In order to determine what we know about the speaker of a poem, we should gather ______ about the speaker.(1 point) details adjectives rhymes perspectives

Answers

Answer 1

Answer:

Details

Explanation:

It is important to know context about who is speaking, because that will provide new insight into what a poem is about.

Answer 2

In order to determine what we know about the speaker of a poem, we should gather details about the speaker.

A speaker in a poem

In poetry, this is the voice behind a poem, the person imagined to be saying the poem out loud.

Determining what we know about the speaker of a peom, it is important to know about the details of the speaker as it will provide a good background information on what a peom is about.

Therefore, the correct answer is option A.

Read more about details here:

https://brainly.com/question/24621985


Related Questions

How does change shape us to be better? Essay

Answers

Answer:

Every experience we have shapes who we are in one-way or another. ... A seemingly unimportant experience may simply change how you feel one day which can cause a chain reaction of how you act a certain day,

Explanation:

: AlohaS4 : Essay :

How does changing shape us to be better?

While change can be a scary thing, change can be a good thing. Everybody can change, as well as the environments around people. Change can shape someone to become a better person. Change can help someone open up or help them to make new friends or become more appreciative. It just depends on how you change or if you want to change.

Change can shape us to be better because when you change, you're becoming different. You're making something about you different. As an example, you could change from being a mean or harsh person to a more forgiving or kind person. Anybody can change as long as they want to change. A key thing about changing is that it's hard to change. It's like breaking a bad habit. It can be difficult to change, it can be very challenging to become a better person, especially if you've never known any better.

Changing can be a very good thing. When you want to change, it's a lot easier to change. You can change your ways or change you're attitude, attire, etc. You can even change your enviorment. Many kids and adults have changed their environment, like when you move. Everything's a new environment, the new house, the new place, and a new school or workplace. Changing can help people be better, they can change into a kind person, or they can learn to forgive others and trust others.

These are the ways changing can be different but helpful. It just depends on how you, as a person, want to change and if you try hard enough, you can change. For the better. For everyone around you and to become a better person.

When you copy my answer, only copy it into your work. Do not repost it onto another learning or homework site. I'm only giving you permission to use it on your homework or your schoolwork nothing else. Thank you!

~Aloha

what does it produce? What type of waves​

Answers

you didnt include any context or information

A myth is a story based on tradition or legend, which has a deep symbolic meaning. A myth 'conveys a truth' to those who tell it and hear it, rather than necessarily recording a true event.
Infer what is meant by a truth?
a. A commonly held belief
c. Evidence
b. An empirical fact
d. none of the above


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

b

Explanation:

definition for Empirical: based on, concerned with, or verifiable by observation or experience rather than theory or pure logic. aka another word for evidence

The answer to your question is B.

Which of these statements does NOT support the claim that “Dogs are the best pets for active people”?

Dogs love to walk and run with their owners.
Dogs love to play ball and Frisbee outdoors.
Dogs are happy to sit and watch TV with their owners.
Dogs need walks and exercise.

no files please

Answers

Answer:

Dogs are happy to sit and watch TV with their owners.

Explanation:

This action does not require any movement, though the other three actions do.

Answer:

Dogs are happy to sit and watch TV with their owners.

Explanation:

Sitting and watching TV is not active. Therefore, the statement that dogs like to sit and watch TV with their owners does not support the claim that dogs are the best pets for active people.

What does the metaphor “Fame is a Fickle Food” mean? What is the theme of this poem?

Answers

Answer:

Emily refers to fame as food, an animate object so it can be understood more easily. Fame is not eternal or predictable; someone might experience it one day and not the next. The speaker equates fame to a fickle food because it is something that can transform people in an instant.

Explanation:

What type of figurative language is the following line from Coffin’s The Spider? “His back legs are a pair of hands.”

personification or metaphor

Answers

Answer: metaphor

Explanation: the story is comparing his back legs with a pair of hands, by calling his back legs a pair of hands. a metaphor is when a word or phrase is applied to a subject to describe said subject (ex. he is a rock, she's a busy bee, etc.).

if it were a personification, the back legs would be given a human characteristic, which is not present in this case.

IGNORE THE WORDSSS HELP WHAT IS THIS SHAPE IM SO DONE WITH MYSELF

Answers

Answer:

Hi, there it's an octagon since it has 8 sided shape and the only shape that has 8 sides is an octagon

Explanation:

I don't know if I am right its a bit blurry

Which device would add rhythm to a poem?
focus on a strong thematic element
a simile comparing the subject to music
personification of an emotion
repetition of sounds across several lines

Answers

C repetition of sound across several lines

Answer:

repetition of sounds across several lines

Explanation:

I asked him 'what are you doing' into indirect speech​

Answers

Answer:

I asked him what was he doing?

Which is an example of a counterargument to the claim that eating an apple everyday "keeps the doctor away"?
Apples are full of Vitamin C, Potassium, and Vitamin K.

Apples contain lots of sugar that can erode the enamel on your teeth.

Apples have fiber which is good for lowing cholesterol.

The polyphenols in apples can lower your risk for diabetes.

Answers

Answer:

your awser would be b

Explanation:

becase if you think about the other they are supporting how apples are good. but b is showing how appels are bad for your teeth. that is what counter arguement means!

Apples contain lots of sugar that can erode the enamel on your teeth.

10 Use the verbs in brackets to report the
sentences.
1 "Please, please let me go," Ricky said. (BEGGED)
2 "You broke into Harper's house," she said to
the man. (ACCUSED)
3 "I'll tell the truth," he said. (PROMISED)
4 "Don't forget to call the police," Ann said to
me. (REMINDED)
5 "I'm sorry I stole your wallet," she said
(APOLOGISED)
6 "I didn't take your camera," he said. (DENIED)
7 "Let's talk to a lawyer," he said. (SUGGESTED)
8 "Don't go near this area," he said. (WARNED)
9 "I took the passport," he said. (ADMITTED)
10 "Leave or I'll call the police," he said.
(THREATENED)​

Answers

Answer:

yabbababrhb3j4bnadhjsnsnsbsnsn

Select the correct answer.
Which choice best defines the central idea of a passage?
ОА.
It is the specific idea the passage focuses on.
B.
It is the general topic of the passage.
O c.
It is who or what the entire passage is about.
OD
It is the evidence that supports the argument.

Answers

Answer:

b) it is the general topic of the passage

Explanation:

a) is incorrect because the central idea of a passage is often not specific, and instead more general, allowing for the writer to discuss sub-topics as well.

c) is incorrect because the central idea of a passage is an message/theme instead of a subject.

d) is also incorrect since the central idea is what the argument revolves around, not the evidence.

i hope this helps! :D

PLEASE HURRY!!!!! In "The Lottery", how does the fact that names are called and people select their piece of paperwork to create suspense?

A. Readers know males draw the papers
B. Readers watch every family participate
C. Readers wonder what the papers signify
D. Readers want to participate in the drawing

Will give Brainest!!

Answers

I would say c bc it seems as tho it

Type in the correct rhyme scheme next to the poem.

Answers

Answer: A A B A A B

Explanation:


1. What news does Balthasar bring to Romeo
2. What is the punishment for selling lethal poisonsin Verona
3. Why does Romeo belleve that the apothecary will sell him polsona
4. When Romeo hears of Juliet's death, he reacts before he considers all the possible
results. If you could talk to Romeo and give him some advice,
what would you tell him
5. When Friar John arrives to talk to Friar Laurence, what does Frlar Laurence realize and
what does he decide to do?

Answers

Answer:

4

Explanation:

my advice would be, sometimes we shouldn't allow our emotions to control us

Which statement best compares Brutus's remarks at
the death of his wife, Portia, to his words before his
own death?
O Brutus shows extreme sorrow and regret over both
deaths.
O Brutus is matter of fact when talking about both
deaths, but he takes time for reflection when talking
about his own impending death.
Brutus uses more imagery when speaking about
Portia's death and is direct when speaking of his
own.
O Brutus explains how Portia died, but he completely
avoids talking about his own death.

Answers

Answer: B - Brutus is matter of fact when talking about both deaths, but he takes time for reflection when talking about his own impending life

Explanation: Edge 2021

The statement that best compares Brutus's remarks at the death of his wife, Portia, to his words before his own death; Option B

What is the correct meaning of the statement?

The correct answer is that Brutus is matter of fact when talking about both deaths, but he takes time for reflection when talking about his own impending life.

Option B is correct because he got over the grief of his wife's death as he said that there would be fewer worries now. That was not his philosophical touch but the emotional one as he didn't want to show his sorrows.

Read more about Correct Statement at; https://brainly.com/question/25071684


From the details in the selection from Silent Spring, what can you conclude about the town before the changes take place?

Answers

Answer:

I believe the answer would be that the town attracts people who connect and like the outdoors

Explanation:

Trust me on this.

I need the answer as soon as possible please

Answers

Answer:

ooh its so ccomplicated

Explanation:

Who Is The main character in No Way To Run

Answers

Answer:

clydie Anderson

Explanation:


What does Ralph see on the horizon?
O an airplane
O the smoke from a ship
O another island
O a shark

Answers

The answer is a because that is what Ralph sees on the horizon

The author writes that people are
at
18 than at 16 or 17. He supports this
second claim with two pieces of
evidence: Most 16- and 17-year-olds
don't
on their own. Instead, it is
that help
them develop this ability.

Answers

Answer: Wiser and more mature

Explanation: This is because people who are older have more responsibility and know right from wrong.

Hope this helped!         :D

Answer:

Wiser and more mature

Explanation:

Which of the following is a good speaking habit? Select all that apply.
O Keep your volce at an even monotone.
O Look audience members in the eye.
O Shuffle your feet when you get nervous.
O Stare at one spot that is removed from the audience.

Answers

Answer:

look audiance members in the eye

Explanation:

it shows confidence

Some historians do not believe that Shakespeare wrote all the plays he is credited with writing. TRUE / FALSE

Answers

Answer:

True, lots of historians do not believe that Shakespeare wrote all of his plays.

Match the sentence to the part of the paragraph it represents. ​

Answers

Answer:

Pretty sure it's evidence first, commentary next, then claim last.

Fill in the blanks.

Word Bank: ready, weather, stood, length, object

Answers

Explanation:

I stood still for the length of the entire trail just so that I could hear the lawyer shout "I object".

Answer: hewo

Explanation:

What does it mean to serve justice for juveniles in the system? In your own words

Answers

Answer:

Justicia Juvenil: un niño no puede ser juzgado como un adulto. La Justicia Juvenil, también conocida como Justicia del Menor, es la ley que se aplica a los niños. Con el fin de que se respeten sus derechos, ésta debe adaptarse a las necesidades específicas de los niños.

Explanation:

the table shows conversion between minutes and seconds how many seconds should go with 2.5 minutes

Answers

Answer:

150 seconds would go with 2.5 minutes

Explanation:

In 1 minute there are 60 seconds

Hence, in 2.5 minutes, the total seconds would be

[tex]2.5 *60 = 150[/tex] seconds

Hence, 150 seconds would go with 2.5 minutes

2. Why was hercules consumed by grief

Answers

Answer:

The goddess Hera, who hated Hercules for being born of her husband's adultery, had stricken him with a temporary curse of madness. ... Consumed by grief, Hercules sought out the Oracle of Delphi, who told him the path to atonement lay with his cousin, King Eurystheus of Tiryns, a favorite of Hera's.

5 What are character motivations?


the qualities of a character in a story

reasons a character does a certain action

types of characters that take part in a story

the ways characters are developed in a story​

Answers

Answer:

The way the characters are developed in the story is the characters motivations

(20 POINTS) Please give an example or two of dramatic irony in the book Hatchet. (Include the chapter where it was found too)

Answers

Answer:

1: During his first few days in the forest, Brian repeatedly notices fish jump in the lake. 10-12

2: Brian finally finds the survival kit even though he has learned on his own how to survive. Ch.19

3: Brian unwittingly turns on the Emergency Transmitter which brings the plane to rescue him. also ch.19

4: He finds a rifle which makes him unsettled, because its power and mastery seem to separate him from the wilderness that has become his home and he doesn’t like the feeling. ch.19

Explanation:

These are some examples of dramatic irony in the hatchet.

During his first few days in the forest, Brian repeatedly notices fish jump in the lake. Brian finally finds the survival kit even though he has learned on his own how to survive.

What are Irony?

In its broadest definition, irony (from the Ancient Greek "v" eirnea, "dissimulation, feigned ignorance" , which is a crucial rhetorical device and literary technique, is the juxtaposition of what on the surface appears to be the situation and what is actually the case or to be expected.

There are several different varieties of irony, including situational, dramatic, and linguistic irony. When stating a truth, verbal, dramatic, and situational irony are frequently utilized to emphasize the point.

By purposefully using language that says the opposite of the truth, rejects the contrary of the truth, or dramatically and blatantly understates a factual link, the ironic form of simile, employed in sarcasm, and some kinds of litotes can stress one's meaning.

Therefore, During his first few days in the forest, Brian repeatedly notices fish jump in the lake. Brian finally finds the survival kit even though he has learned on his own how to survive.

To learn more about irony, refer to the link:

https://brainly.com/question/1695719

#SPJ2

Other Questions
List 4 significant problems with nuclear power plants. im crying please help me so much 7Anna and Paddy take part in the same fun run.Anna completed the fun run in 2 hours.Her average speed was 6 kilometres per hour.Paddy completed the fun run in 90 minutes.(a) Work out Paddy's average speed in kilometres per hour. PRODUCTOR11. (Circle one) Oxygen is areleased?)REACTANTof respiration? (In other words, is it needed or Determine if 0.875 is rational or irrational and give a reason for your answer. PLEASE HELP :DDDDDDDDDD Find the volume of the rectangular prisim 6cm 4cm 12cm If the vehiche has a speed of 24.0 m/s at point a what is the force of the track on the vehicle at this point? Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC?