If a cell's surface area-to-volume ratio increased from 3:1 to 4:1, what impact would that have on the transport of materials across the cell membrane? It would be unchanged Transport would increase Transport would decrease None of the above

Answers

Answer 1

Answer:

The answer to this question is Transport would increase.

Explanation:

The transport would just increase.

Answer 2

In the given area-to-volume ratio, the transport would increase across the cell membrane. The correct option is B.

What is area-to-volume ratio?

The surface area to volume ratio is merely the surface area divided by the volume of an entity. It calculates the surface area per unit volume of the object.

The crucial fact is that as the cell size increases, the surface to volume ratio decreases.

If the cell expands beyond a certain size, not really enough material can cross the membrane quickly enough to cater the increased cellular volume.

The surface area divided by the volume is the ratio. This suggests how much surface area is accessible in relation to the size of the cell.

The cell is very large if the surface area to volume ratio is small. If the ratio is large, the surface area exceeds the volume the cell will be small.

Thus, the correct option is B.

For more details regarding cell membrane, visit:

https://brainly.com/question/13524386

#SPJ2


Related Questions

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

what are the two effects of world war one?

Answers

Answer:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Explanation:

The First World War leads to destruction of empires. Numerous new nation-states were created. United States were forced to become a world power that in turn lead to the rise of Hitler and Soviet communism.

Effects of world war one are as follows:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Identify the products of cellular respiration.

Answers

Answer:

Water and carbon (IV) oxide

Scientific research shows that our global climate is changing. The global sea level is rising and ocean temperatures are...

Answers

the global sea level is rising and ocean temperatures are Increasing

List and describe three methods of nonpoint pollution control.
1.
2.
3.

Answers

Answer:

1. Protect drinking water by using less pesticides and fertilizers.

2. Reduce soil erosion by using conservation practices and other applicable best management practices.

3. Use planned grazing systems on pasture and rangeland.


Question 4
Blood sugar homeostasis plays an important role in our health and well-being. If
blood sugar levels get too low or high, there are serious health complications that
can result. Which two body systems regulate blood sugar levels? Click on the correct
answers.

Select 2 correct answer(s)

A-Nervous System
B-Musculoskeletal System
C-Respiratory System
D-Digestive System

Answers

Nervous and digestive system

True or False?

It takes about the one million years for
the magma to complete one circular
convection flow.

Answers

Answer:

False, since it takes more than one million years

Explanation:

Speeds can be faster for small-scale convection occurring in low-viscosity regions beneath the lithosphere, and slower in the lowermost mantle where viscosities are larger. A single shallow convection cycle takes on the order of 50 million years, though deeper convection can be closer to 200 million years.

PLEASEEEE HELPPPPPPPPPPP
Professor Marcus has identified a new species of beetle in the Amazon Rainforest. The professor then investigates the process of gene expression in the cells of the beetle. Which is an expected result of the investigation?

A The processes of transcription and translation are unique in the beetle.

B The process of translation in the beetle is similar to other organisms, but involves a unique genetic code.

C The process of transcription in the beetle is similar to other organisms, but involves a unique set of nucleic acids in mRNA.

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Answers

Answer:

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Explanation:

Transcription is the cellular process where a specific DNA fragment called 'gene' is used as a template to create a complementary RNA molecule, usually a messenger RNA (mRNA). Subsequently, this mRNA is then used to synthesize a polypeptide chain (i.e., a protein) in the ribosomes. In eukaryotic organisms such as, in this case, beetles, both transcription and translation are essentially the same processes, and the genetic code used in the protein synthesis is also the same. The difference between beetles is the variation among DNA nucleotide sequences (genomes) which are used as templates to synthesize mRNAs, thereby their final products (proteins) are also different.

Why do the temperatures change over the months?
O A. Because the Moon is tilted on its axis, it reflects more sunlight on Earth during different times of Earth's yearly orbit.
B. Because the Sun is tilted on its axis, parts of Earth get more sunlight during different times of Earth's yearly orbit.
O C. Because Earth is tilted on its axis, the stars reflect more light during different times of the Earth's yearly orbit.
D. Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit.

Answers

Answer:

Answer

Explanation:

B because the more the sun is titled the more heat=different season.

Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit. As Earth orbits around the Sun, its axis is tilted at an angle of about 23.5 degrees. Hence the correct option is D.

Why do the temperatures change over the months?

The temperatures change over the months primarily because of Earth's axial tilt. As the Earth rotates around the sun, the angle at which sunlight hits different parts of the Earth changes.

This is because the Earth's axis is tilted about 23.5 degrees relative to its orbit around the sun. When a particular hemisphere is tilted toward the sun, it receives more direct sunlight, resulting in warmer temperatures.

Conversely, when that hemisphere is tilted away from the sun, it receives less direct sunlight, resulting in cooler temperatures. This cycle repeats itself annually, causing changes in temperatures over the months.

Hence the correct option is D.

To know more about Earth's axis:

https://brainly.com/question/14639935

#SPJ2

Freckles are a dominant trait in humans. Both of the girls have the genotype FF for freckles. If either one marries a man with no freckles, what are the chances that their children will have freckles?
A. 0%
B. 50%
C. 75%
D. 100%
The answer is D. 100%

Answers

Answer: 50%

Explanation: 2 out of 4 of possible offspring will have a genotype (Ff) that results in a dominant phenotype. ff = recessive non-freckled offspring.

How might we determine if the trait of albinism is sex-linked?

Answers

Answer:

Throught genetics varaition. Crossing over and all

Explanation:

Becuase I said so

A football team lost 14 yards on their first play then lost another 7 yards on the next play. what internet represents the total change in yards for the two plays?

Answers

Answer:

-21

Explanation:

Guessing autocorrect took "integer" and put in "internet"?

- 14 yards -7 yards = -21 yards

Why is it important for DNA replication to be a
highly regulated process?

Answers

Answer:

Here you go

Explanation:

DNA replication is regulated to ensure all chromosomes replicate once and only once per cell cycle.Cell cycle regulation by protein phosphorylation ensures that pre-RC assembly can only occur in G1 phase, whereas helicase activation and loading can only occur in S phase.

both plant and animal cells:
A) produce proteins
B) contain a large vacuole
C) photosynthesize
D) contain green pigments​

Answers

the answer should be b

How does the large intestine help the body excrete wastes?
It reabsorbs water from filtrate.
It forms urine.
It removes urea from the body.
It processes undigested food into feces.

Answers

Answer:

It processes undigested food into feces.

Explanation:

Answer:

D. It processes undigested food into feces.

Explanation:

Correct on EDGE 2021!

Which of the following applications of genetic engineering is preventative and helps
individuals fight infection before its onset?

A)Insulin production
B)Vaccine production
C)Stem cell therapy
D)Gene therapy

Answers

B I think(sorry if you get this wrong)
The answer is B very sure

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

state two factors on which the gravitational force between two objects depends.​

Answers

Answer:

Gravitational Force depends on two factors:

1. Product of mass of two object

2. Square of distance between their centers

Mathematically,

  F = G *(m1* m2)/d²

Explnation:

Question 5
Some human cells can perform anaerobic respiration for limited amounts of time, such as during periods of heavy exercise. Use the results of your experiment to explain how anaerobic respiration could benefit human survival.

Answers

Answer:

My experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

Explanation: from plato, so change it a bit.

The experiment showed that energy production, or respiration, occurred in yeast even when little oxygen was present. During exercise, the lungs must work hard to take in oxygen, which then circulates to the body parts that need it. The ability to preform anaerobic respiration for short periods of time allows humans to sustain activity, even when oxygen is limited in the body.

What is anaerobic respiration ?

Anaerobic respiration is respiration using electron acceptors other than molecular oxygen (O2). Although oxygen is not the final electron acceptor, the process still uses a respiratory electron transport chain.

In aerobic organisms undergoing respiration, electrons are shuttled to an electron transport chain, and the final electron acceptor is oxygen. Molecular oxygen is an excellent electron acceptor. Anaerobes instead use less-oxidizing substances such as nitrate (NO−3), fumarate (C4H 2O2−4), sulfate (SO2−4), or elemental sulfur (S). These terminal electron acceptors have smaller reduction potentials than O2. Less energy per oxidized molecule is released. Therefore, anaerobic respiration is less efficient than aerobic.

Learn more about  anaerobic respiration

https://brainly.com/question/13943624

#SPJ2

An organism, like a plant, that can make its own food is called (choose all
that are correct)
A. a heterotroph.
B. an autotroph.
C. a producer
D. a decomposer.

Answers

Answer:

B  

Explanation:

B. Autotroph

Explanation: An organism that produces its own nutrients from inorganic substances or from the environment instead of consuming other organisms.

What is the meaning of STEM

Answers

Answer:

Science, Technology, Engineering, and Math.

Answer:

problem solving creativity critical analysis

STEM is an approach to learning and development that integrates the areas of science, technology, engineering and mathematics. Through STEM, students develop key skills including: problem solving. creativity. critical analysis.

Explanation:

This should help! Have a great day!!

Plants make sugar from sunlight through ______.
A. Phloem

B. photosynthesis

C. Xylem

D. osmosis

Answers

Answer:

B. Photosynthesis

Explanation:

Photosynthesis is the process plants go through to make glucose, also known as sugar.

What is the final result of genetic drift in populations of

Answers

Answer: Genetic drift may result in the loss of some alleles (including beneficial ones) and the fixation, or rise to 100% frequency, of other alleles.Once it begins, genetic drift will continue until the involved allele is either lost by a population or is the only allele present at a particular gene locus within a population. ... Genetic drift can result in the loss of rare alleles, and can decrease the size of the gene pool.

Explanation:

Answer:

decrease the genetic diversity of a population.

Explanation:

Genetic drift describes random fluctuations in the numbers of gene variants in a population. Genetic drift takes place when the occurrence of variant forms of a gene, called alleles, increases and decreases by chance over time.

Genetic drift can cause a new population to be genetically distinct from its original population, which has led to the hypothesis that genetic drift plays a role in the evolution of new species.

Some evidence on the safety of vaccines.

Answers

Answer:

The safety an​d effectiveness of vaccines​ are under constant study. Because vaccines are designed to be given routinely during well-child care visits, they must be extraordinarily safe. Safety testing begins as soon as a new vaccine is contemplated, continues until it is licensed, and is monitored indefinitely after licensure.

Explanation:

Answer:

well

Explanation:

Before a vaccine is ever recommended for use, it’s tested in labs. This process can take several years. FDA uses the information from these tests to decide whether to test the vaccine with people.

During a clinical trial, a vaccine is tested on people who volunteer to get vaccinated. Clinical trials usually start with 20 to 100 volunteers, but eventually include thousands of volunteers. These tests can take several years and answer important questions like:

Bacteria Natural Selection

Answers

Answer:

Bacterial resistance arises through the simple process of natural selection. Bacteria divide rapidly, but DNA replication is imperfect. In the presence of antibiotics, while most bacteria are killed, a small number of resistant mutants may survive and take over.

Explanation:

When bacteria are initially exposed to an antibiotic, those most susceptible to the antibiotic will die quickly, leaving any surviving bacteria to pass on their resistant features

PLEASE HELP ITS DUE IN 3 HOURS!! 6. Match the correct definition to each vocabulary term:


Answers

Answer:

In order from top to bottom

C

A

E

D

B

Explanation:

1) Reflection is when a ray hits something reflective then bounces back. For example, light reflects off a mirror, which is why you can see yourself in a mirror.

2) Wavelength measures the size of a wave. It is measured from the crest or trough of one wave to the crest or trough of another.

3) Refraction occurs when waves go through different mediums at different speeds. This is why a straw looks bent when in water.

4) Frequency is a way of measuring the speed of a wave. It shows how many waves pass every unit of time.

5) Absorption means that all of the waves were absorbed into the medium and none of them passed through.

The energy needed for the changes in the water cycle to take place comes
from__.
A. wind
B.green plants
C.nitrogen
D.the sun

Answers

It’s D. I got it right lol

how does geosphere effect the rock cycle?​

Answers

Hydrosphere and Atmosphere: The erosion of rocks, a major part of the rock cycle and change in the geosphere over time, turns rock into sediment and then, sometimes, to sedimentary rock. ... Different combinations of sedimentary rocks form in environments with different climate conditions.

The ecosystem with the greatest sustainability will be the one that has the

Answers

Answer:

Different organisms or animals

Explanation: In a ecosystem, if you have different animals or organisms, it give them a better chance of survival, reason being that they can choose to eat whatever animal or organism they want because there is lots of animals to choose from the ecosystem. Basically the more diversity you have, the better chance you will survive, and the less diversity you have, the less chance of survival.

How is the ocean affected by the releasing of excess carbon?

Answers

Answer:

Explanation:

Because of human-driven increased levels of carbon dioxide in the atmosphere, there is more CO2 dissolving into the ocean. The ocean's average pH is now around 8.1 , which is basic (or alkaline), but as the ocean continues to absorb more CO2, the pH decreases and the ocean becomes more acidic.

Other Questions
A plant asset was purchased on January 1 for $140000 with an estimated salvage value of $20000 at the end of its useful life. The current year's Depreciation Expense is $10000 calculated on the straight-line basis and the balance of the Accumulated Depreciation account at the end of the year is $40000. The remaining useful life of the plant asset is Explain how you would graph the inequality: 3 x The Willis Tower In Chicago is 1,451 FEET tall. The Transamerica Pyramid is San Francisco is 10,236 INCHES tall. How do these two compare? Help I dont know this you dont have to explain:] One of the objectives for this lesson is to find the length of a curve using the z score. 40 POINTS !! 40 POINTS !!PLEASE HELP , DONT SKIP !NO LINKS OR FILES. heres another math question There is no court above all other courts in the U.S. Is the above statement true or false? 2. Why do you fall forward when you stub your toe on a chair? Explain in terms (meaning usethe words in the law in your answer) of inertia and Newton's llaw.STUBBEDMY TOES3. Why do you fly forward when hitting a curb while riding a skateboard or bike? Explain interms of inertia and Newton's 1" law.4. Come up with your own example of Newton's first lawl Again explain using inertia andNewton's l1st law pls help!! Bryant earns $15 in commission for every $150 worth of shoes that he sells. Which equation can be used to find the total commission, C, Bryant will earn if the cost, s, of the shoes he sells is known?a) c= 1/15s b) c=1/10sc) 10sd) c=15s Answer in Spanish in complete sentences.1. Qu lee Periquillo en casa del mdico? How does Samuel try to befriend Richard Jen has 3 bags of pears. Each Bag has 5 pears. If Jen gives the same number of pears to 4 friends, how many pears will each friend get? what are the disadvantages of alloys Describe the impact of motor vehicles and public transportation in urban areas below and provide examples of each. Why is the timing of activities considered convenient for many social group 1. Is this teddy(you A group of words that does not express a complete thought is called a Which piece of evidence did Wegener use to prove continental drift?a. The shape of the continentsb. Fossils found in strange places 9. Solve 6/7 divided by 36/56 and put answer in simplest form.A. 2/8B. 8/6C.4/3D. 6/8