If 0.583 g of ammonia (NH3) is dissolved to make 250 mL of solution, what is the molarity?

Answers

Answer 1

Answer:

0.137 M NH3

Explanation:

First divide the mass of NH3 by the molar mass of NH3, and then divide by the volume to get molarity.

0.583 g / 17.031 g/mol = 0.0342 mol NH3

0.0342 mol NH3 / 0.250 L = 0.137 M NH3


Related Questions

Wavelength whose frequency is 5.00 x10^15

Answers

The wavelength of the radiation whose frequency is 5 X 10^15s^-1 is 2.4 X 10^-6 inches, or 60 nanometers.

Differentiate liquid crystals from pure liquids and crystalline solids.
(Answer this question correctly and I will give the first correct answer brainliest)

Answers

Answer:

the difference between pure liquids and crystallines solids is pure liquids have optically active molecules forming twisted shapes whereas solids do not

Explanation:

H is a chemical
and H2 is a chemical
.

Answers

Answer:

H is monoatomic

while H2 is di-atomic

which taste sensation is produced by amino acids such as aspartic acid and glutamic acid?

Answers

Answer:

Savory. Savory taste is caused by amino acids. It's commonly brought on by aspartic acid or glutamic acid. Occasionally, savory is also called “umami” or “meaty.”

Explanation:

Hope this helps.

What is the formula for the ionic compound formed when potassium bonds with oxygen?

Answers

Answer:

A metal oxide with formula K2O. Potassium oxide (K2O) is an ionic compound of potassium and oxygen. It is a base. This pale yellow solid is the simplest oxide of potassium.

are protons attracted to neutrons or electrons or both?

Answers

Answer:

protons and electrons attract each other.

Explanation:

neutron as no charge,  proton and electron are exactly the same size but opposite. ( the opposite charge attract)

The protons possess a positive charge so they attract negatively charged electrons.

What is a proton?

A proton can be described as a stable subatomic particle, a symbol with a positive charge of +1e elementary charge. Proton's mass is slightly less than that of a neutron but 1836 times the mass of an electron.

Protons and neutrons are jointly referred to as "nucleons" each with masses of approximately one atomic mass unit. More than one proton can be present in the nucleus of an atom. They give the attractive electrostatic central force which holds the atomic electrons.

The number of protons in the nucleus is referred to as the atomic number and is represented by the symbol Z. Since each element in the modern periodic table has a unique number of protons, its own unique atomic number, determines the chemical characteristics of the element.

As the neutrons are neutral do not carry any charge so the protons do not attract neutrons.

Learn more about protons, here:

https://brainly.com/question/12535427

#SPJ2

Help pls What have you taken away from the work of Stephen Hawking?

Answers

When Stephen Hawking was diagnosed with ALS at age 21, he knew he had little time left. But he also knew he wanted to do so much more first. With these circumstances, he learned the importance of carpe diem .

How many significant figures in 100000 g?

Answers

Answer:

1

Explanation:

Any digit that is not 0 is always significant

Which group on the Periodic Table has elements that would easily combine with elements from Group 1 (which have one valence electron) because they have 7 valence electrons?

Answers

Answer:The halogens in Group 17

Explanation:  The halogens in Group 17 all have 7 valence electrons.  They will steal anuy electrons they can to form a full outer shell.

Who was the first to recognize that the observations and experimental results
regarding matter could be explained by the existence of atoms?
a. Grookes
b. Rutherford
c. Ballen
d. Chadwick

Answers

John Dalton was the first to theorize that all matter is made up of atoms but it was Rutherford who came up with what is now known as the Rutherford model which was a proposed description of the structure of atoms.

Someone pls help me I will make you brain

Answers

Answer:

the 3rd option is the answer

How many kilojoules are equivalent to 10 Joules?

A) 0.001 kJ

B) 0.01 kJ

C) 1000 kJ

D) 10,000 kJ

Answers

Answer:

It should be B: 0.01 kJ

Answer:

Hey...The answer is B) 0.01 kJ

Instructions
Click the links to open the resources below. These resources will help you complete the assignment. Once you have created your
file(s) and are ready to upload your assignment, click the Add Files button below and select each file from your desktop or network
folder. Upload each file separately.
Your work will not be submitted to your teacher until you click Submit.
Documents
Descriptive Lab Report Guide
El Descriptive Lab Report Rubric
File Upload
Accepted file types: .ppt, .pptx, xls, .xlsx, .doc, .docx, zip
, por accdb, .msg
.pd:
+ Add Files

PLEASE HELP!!!!

It won’t let me submit my file, how do I do it???
X
Delete All

Answers

Answer:

ok i will do the instructions

Explanation:

Answer:

Make sure that its an accepted file. If not try to refresh the page.

based on the activity series, which metal dissolves in hydrochloric acid to produce hydrogen gas, but does not react with steam or liquid water?

Answers

Answer: Iron

Explanation: does not react with water, but hydrochloric acid will dissolve them, displacing the hydrogen from the HCl. Iron reacts with hydrogen chloride to produce iron chloride, FeCl2 — sometimes known as ferrous chloride.

To solve such this we must know the concept of chemical reaction. Iron is the metal, which dissolves in hydrochloric acid to produce hydrogen gas, but does not react with steam.

What is chemical reaction?

Chemical reaction is a process in which two or more than two molecules collide in right orientation and energy to form a new chemical compound. The mass of the overall reaction should be conserved. There are so many types of chemical reaction reaction like combination reaction, double displacement reaction.

When metals react with acid the liberation of hydrogen gas take place.  Metal which is at top of reactivity series react with both acid and steam or liquid water. Iron is the only metals which dissolves in hydrochloric acid to produce hydrogen gas, but does not react with steam or liquid water.

Therefore, iron is the metal, which dissolves in hydrochloric acid to produce hydrogen gas, but does not react with steam.

Learn more about the chemical reactions, here:

https://brainly.com/question/3461108

#SPJ5

If a piece of metal has a density of 9.865 g and a volume of 14 ml, what is its mass?

Answers

Answer:

I think the answer is 138.11 gram

Explanation:

Explain how copper conducts electricity?

Answers

Answer:

Copper is a metal made up of copper atoms closely packed together. As a result, the electrons can move freely through the metal. For this reason, they are known as free electrons. They are also known as conduction electrons because they help copper be a good conductor of heat and electricity.

Explanation:

how many atoms of oxygen o are represented on the left side of the arrow in the chemical reaction

Answers

Answer:

two oxygen atoms on the left side of the arrow

3. Measure: Find the mass, volume, and density of each of the three crowns.
Mass (g)
Volume (cm)
Density (g/cm)

Answers

I think I found what your looking for

raw or undercooked shellfish may be contaminated with what type(s) of bacteria
vibrio vulnificus
salmonella
vibrio vulnificus and vibrio parahaemolyticus

Answers

Answer:

vibrio vulnificus and vibrio

Explanation:

Answer:

vibrio vulnificus and vibrio parahaemolyticus

Help me pls I will mark you as brain

Answers

Answer:

D. 1, 2, and 3

Explanation:

Someone pls help me I will make you brain

Answers

Answer: It has to be stratosphere because This region of the atmosphere is called the stratosphere. It is present in stratosphere According to NASA earth have 6 atmospheric layers..the layer just above the earth is troposphere and above this layer is the stratosphere.

Explanation:

Which diagram or diagrams represent a compound?

Answers

Answer:

A - X Only

Explanation:

helppppppppppppppppp​

Answers

Answer:

23: 6000560000000

24: 0.0015

25: 200

26: 0.0105

27: 600

28: 4023000

Explanation:

You have to move the decimal the same amount of times as the exponent says.

For example, like with the 6, you move it 2 decimals to the right (since it's positive), and the regular number would be 600.

What’s the elements found in these formulas?

NaC2HO4

H2F5BLi

2He2PSO4

3He2O4PH

Answers

Answer:

The only one I know is NaC2HO4.

There is Sodium, Carbon, Hydrogen and Oxygen.

1 atom in sodium, 2 atoms in carbon, 1 atom in hydrogen and 4 atoms in oxygen completeting the total of 8 atoms in this element.

The elements are the simplest chemical forms and they cannot be broken down through chemical reactions. There are many elements in the given formulas.

What are elements?

The elements are defined as those substances whose atoms all have the same number of protons. The elements are considered as the building blocks of matter. Each element has an atomic number and a symbol.

Each atom is regarded as an element. The elements create bonds to form molecules. The isotopes are the elements with the same atomic number but different mass numbers.

NaC₂HO₄  - 'N' , 'C', 'H','O'

H₂F₅BLi - 'H','F','B','Li'

He₂PSO₄ - 'He', 'P','S','O'

He₂O₄PH - 'He', 'O','P','H'

To know more about elements, visit;

https://brainly.com/question/29545466

#SPJ2

How much energy does orange light have if its wavelength is 615 nm?

Use the ROYGBIV (red, orange, yellow, green, blue, indigo, violet)

Answers

Answer:

it would be 615

Explanation:

Why can liquid metal be poured into a block-shaped mold?
Describe what happens to the shape and volume of the liquid
metal.

Answers

Answer:

yes

Explanation:

because

How many moles in 5.75 x 1024 atoms of copper (Cu)? (9.55 mol)

Answers

Answer:

9.55 moles

Explanation:

How many moles are equivalent to 5.75x1024 atoms of Al? 9.55 moles contain 5.75 x 1024 atoms of Al

Someone pls help me I will make you brain

Answers

Answer:3

Explanation:

as the temperature of a gas sample at constant pressure increases, the volume of the gas will _____ and there will be _____ gas particles in the same space. the density of a gas at constant pressure therefore _____ as the temperature increases.

Answers

Answer:

Increase

Less/low number

Lessen

Explanation:

Increase > Increase in temperature cause increase in volume.

Less/low number > As volume increases the number of particles to be adjusted in the same space will be lesser than before.

Lessen> At constant pressure as increase in temperature cause increase in volume so the density will lessen due to increase in volume. Density equation is given below.

Density = mass /volume

If volume increases density will get lowered.

If the net force acting on a stationary object is zero, how will the object’s motion be affected?

Answers

Answer:

remain at rest

Explanation:

Other Questions
Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3