulses

Answers

[tex]\huge\pmb{\red{A}\pink{N}\orange{S}\blue{W}{E}\purple{R}\purple{→}}[/tex]

---› Improved reasoning skills

Explanation:

Hope it helps you!!

How many bones are in the baby body vs the Human body

Answers

Answer:
A baby would have 300 bones in their body. While an adult would have around 206 bones.

Explanation:

Some of your bones will fuse together. Which is why the number went down.

Which of the following statements would be
mentioned in the "objective" section of a good
verbal report?
The patient's current weight is 165 pounds.
The patient is complaining about dizziness.
The patient's sister is expected to arrive at 2
p.m.
The patient must receive one dose of
medication every three hours.

Answers

Answer:

option 3

Explanation:

Answer:

C The patient’s current weight is around 165 pounds.

Explanation:

Edge 2021

Four workers are going through their days. Ingrid is researching the AIDS epidemic in Africa. Lenny is working to identify where an outbreak of bacteria-contaminated spinach came from. Ben is investigating an employee injury that occurred in a physical therapist’s office. Drew is working on generating the MMWR. Which best describes which agency each person works for?

Answers

Answer:A

Explanation:

answers A

Ingrid, Lenny, Ben, and Drew are likely public health workers in various agencies responsible for disease control, food safety, workplace safety, and health data reporting.

Public health workers work to improve the health of populations and protect against health threats. They work in many different organizations, including government agencies like the Centers for Disease Control and Prevention (CDC) and the Occupational Safety and Health Administration (OSHA), as well as non-profit organizations and academic institutions.

Ingrid is likely a researcher working on the AIDS epidemic in Africa, which could be related to the CDC's work on global health and disease control. Lenny is likely working for a food safety agency, such as the Food and Drug Administration (FDA), investigating the source of a foodborne illness.

Ben is likely an inspector with OSHA, investigating a workplace injury. Drew is likely working for the CDC, generating the Morbidity and Mortality Weekly Report (MMWR), a weekly publication that summarizes key public health data.

This question is incomplete, thus the answer is general.

Learn more about employee here:

brainly.com/question/27404382

#SPJ1

Other Questions
Find the x and y Intercept of x + 2y = -14 What is human trafficking Which of the following statements best explains differences between the finches? A. Some finches were born with beaks that allowed them to have better access to different sources of food. These finches reproduced and passed on their genes.B. The beaks of the finches changed so all of the finches could eat the same types of food.C. The beaks of the finches changed as the species of finches migrated to the same island.D. The beaks of the finches changed as the finches' body sizes changed. The characteristics of type one diabetes Factor quadratic trinomials2x^2+7x+63x^2+5x+2With method X pleaseee:( How do you graph a parent graph? Do you agree with Wittgenstein that philosophy should focus on language? Why or why not? Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each?